ID: 1196610714

View in Genome Browser
Species Human (GRCh38)
Location X:117711546-117711568
Sequence AAACCATCCATAGCATCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196610714_1196610715 11 Left 1196610714 X:117711546-117711568 CCTAAGGATGCTATGGATGGTTT No data
Right 1196610715 X:117711580-117711602 AGTGCAACTATGTAGTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196610714 Original CRISPR AAACCATCCATAGCATCCTT AGG (reversed) Intergenic
No off target data available for this crispr