ID: 1196613776

View in Genome Browser
Species Human (GRCh38)
Location X:117743676-117743698
Sequence TGCCTGGGTGTGGAGTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196613776_1196613786 25 Left 1196613776 X:117743676-117743698 CCTCTGGACTCCACACCCAGGCA No data
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613776_1196613782 11 Left 1196613776 X:117743676-117743698 CCTCTGGACTCCACACCCAGGCA No data
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data
1196613776_1196613783 17 Left 1196613776 X:117743676-117743698 CCTCTGGACTCCACACCCAGGCA No data
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196613776 Original CRISPR TGCCTGGGTGTGGAGTCCAG AGG (reversed) Intergenic
No off target data available for this crispr