ID: 1196613777

View in Genome Browser
Species Human (GRCh38)
Location X:117743686-117743708
Sequence CCTGGAGATATGCCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 5, 1: 35, 2: 69, 3: 169, 4: 466}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196613777_1196613786 15 Left 1196613777 X:117743686-117743708 CCACACCCAGGCATATCTCCAGG 0: 5
1: 35
2: 69
3: 169
4: 466
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613777_1196613782 1 Left 1196613777 X:117743686-117743708 CCACACCCAGGCATATCTCCAGG 0: 5
1: 35
2: 69
3: 169
4: 466
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data
1196613777_1196613783 7 Left 1196613777 X:117743686-117743708 CCACACCCAGGCATATCTCCAGG 0: 5
1: 35
2: 69
3: 169
4: 466
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196613777 Original CRISPR CCTGGAGATATGCCTGGGTG TGG (reversed) Intergenic
900148906 1:1169774-1169796 TCTGGAGATAGCCCCGGGTGGGG - Intergenic
900355459 1:2260015-2260037 CCTGGATAGATACCTAGGTGTGG + Intronic
900433279 1:2612798-2612820 CCTGGAGAGATGTATGGGAGAGG + Intronic
900804955 1:4761475-4761497 CTTGGAGATCTGTCTGGCTGTGG - Intronic
901906215 1:12413944-12413966 CTTGGACATATACCTGGGAGTGG - Intronic
901936408 1:12630126-12630148 CCTGCAGATATGCAGGGGTTGGG - Intergenic
903137709 1:21320218-21320240 CCTGGAGATAGTCGTGGGCGGGG - Intronic
903550793 1:24156422-24156444 TCTGCAGCTACGCCTGGGTGTGG - Exonic
904068446 1:27773462-27773484 CCCGGGGACAGGCCTGGGTGAGG + Intronic
904265445 1:29316031-29316053 CCTGGAGGCCTGCCTGTGTGGGG + Exonic
904289122 1:29472220-29472242 CCCAGAGACCTGCCTGGGTGGGG + Intergenic
904559483 1:31387062-31387084 CGTGGGGATGTGTCTGGGTGTGG - Intergenic
904559607 1:31387655-31387677 CGTGGGGATGTGTCTGGGTGTGG - Intergenic
904559616 1:31387692-31387714 CGTGGGGATGTGTCTGGGTGTGG - Intergenic
904684844 1:32252422-32252444 CCTGGAAATCTGGCTGAGTGAGG - Intronic
905202557 1:36323833-36323855 GCTGGAGCTCTGCCTGCGTGCGG + Exonic
909267365 1:73577490-73577512 CCTGGAGATCTACCTGGGCATGG - Intergenic
909419775 1:75450730-75450752 CCTGGAAATCTGCCTGGGCATGG - Intronic
909836405 1:80260591-80260613 CTTGGATATCTGCCTGGGTGTGG - Intergenic
910558018 1:88558296-88558318 GCTGGAGATATGGTGGGGTGGGG - Intergenic
911073714 1:93852508-93852530 CTTGGGGATATGCCTAGGAGTGG - Intergenic
912040431 1:105383365-105383387 CCTGGAGATCTGCCTGGGCATGG + Intergenic
912075716 1:105873121-105873143 CCTGGATATCTGCCTGGGTGTGG + Intergenic
912476058 1:109935740-109935762 CCTGGAGATCTGGCTGGGTGTGG - Intergenic
913368704 1:118071996-118072018 CCTGTTGATATGCCTTTGTGTGG - Intronic
914479844 1:148055782-148055804 CCTGATGACATGCCTCGGTGTGG + Intergenic
915581405 1:156815209-156815231 CCTGGGGAGATGCCTGGATCAGG + Exonic
915608940 1:156975014-156975036 CTTGGATATATACCTGGGAGTGG + Intronic
915962940 1:160282361-160282383 GCTGGAGAAATGTCTGGGAGTGG + Intronic
917732668 1:177891751-177891773 CCTGGAGTTCTGCCTGGGGGTGG - Intergenic
917732736 1:177892089-177892111 CCTGGAGATCTGCCTGGGCATGG - Intergenic
917980917 1:180268512-180268534 CCAGGAGATCTCCCTGTGTGGGG - Intronic
918667594 1:187171624-187171646 CTTGGAATTATGCCTGGGTGTGG + Intergenic
918740809 1:188128396-188128418 CCTGGGGATATGCCTGATTGTGG - Intergenic
918925602 1:190782083-190782105 CCTGGAGATCTGCCTGGGCATGG - Intergenic
918925631 1:190782279-190782301 CCTGGGGATGTGCCTGAGTGTGG - Intergenic
919584271 1:199416555-199416577 CCTGGAGATCTGCCTGGGCATGG - Intergenic
919593821 1:199537629-199537651 TTTGGAGATATGCCTGGGTGTGG - Intergenic
919593885 1:199537962-199537984 CCTGGAGATCTACCTGAGTATGG - Intergenic
920079013 1:203358665-203358687 CCTGGAGAGGAGCCTGGGTGTGG - Intergenic
920732038 1:208496663-208496685 CCTGGAGACATGCCTAGGCATGG + Intergenic
920732057 1:208496762-208496784 CCTGGAGAGCTGCATGGGTATGG + Intergenic
920732100 1:208496981-208497003 CCTGGAGATCTGCCTGAGTGTGG + Intergenic
921229474 1:213053739-213053761 CCTGGAGGTATGAATGTGTGTGG + Intronic
921340442 1:214129039-214129061 CCTGGATATATGCAGTGGTGGGG - Intergenic
921440642 1:215182190-215182212 CCTGGAGATCTGCCTGGGTGTGG + Intronic
922003528 1:221504653-221504675 CCTGGAGATCTGTCTGAGTATGG - Intergenic
922068855 1:222170850-222170872 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
922763609 1:228146751-228146773 CCTGCAGGCATGCCTGGGTTGGG + Intronic
924683276 1:246260057-246260079 CCTGGAGATCTGTCTGGGCATGG + Intronic
924893058 1:248306168-248306190 CCTGGAGATGTCTCTGGATGGGG + Intergenic
1062834459 10:626658-626680 CCTGGGGAAATGCCTGCATGGGG + Intronic
1063181721 10:3607394-3607416 CCTGGAGAACTGCCTGGGCCTGG - Intergenic
1064988821 10:21237895-21237917 CAGGGAGATATGGCTGGATGTGG - Intergenic
1065047127 10:21754568-21754590 CCTGGCCATATGCCAGGCTGGGG - Intergenic
1065204238 10:23342863-23342885 CCTGGAGCTGTGTCTGTGTGAGG + Intronic
1065835339 10:29652575-29652597 CTTGGGGATATGCCTAGGAGTGG + Intronic
1066620581 10:37345138-37345160 GCTGGTGAAATGCTTGGGTGAGG + Intronic
1066623839 10:37385675-37385697 GCTGGTGAAATGCTTGGGTGAGG + Intergenic
1067221628 10:44348123-44348145 CCTGGAGAAAGGCCTCTGTGAGG + Intergenic
1067234497 10:44436537-44436559 CCTGGAGAGCTTCCTGGGAGAGG - Intergenic
1067363708 10:45605239-45605261 CTTGGAGAGATGCCTGATTGTGG - Intergenic
1069227990 10:65968486-65968508 CCTGGAGATCTGCCTGGGTATGG - Intronic
1069346437 10:67476256-67476278 CCTGGAGATCTGCCTGGGCATGG - Intronic
1069346468 10:67476435-67476457 CCTGGAGATCTGTCTGGGAGTGG - Intronic
1069346491 10:67476540-67476562 CCTGGAGATATGCCTGGGTATGG - Intronic
1069346526 10:67476771-67476793 CCTGGAGATATGCAGGGGTATGG - Intronic
1069346546 10:67476884-67476906 CCTGGAGATCTGCTTGAGGGTGG - Intronic
1069346581 10:67477111-67477133 CCTTGAGATCTGCCTGGGTGTGG - Intronic
1070050434 10:72883595-72883617 GCTGGAGATATACCTAGGAGTGG - Intronic
1070584379 10:77750839-77750861 CCTGGAGATTTGGTTGGGGGAGG - Intergenic
1070832707 10:79429975-79429997 CCTGGAGCTATGGCCAGGTGAGG + Intronic
1071064487 10:81614506-81614528 CCTGGTGAAATGCATGGGTGAGG - Intergenic
1071302116 10:84263752-84263774 CCTGGACATATGCTTGGGGTGGG - Intergenic
1075180202 10:120204448-120204470 TCCGGAGATCTGCCTGGATGTGG + Intergenic
1076676881 10:132151695-132151717 CCCTGAAATAGGCCTGGGTGGGG - Intronic
1076944792 10:133638299-133638321 CCCGGAGATTCGCCTGGGGGTGG - Intergenic
1077274856 11:1699895-1699917 CCTGGTGATGTCCCTGAGTGTGG - Intergenic
1078014899 11:7604604-7604626 GCTGGACAAATGCATGGGTGTGG - Intronic
1078941077 11:16006591-16006613 GCTGGAGATAAGCCTAGGTTTGG - Intronic
1079236349 11:18693401-18693423 CCTGGAGGAATGCCTGGGCTGGG + Intronic
1079256314 11:18834383-18834405 CCTGGAGATCTGACTGAGTGTGG + Intergenic
1079256350 11:18834597-18834619 CCTGGAGATGTGCCTGGATATGG + Intergenic
1079258397 11:18852878-18852900 CCTGGAGATCTACCTGGGCATGG - Intergenic
1079743965 11:24101518-24101540 CCTGGAGATATGCCTAAGCATGG - Intergenic
1082948655 11:58787878-58787900 CCTGGAGATCTGCCTGAGTGTGG - Intergenic
1082948705 11:58788208-58788230 CCTGAAGATCTGCCTGGGCAAGG - Intergenic
1083623161 11:64058893-64058915 CCTCCAGCTGTGCCTGGGTGTGG - Intronic
1083737732 11:64691231-64691253 CCTGGAGCTCAGCCTGGATGTGG + Intronic
1084018437 11:66401785-66401807 GCAGGATATATGGCTGGGTGTGG - Intergenic
1084143989 11:67254060-67254082 CCTGAAGGCATGGCTGGGTGTGG + Intronic
1084426375 11:69086616-69086638 CATGGAGAACAGCCTGGGTGGGG - Intronic
1084664241 11:70567860-70567882 CCTGCAGCTATTCCAGGGTGTGG - Intronic
1084872937 11:72109928-72109950 CCTGGAGAGGAGGCTGGGTGTGG + Exonic
1084941712 11:72616697-72616719 CCTGCAGAGGTGCCTGGGAGAGG - Intronic
1085384567 11:76149723-76149745 GCAGGGGATATGGCTGGGTGGGG + Intergenic
1086494066 11:87384623-87384645 CCTGGATTTCTGCCTGGGGGTGG - Intergenic
1086755591 11:90558096-90558118 CCCGGAGATTTGCCTGGGCATGG - Intergenic
1086755640 11:90558435-90558457 CCCAGACATATGCCTAGGTGTGG - Intergenic
1087356219 11:97097867-97097889 CCTGGAGATTTGCCTGGGTGTGG - Intergenic
1087562053 11:99802836-99802858 CTTGGAAATATGCCTGAATGTGG + Intronic
1087673440 11:101131591-101131613 CCTGGATATATGCATAGGAGTGG + Intergenic
1088425384 11:109696379-109696401 CCTGGAGTTCTGCCTGAGGGTGG - Intergenic
1088425441 11:109696718-109696740 CCTGGAGATCTGCCTGGGCATGG - Intergenic
1088425483 11:109696943-109696965 CCTGGAGATATGCCTGGGTGTGG - Intergenic
1088470963 11:110187278-110187300 CCTGGAGGTCTCCCTGAGTGTGG - Intronic
1089224488 11:116905455-116905477 CTTGGATATATACCTGGGAGTGG + Intronic
1089288013 11:117420070-117420092 ACTGTAGAAATGCCTGGGGGAGG + Intergenic
1090483248 11:127086513-127086535 CCTGGAGATCTGACTGGGCATGG - Intergenic
1090483276 11:127086631-127086653 CCTGGAGATCTGCCTGGATGTGG - Intergenic
1090483291 11:127086742-127086764 CCTGGAGATCTGCCTGGGCATGG - Intergenic
1090629957 11:128637332-128637354 CCTGGAGATCTGTCTGGGCATGG - Intergenic
1090629988 11:128637553-128637575 CCTGGAGGTCTGCCTGGGCATGG - Intergenic
1092090769 12:5802050-5802072 CCTGGACATATGACTTGGGGAGG - Intronic
1092674555 12:10901276-10901298 CCTGGAAATCTGCCTGCTTGTGG - Intronic
1093134793 12:15437564-15437586 CCTGGAGATTTGCCTGAGCATGG - Intronic
1093134812 12:15437677-15437699 CCTGCAGATCTTCCTGGGTGTGG - Intronic
1093695691 12:22157633-22157655 CCTGAAGATATTCATGTGTGTGG - Intronic
1093706117 12:22276499-22276521 CCTGGAGGGCTGCCTGGGGGAGG + Intronic
1093809282 12:23472651-23472673 CCTGGAGATCTTCCTGGGTGTGG - Intergenic
1093809319 12:23472877-23472899 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1093809340 12:23472989-23473011 GCTGGAGATCTGCCTGGGCATGG - Intergenic
1094452926 12:30601360-30601382 CCTGGAGATCTGCCTGGGCATGG - Intergenic
1094452961 12:30601585-30601607 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1095400916 12:41814045-41814067 CCTGGAGATTGGCCTGGGAATGG + Intergenic
1095400981 12:41814383-41814405 CCTAGAGATCTGCCTGGGTGTGG + Intergenic
1095626211 12:44318193-44318215 CCTGGAGATATGCCTAAGCATGG + Intronic
1095780005 12:46048907-46048929 CCTGGAGATCTGCCTGGACATGG - Intergenic
1095780060 12:46049246-46049268 CTTAGAGATCTGCCTGGGTGTGG - Intergenic
1095844984 12:46734901-46734923 CCTGAAGATCTGCCTTGGTGTGG - Intergenic
1095866995 12:46983313-46983335 CCTGGAGATTTGCCTGGGTGTGG - Intergenic
1095915606 12:47475052-47475074 CTTGGAGATCAGCCTGGGTGTGG - Intergenic
1095915629 12:47475165-47475187 CCTGGAGATCTGCCCGGATATGG - Intergenic
1095915691 12:47475499-47475521 CCTGGAGCTCTGCCTGGGTGTGG - Intergenic
1096189850 12:49609400-49609422 CCTGAAGATCTGCCTGGGTGTGG - Intronic
1097662495 12:62446072-62446094 CCTGGAAATCTGCTTGAGTGTGG + Intergenic
1098371742 12:69767645-69767667 CCTGGAGGTCTGCCTGGGCGTGG + Intronic
1098371834 12:69768209-69768231 CCTGGAGATCTGCCTGGGCATGG + Intronic
1098371855 12:69768323-69768345 CCTGGAGATCTGCCTGGATATGG + Intronic
1098678033 12:73315761-73315783 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1098678066 12:73315969-73315991 CCTGGATTTATGCTTGGGGGTGG + Intergenic
1098839280 12:75459584-75459606 CCTGGAGATATGCTTGGATGTGG - Intergenic
1099230126 12:80013986-80014008 CCTGGAGAAATGCTTGGGTGAGG + Intergenic
1099768415 12:87020860-87020882 CCTAGACATTTGCCTGGGTGTGG - Intergenic
1099901535 12:88716503-88716525 CCAGGTGATATGCCTGGGGAAGG + Intergenic
1099901549 12:88716628-88716650 CCTGGAGTTATGTCCAGGTGTGG + Intergenic
1100931907 12:99619237-99619259 CCTGGAAATCTGCCTGGGCATGG - Intronic
1101441771 12:104709255-104709277 CCTGGAGCGAACCCTGGGTGTGG - Intronic
1103558498 12:121779879-121779901 GCTGGAGAGAGGCCAGGGTGGGG - Exonic
1105236132 13:18555187-18555209 TCTGGAGGTCTGCCTGAGTGTGG + Intergenic
1106016104 13:25870381-25870403 CCTGGACACAGGCCTGGGGGTGG + Intronic
1106467347 13:30024736-30024758 CCTGGAGGGACGGCTGGGTGAGG + Intergenic
1107158540 13:37198185-37198207 CCTGAAGATATGCCTGGGGGTGG + Intergenic
1107297163 13:38921651-38921673 CCTGGTGATATGCCTGGGTTTGG - Intergenic
1107438189 13:40400657-40400679 CCTGGAATTATGACTGCGTGTGG - Intergenic
1107719833 13:43236286-43236308 CCTGGGGATATGGCTTGGTTTGG + Intronic
1108864975 13:54912081-54912103 CCTGGATATCTGTCTGGGAGTGG - Intergenic
1109046994 13:57425601-57425623 CCTGGAGATCTGCCTGGTCCTGG - Intergenic
1109095404 13:58107728-58107750 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1109095422 13:58107850-58107872 CCCAGAGATCTGCCTGGGTATGG + Intergenic
1109095457 13:58108076-58108098 CCTGGAGATCTGCCTAGTTGTGG + Intergenic
1109309098 13:60671716-60671738 CCCAGAGGTATGCCTAGGTGTGG + Intergenic
1109309202 13:60672282-60672304 CCTGGTGATCTGCCTCCGTGTGG + Intergenic
1109309226 13:60672392-60672414 CCTGGAGATCTGCCTGGTTATGG + Intergenic
1110106743 13:71686382-71686404 CCTGGCGATCTGTCTGTGTGTGG - Intronic
1110128586 13:71978912-71978934 CCTGGAGGTCTGCCTGAGTATGG - Intergenic
1110628601 13:77679480-77679502 GCTGGAGAAATGCCTGGGCAAGG - Intergenic
1110638236 13:77791009-77791031 CCTGTAGATCTGCCTGGGCATGG - Intergenic
1110638282 13:77791345-77791367 CCTGGAGATCTGCCTGGGTTTGG - Intergenic
1110742974 13:79019029-79019051 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
1111041720 13:82757513-82757535 CCTGGACTTATGTCTGGGTGTGG - Intergenic
1111143662 13:84154599-84154621 GCTGGAGGTCTGCCTGGATGTGG + Intergenic
1111271841 13:85896533-85896555 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1111496884 13:89062247-89062269 CCTGGAGATTTGCCTCAGTGTGG + Intergenic
1112078277 13:95936696-95936718 CCTGAAGATCTGCCTGGGCATGG + Intronic
1112223468 13:97514503-97514525 CCTGGAGATCTGCCTGGGAATGG + Intergenic
1113092463 13:106630083-106630105 CCTGGAGAGATGCCGGAGTGAGG + Intergenic
1113214300 13:108020217-108020239 CCTGGAGATCAGCCTGGGTGTGG - Intergenic
1113294067 13:108938610-108938632 CCTGGAGATCTGCCTGGGCATGG + Intronic
1113872595 13:113569381-113569403 CTTGGATATATTCCTGGGAGTGG + Intergenic
1114832730 14:26164390-26164412 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
1114832768 14:26164617-26164639 CCTGGAGTTCTGCCTGGGGATGG + Intergenic
1114860883 14:26520131-26520153 CTTGTAAATATGCCTGTGTGAGG + Intronic
1115941735 14:38617889-38617911 CCTGAAGATATGTCCGGATGTGG - Intergenic
1115963536 14:38862835-38862857 CCTGGAGAGCTGCCTGAGTGTGG + Intergenic
1116222788 14:42110784-42110806 CCTGGAGAAATGCCTGGCCATGG + Intergenic
1116574708 14:46558023-46558045 CCTGGAGATCTGCCTGGACTTGG + Intergenic
1116681317 14:47973582-47973604 CTTGAAGATCTGCCTGGGTGTGG - Intergenic
1116681334 14:47973711-47973733 CCTAGAGATCTGCCTGGGAATGG - Intergenic
1116781369 14:49241062-49241084 CCTGGAGAACTGCCTGAGTATGG + Intergenic
1117560388 14:56932014-56932036 CCTAAAGATATGCCTGCATGTGG + Intergenic
1117719883 14:58618998-58619020 CGTGGAGATGCGGCTGGGTGTGG + Intergenic
1117824444 14:59687328-59687350 CCTGGAGATCTGCCTAGGCATGG - Intronic
1117824586 14:59688238-59688260 GCTGGAGATCTGCCTGGGAATGG - Intronic
1118315051 14:64721117-64721139 GCTGTAGATATCCTTGGGTGGGG + Intronic
1118805671 14:69234822-69234844 CTTGGAAAAATGCCAGGGTGTGG + Exonic
1119220539 14:72903014-72903036 CTTGGAGATATACCTAGGAGTGG - Intergenic
1120121040 14:80680417-80680439 CCTGGAGATCTTCCTGGGCATGG - Intronic
1120121056 14:80680530-80680552 CCTGGATATTTGTCTGCGTGTGG - Intronic
1120238795 14:81925340-81925362 CCTGGAGATATGAGTGAGGGTGG + Intergenic
1120279403 14:82420063-82420085 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1120454981 14:84718988-84719010 GCTGGAGATCTGCCTATGTGTGG - Intergenic
1121075435 14:91064338-91064360 CCTAGGGAGAAGCCTGGGTGCGG + Intronic
1122202758 14:100132529-100132551 CCTGGACATTTGCCTGGGCCTGG + Intronic
1122359922 14:101153081-101153103 CCTGGAGGGAGGCCTGGGGGAGG - Intergenic
1122680937 14:103462224-103462246 TCTGGAGAAATTCATGGGTGAGG - Intronic
1122809762 14:104282095-104282117 CATGGAGCCAGGCCTGGGTGGGG + Intergenic
1123138000 14:106048320-106048342 TCTGGGGATATTCCTGGGAGAGG - Intergenic
1123210978 14:106760584-106760606 CCTGGAGAAAAGCCTGCATGGGG + Intergenic
1125130455 15:36278707-36278729 CCTGGAGATGTGCCTGGCCATGG + Intergenic
1125130541 15:36279243-36279265 CCTGGAGATCTGCCTGGGTATGG + Intergenic
1125130578 15:36279467-36279489 CCTGGATTTCTGCCTGGGGGTGG + Intergenic
1125355121 15:38809423-38809445 CCAGGGGCTTTGCCTGGGTGGGG + Intergenic
1125371639 15:38983996-38984018 CCTGGAGATCTGCCTGGACAGGG + Intergenic
1126764972 15:52002609-52002631 TCTGGAGAGATTCCTGTGTGGGG - Intronic
1127705588 15:61544505-61544527 GCTGGAGATGTGGGTGGGTGTGG + Intergenic
1128160685 15:65421561-65421583 CCTGGAGATGGGCCTGGGGCTGG + Intronic
1128543822 15:68554459-68554481 GCTGGAGATCTGCCTGGGGGAGG - Intergenic
1128678282 15:69627701-69627723 CCTGGAGATGTGCTTGGATGGGG + Intergenic
1128715743 15:69906434-69906456 CCTGGGGACATGCCTAGGAGAGG - Intergenic
1128888347 15:71308741-71308763 CTTGGGTATATGCCTGGGAGTGG + Intronic
1129091586 15:73156905-73156927 CCTGGTGAAATTCTTGGGTGAGG + Intronic
1130715534 15:86329885-86329907 CCTGGAGATCTGCCTGGGCATGG - Intronic
1131585095 15:93684446-93684468 CCTGGAGATCTGCCTGGGTATGG - Intergenic
1131610614 15:93957430-93957452 CATGGAGAAATGGCTGGGTCAGG + Intergenic
1131698767 15:94909968-94909990 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1132477045 16:145001-145023 CCGGGAGAGATGCCTCCGTGAGG - Intergenic
1133642134 16:7727220-7727242 GCTGGGGATATGAGTGGGTGGGG - Intergenic
1133772892 16:8878070-8878092 CCTGGAGGTCTGCCTGGTGGAGG - Intergenic
1134453456 16:14377479-14377501 GCTGGGCATATGCCTGGGAGTGG - Intergenic
1135675701 16:24413203-24413225 CCTGGAGATGGGACTGGGTGAGG - Intergenic
1136080880 16:27851937-27851959 CCTGGAGCTACCCCTGGGTGAGG + Intronic
1136640201 16:31557675-31557697 CCTGGAAATATGCCTGGGCAAGG - Intergenic
1137842839 16:51655847-51655869 CCTGGGGATCTGTCTGGGTGTGG + Intergenic
1139342565 16:66278035-66278057 CCTAGAGAACAGCCTGGGTGTGG - Intergenic
1139342602 16:66278261-66278283 CCTGCAGATCTGACTGGGTTTGG - Intergenic
1139845285 16:69916690-69916712 ACTGAAGAAAGGCCTGGGTGTGG + Intronic
1141152528 16:81574184-81574206 TCTGGAGGGATGCCTGGCTGAGG + Intronic
1141210310 16:81973528-81973550 CCTGGACATCTGCCTGGGCATGG - Intergenic
1141210329 16:81973641-81973663 CCTAGAGATATGCCTGGGCATGG - Intergenic
1141564756 16:84893723-84893745 CCTGCAGAGACACCTGGGTGTGG + Intronic
1141621037 16:85236510-85236532 CCTGTGCATAGGCCTGGGTGTGG + Intergenic
1141919435 16:87126123-87126145 GCAGGAGATATGTCTGGATGGGG - Intronic
1142501383 17:335117-335139 CCAGCAGATATGCTTGGCTGGGG + Intronic
1142505912 17:363023-363045 CCGGGAAATAAGGCTGGGTGCGG + Intronic
1143577501 17:7803074-7803096 CCTGGAGAACTGCTTGGGTGGGG - Intronic
1143771119 17:9169572-9169594 CCTGGAGGATTGGCTGGGTGCGG + Intronic
1144399957 17:14886619-14886641 CCAAAAGTTATGCCTGGGTGGGG + Intergenic
1144399977 17:14886731-14886753 CTTGGAGATCTGCCTGAGTATGG + Intergenic
1144664720 17:17094456-17094478 CATGAAGATATGCCTTGGTGTGG + Intronic
1144873149 17:18382723-18382745 CCTGGGGATAGGGGTGGGTGGGG + Intronic
1145974177 17:28974851-28974873 CCAGGAGATAGGCCTGTCTGTGG - Intronic
1146000765 17:29129022-29129044 CCTGGAGTTAGGCCTGGGATTGG - Intronic
1146380505 17:32323856-32323878 CCTGGGGAGAGGCCTGGGTCAGG - Exonic
1146640879 17:34540463-34540485 CCTAGAGATCAGGCTGGGTGCGG - Intergenic
1146787243 17:35731396-35731418 CCTGGTGACAGGCCTGGGCGAGG + Intronic
1147324913 17:39665548-39665570 CCTGGAGAAATTTCTGGGGGTGG + Intronic
1147981518 17:44277508-44277530 CCAGGAAACATGGCTGGGTGCGG + Intergenic
1148497395 17:48061121-48061143 CCTGGAGGGCTGCCTGGGGGAGG + Exonic
1148553411 17:48564122-48564144 CCAGGAGAGAGGCCTGGGGGCGG + Intronic
1148765419 17:50035949-50035971 TCTGGAGATAAGCCTTGATGAGG - Intergenic
1149112089 17:53046353-53046375 CCTGGAAATCTGCCTGGGGGTGG - Intergenic
1149112127 17:53046577-53046599 CCTGGAGATCTACCTGGATGTGG - Intergenic
1149607488 17:57935507-57935529 CCAGGAAATATGCCTGGGGCCGG + Intronic
1150630741 17:66878745-66878767 CCTGGAGAAGCGCCTGTGTGAGG - Intronic
1151748093 17:76022308-76022330 CCTGGGGATAGGGGTGGGTGGGG - Intronic
1151814361 17:76464048-76464070 TCTGGAGTCCTGCCTGGGTGCGG + Intronic
1152941994 17:83177671-83177693 CCTGGGGCAAGGCCTGGGTGAGG + Intergenic
1153092996 18:1369719-1369741 CCTTGAGATATGCATGCATGAGG + Intergenic
1153266280 18:3273192-3273214 TCTGGAGAGATTTCTGGGTGTGG + Intronic
1154513410 18:15134811-15134833 TCTGGAGGTCTGCCTGAGTGTGG - Intergenic
1155037043 18:22033470-22033492 CCTGGAGCTCTGCCTGGAGGTGG - Intergenic
1155663713 18:28282108-28282130 CCTGGAGATCTGCCTGGTCATGG - Intergenic
1155663727 18:28282221-28282243 CCTGGAAATCTGCCTGGGTATGG - Intergenic
1156052151 18:32950629-32950651 ACTGGTGATATGGCTGTGTGGGG + Intronic
1156084248 18:33379939-33379961 CCTGGAGAACTGGCTGGGTGTGG + Intronic
1156426552 18:37019777-37019799 CCTGGAGATCTGCCTGGGCATGG + Intronic
1156781603 18:40857237-40857259 CCTGGAGAGATGTCAGGATGTGG - Intergenic
1156886456 18:42141174-42141196 CCTGGAGATCTGCCTGGGCATGG - Intergenic
1157936056 18:51874239-51874261 CCTGGAGATCTGCCTTCATGTGG + Intergenic
1157940328 18:51921604-51921626 TCTGGAGATCTGCCTGAGAGTGG - Intergenic
1157940348 18:51921717-51921739 CCTGGAGATCTGCCTGGGCATGG - Intergenic
1158303980 18:56084293-56084315 ACTGGAGATGTGGCTGCGTGTGG - Intergenic
1159303987 18:66616113-66616135 CCTGGAGATCTGCCTAGGTGTGG - Intergenic
1159304017 18:66616273-66616295 CATGGAGATCTGCCTGGGTGCGG - Intergenic
1159320243 18:66838815-66838837 CCTGGAGACATGCTTGGGCATGG - Intergenic
1159723157 18:71919208-71919230 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1159723182 18:71919321-71919343 CCTGGAGATTTGTCTGGTTGTGG - Intergenic
1159998498 18:74992311-74992333 TCTGGAGATGGCCCTGGGTGGGG + Intronic
1160440289 18:78884345-78884367 CCTGGAGATTTGCCTGGGTGTGG - Intergenic
1160456618 18:79006425-79006447 CCAGGGGACATGCCTGGGGGTGG - Intergenic
1160786391 19:901870-901892 CCATGAGCTGTGCCTGGGTGGGG - Intronic
1160791568 19:925948-925970 CCTGGTGATTTGTCTGGGGGTGG + Intronic
1161020052 19:2005280-2005302 CCTGGATAAATGCCTCGGAGTGG + Intronic
1161542357 19:4859769-4859791 CCTGGTCATTTCCCTGGGTGGGG - Intronic
1163082537 19:14954277-14954299 CCTGGAGGAGGGCCTGGGTGTGG - Exonic
1164044283 19:21522129-21522151 CCTGCAGAAATGGCTGGATGGGG - Intronic
1164486125 19:28657205-28657227 CCTGGAGATCTACCTGGGCAAGG - Intergenic
1165747333 19:38237708-38237730 CATGGGGATCTGGCTGGGTGCGG - Intergenic
1166918691 19:46213587-46213609 CCTGGAGATTTGGCTGGGCATGG - Intergenic
1166921128 19:46229898-46229920 CCTGGAGATTTGGCTGGGCATGG - Intronic
1167123810 19:47535638-47535660 CCTGTACATAAGGCTGGGTGTGG + Intronic
1167142969 19:47664952-47664974 CCTGGAGACAAGCCCTGGTGTGG - Intronic
1168437658 19:56334242-56334264 CCTGGAGGTCTGCCTGGGCTTGG + Intronic
925534449 2:4901359-4901381 CCTGCAGAGATGCCCTGGTGGGG - Intergenic
925768317 2:7259133-7259155 CCTGGATTTCTGCCTGGGGGTGG - Intergenic
925768430 2:7259610-7259632 CCTGGAGAGCTGCCTGGGCATGG - Intergenic
925768450 2:7259723-7259745 CCTGGAGATCTGCCTGGGCATGG - Intergenic
925954981 2:8954735-8954757 CCTGTAGATTTGCCTGGGTGTGG + Intronic
926307874 2:11652461-11652483 CCTGGAGGTAATCCTGGGTGTGG + Intergenic
927788789 2:25993538-25993560 CCTAGAAATATGCCTGGTTCAGG + Intergenic
928614568 2:33024406-33024428 CCTGCAGATATGTAGGGGTGAGG + Intronic
930210808 2:48635087-48635109 TCTGGAGATCTGCCTGGGCATGG + Intronic
930942400 2:57028376-57028398 CCTGGAGATCTGCCTGGTTGTGG + Intergenic
931461995 2:62457382-62457404 CCTGGAGGAAGGGCTGGGTGCGG + Intergenic
932534790 2:72581735-72581757 CCCAGAGGTATGCCTAGGTGTGG - Intronic
933336735 2:80968017-80968039 CCTGGAAATCTGCCTGACTGTGG - Intergenic
933336747 2:80968130-80968152 CCTGGAGGTCTGCCTGGGCATGG - Intergenic
933363955 2:81324695-81324717 CCTGAAAATATGCCTGGCTGCGG + Intergenic
933613893 2:84464044-84464066 CCTGGAGTGATGCTAGGGTGAGG + Intergenic
933784126 2:85824891-85824913 CTTGGACATATGCCTAGGAGTGG + Intergenic
933996027 2:87670680-87670702 CCTGTGGAGATGCCTAGGTGGGG - Intergenic
936820223 2:116510969-116510991 CTTGGTGATCTGCCTGGGTGTGG + Intergenic
937609201 2:123840141-123840163 CCATGGGATCTGCCTGGGTGTGG - Intergenic
937609238 2:123840367-123840389 CCTGGAGATTTGCCTCAGTGTGG - Intergenic
937823129 2:126334569-126334591 CCTGGAGATCTGCCTCGGCATGG - Intergenic
938513655 2:131979422-131979444 TCTGGAGGTCTGCCTGAGTGTGG - Intergenic
939247489 2:139644849-139644871 CTTGGATATCTGCCTGGATGTGG + Intergenic
939247506 2:139644963-139644985 CCTGCAGATATGTCTGGGTGTGG + Intergenic
939247601 2:139645524-139645546 CCTGGAGGTCTGCTGGGGTGTGG + Intergenic
939639951 2:144628122-144628144 CTTGCAGAGATGCATGGGTGTGG + Intergenic
940076348 2:149746494-149746516 CCAGGAAACATGCCTGAGTGAGG + Intergenic
940404372 2:153283918-153283940 GCTGGAGACCTGCCTGGGTGTGG + Intergenic
940404387 2:153284011-153284033 CCTGCAGATCTGCCTGGGCGTGG + Intergenic
940430471 2:153584182-153584204 CCTGGTGAAATGCTTGGGTGAGG - Intergenic
940445428 2:153771462-153771484 CCTGGAGATATATCCAGGTGTGG + Intergenic
940864885 2:158807934-158807956 TCAGGACATATGGCTGGGTGAGG - Intronic
941085949 2:161118553-161118575 CCTGGAGCTGTGCTTGGGTAGGG - Intergenic
942866542 2:180682681-180682703 CCAGGAAATATGACTGGTTGTGG - Intergenic
943249022 2:185493999-185494021 CCTGGAGGTCTGCCTGGTTGTGG + Intergenic
943616772 2:190101441-190101463 CCTGGAGTTCTGCCTGGCGGTGG - Intronic
943644293 2:190392048-190392070 CTTGGGGATATACCTGGGAGTGG + Intergenic
943912287 2:193584194-193584216 CCTGGAATTATGCCTGAGTGTGG - Intergenic
943912298 2:193584306-193584328 CTTGGAAGTACGCCTGGGTGTGG - Intergenic
943951304 2:194134411-194134433 GCTGGAGATGTGGCTGGCTGGGG + Intergenic
944607226 2:201363197-201363219 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
945482965 2:210364079-210364101 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
945482978 2:210364192-210364214 ACTGGAGATCTGCCTGGGCATGG + Intergenic
945494932 2:210498774-210498796 CTTGGAGATCTGCCTGGGTGTGG + Intronic
945494949 2:210498887-210498909 CTTGGAGATATGCCTGTGCATGG + Intronic
945495009 2:210499227-210499249 CCTGGATTTCTGCCTGGGAGTGG + Intronic
946000091 2:216475188-216475210 GCTGGAGCTGTGGCTGGGTGTGG + Intronic
948312656 2:237000188-237000210 CCTGCTGGTGTGCCTGGGTGGGG + Intergenic
948729462 2:239953854-239953876 CCTGGAGAGACGCCAGTGTGTGG - Intronic
1169028649 20:2391124-2391146 CCTGAGGATATGCGGGGGTGGGG + Intronic
1169515480 20:6311928-6311950 CCTGGAGATCTGTCTGGGCATGG - Intergenic
1169515587 20:6312590-6312612 CCTGAAGATCTGCCTGGGCATGG - Intergenic
1169671346 20:8106172-8106194 CCTGGAGATCTTCCTGGGCATGG - Intergenic
1169938967 20:10916539-10916561 CCTGGAGTTGTGGCTGGATGAGG - Intergenic
1170070148 20:12357835-12357857 CCTAGAGAGCTGCCTGGGTATGG - Intergenic
1170905763 20:20514261-20514283 CCTGGAGATCTGCTTGGGTGCGG - Intronic
1170905844 20:20514709-20514731 CCTGGAGATATGCCTGGGCATGG - Intronic
1171257496 20:23701208-23701230 CCTGGAGATCTACCTGGGTGTGG - Intergenic
1171264910 20:23763367-23763389 CCTGTAGATCTACCTGGGTATGG - Intergenic
1173223630 20:41148499-41148521 CTTGGAGATATGCTGGGCTGTGG + Intronic
1173970681 20:47149995-47150017 CCAGGAGGTGTGCCTGAGTGAGG + Intronic
1174082482 20:47980361-47980383 CTTGGATATATGCCTGGGTTGGG + Intergenic
1174304449 20:49605247-49605269 CCTGCAGAGATCCCTGGGTCTGG + Intergenic
1175310443 20:58008089-58008111 CCTGGAGCTTTCACTGGGTGAGG + Intergenic
1175830898 20:61965224-61965246 CCTGGAGATAAGCCTTCGCGGGG + Intronic
1176780130 21:13183474-13183496 TCTGGAGGTCTGCCTGAGTGTGG + Intergenic
1177191377 21:17855691-17855713 CCTGGATATATACCTAGGAGGGG + Intergenic
1177294816 21:19160651-19160673 CCTGAAGATCTGCCTGGGCATGG + Intergenic
1177294852 21:19160877-19160899 TCTGGACATATGCCTGGGCATGG + Intergenic
1177855860 21:26399548-26399570 CCTGGTGATATTCATGGGTGAGG - Intergenic
1177933622 21:27316387-27316409 CCTGGAGCTATGTCTGGGCATGG + Intergenic
1177977785 21:27872491-27872513 TCTGGAGGTCTGCCTGAGTGTGG + Intergenic
1179602976 21:42493277-42493299 CCTGGACATGTGCTGGGGTGTGG - Intronic
1179647070 21:42782523-42782545 CCTGGGGACGTGGCTGGGTGGGG + Intergenic
1179827572 21:43975565-43975587 CGTGGAGACCTGCCTGGCTGTGG + Intronic
1181695878 22:24592638-24592660 CCTGGAGTGAGGGCTGGGTGAGG - Intronic
1183525402 22:38319603-38319625 CCTGGCGATCTGGCTGGGTTAGG - Intronic
1184710552 22:46247040-46247062 CCTGGAGCTCTCCCTGGGTAGGG - Intronic
1184766767 22:46576466-46576488 CCTGGGGAGATGCAGGGGTGTGG + Intronic
1185210894 22:49569975-49569997 CCTGGAGGGATGCCTCGCTGCGG - Intronic
949139939 3:620032-620054 CATGGAGATATGGCCGGGCGCGG + Intergenic
949494643 3:4620157-4620179 GCTGGAGAGAAGCCTGGCTGGGG + Intronic
949663016 3:6303717-6303739 CCTGGAGATCTGTCTGTGTGTGG - Intergenic
951128611 3:19014262-19014284 CCTTGAGATATGGCTTGGGGAGG - Intergenic
951159956 3:19407443-19407465 ACTGGAGATCTGCGTAGGTGTGG - Intronic
951193959 3:19803713-19803735 CCTGGAGTTCTGCCTGGGGGTGG - Intergenic
951193995 3:19803939-19803961 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
951194039 3:19804165-19804187 CCTGGAGATATGCTTGGGTGTGG - Intergenic
951236363 3:20240780-20240802 CCTGGAGATCTGCTTAGGTATGG - Intergenic
951236392 3:20240993-20241015 CCTGGAGATATGACTAGGTGTGG - Intergenic
951261280 3:20512348-20512370 TCTGGAGATCTTCCTGGGCGTGG + Intergenic
951261299 3:20512459-20512481 GCTGGAGATATGCCTGGGCATGG + Intergenic
951284385 3:20791133-20791155 CCTGGAGATATGCCTGGTTGTGG - Intergenic
951325414 3:21296905-21296927 CCTGAAAATCTGCCTGGGTGTGG - Intergenic
952160443 3:30688298-30688320 CATGGTGAGATGCCTGGCTGGGG - Intronic
952232745 3:31448393-31448415 CCTGGAGAAATGCTTGGGTGAGG - Intergenic
952834533 3:37591926-37591948 CCTGGACATTTGCCTGCCTGGGG + Intronic
954485961 3:50851435-50851457 CCTGGAGATCTTCCTGGGCGTGG + Intronic
955072992 3:55587552-55587574 CCTAGGGAAATGCTTGGGTGAGG - Intronic
957146033 3:76424969-76424991 ACCAGAGACATGCCTGGGTGTGG - Intronic
957384256 3:79475325-79475347 CATGTAGATAAGTCTGGGTGAGG + Intronic
958072387 3:88630820-88630842 CTTGGAGATATGCTTGGGAGTGG + Intergenic
958823952 3:99007643-99007665 CCTGGAGATTTGCCTGAGCATGG + Intergenic
959299153 3:104576869-104576891 CCTGGAGATCTGCCTGGTTGTGG + Intergenic
959678082 3:109059870-109059892 CCTGGAGAAATGCATTGGTTGGG + Exonic
959754089 3:109875650-109875672 CCTGGAGATCTGCCTGGGCATGG - Intergenic
959882805 3:111464952-111464974 CCTGGAGATATGGCTTAGTTAGG - Intronic
959948146 3:112149216-112149238 CCTGGAGATCTGCCTGGTCATGG + Intronic
959948181 3:112149434-112149456 CCTGGAGATCTGCCTAAGTGTGG + Intronic
959948223 3:112149660-112149682 CCTGGAGGTCTGCCTGGGTGTGG + Intronic
959948240 3:112149770-112149792 ACCTGAGATCTGCCTGGGTGGGG + Intronic
960996446 3:123343623-123343645 CCTGGAGCTCTGCCTGGGGAGGG - Intronic
961385866 3:126523248-126523270 CATGGAGATATGCAGTGGTGAGG - Intergenic
961823697 3:129587967-129587989 CCTGGACATAGGGGTGGGTGCGG - Intronic
962242775 3:133765333-133765355 CCTTGATATCTGCCTGTGTGAGG - Intronic
962911620 3:139856199-139856221 CCTGGAGATCTTCCTGGGTGTGG + Intergenic
964058001 3:152484942-152484964 CCTGGAGATCTGCCTGGACATGG + Intergenic
964300260 3:155278664-155278686 CCTGGAGGAATGCCTGGCCGTGG + Intergenic
964652440 3:159026736-159026758 CCTGGAGTTCTGCCTGTGGGTGG + Intronic
964652593 3:159028172-159028194 CCTGGAGTTCTGCCTGTGGGTGG - Intronic
965360788 3:167735454-167735476 CCAGCAGAGACGCCTGGGTGGGG + Intronic
965632605 3:170748507-170748529 TCTGGAGATATGCCTAAGAGTGG + Intronic
966426227 3:179782601-179782623 GCTGGAGAAATGCCTGAGGGTGG + Intronic
966459921 3:180165507-180165529 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
966459956 3:180165719-180165741 CCTGGAGATGTGCCTGGGCTTGG + Intergenic
967661263 3:192113106-192113128 CCTGCAGTTATGACTGGGTCTGG + Intergenic
968284865 3:197502570-197502592 CCTGGGGCTAGGCCTGGGAGAGG - Intergenic
968706396 4:2080373-2080395 CATGCAGATGTGCCTTGGTGGGG - Intronic
969052477 4:4383105-4383127 CCTGGAGATCTGGCTGGCTGTGG + Intronic
969189483 4:5505464-5505486 CCAGGAGAGATGCCATGGTGGGG + Intergenic
969905943 4:10396132-10396154 CCTGGAGATATGCCTGGACATGG + Intergenic
970067525 4:12116062-12116084 TTTGGAGAGATGGCTGGGTGTGG + Intergenic
970311526 4:14787471-14787493 TGTGGAGATCTGCCTGGGTGTGG - Intergenic
970311530 4:14787489-14787511 GCTGGAGATCTGCCTGGGTGTGG - Intergenic
970311544 4:14787603-14787625 CCTGGAGATCTGCCTGGGTAGGG - Intergenic
970668464 4:18366520-18366542 CCTGGGAATCTGCCTGGGGGTGG - Intergenic
971066212 4:23035860-23035882 CCTGGAGTTCTGCCTGGGGCCGG + Intergenic
971113234 4:23614332-23614354 CCTGGAGACCTGCCTGGATGTGG - Intergenic
971611459 4:28731425-28731447 CCTGGAAATATGCCTGGGCATGG + Intergenic
971614049 4:28764536-28764558 CCTGGAGATATGCCTGGGCTAGG - Intergenic
971614068 4:28764649-28764671 CCTGGTGATCTGCCTGGGCATGG - Intergenic
971614089 4:28764759-28764781 CCTTGAGATCTGCCTGGATGTGG - Intergenic
971950037 4:33332776-33332798 CCTGGTGATATGCTTGGTTGTGG - Intergenic
971958408 4:33453695-33453717 CCTGGAGATATTTCTAGGTGTGG - Intergenic
971958426 4:33453805-33453827 CCTGGAGATTTGCCTAGGTGTGG - Intergenic
972043965 4:34639971-34639993 CCTGGAGATTTGCCTGGGAATGG - Intergenic
973001872 4:44961619-44961641 CCTGTAGATCTGCCTGGGTGTGG + Intergenic
974126807 4:57706843-57706865 CCTGGAGATGTGCCTAGGCATGG + Intergenic
974312743 4:60233850-60233872 CCTAGAGATCTGCCTGGGAGTGG + Intergenic
974562607 4:63541293-63541315 CCTGGAGTTCTGCTTGGGTGTGG - Intergenic
974676019 4:65090327-65090349 CCTGGAGATGTGCCTAGGCATGG + Intergenic
974775597 4:66476606-66476628 CCTGGAGATCTACCTGAGTGTGG - Intergenic
974813841 4:66981346-66981368 CGTGGAAATGTGCCTTGGTGGGG - Intergenic
975063998 4:70038847-70038869 CCTGGAGATCTGCCTGAATGTGG + Intergenic
975276326 4:72505898-72505920 CTTGGAAATCTGCCTGGGTGTGG + Intronic
975276372 4:72506236-72506258 CCTGGAGATCTGCCTGGCTCTGG + Intronic
976984818 4:91280555-91280577 CCTGGTGAAATGCTTGGGTGGGG + Intronic
977026831 4:91830649-91830671 CCTGGAGCTATGGCCTGGTGTGG + Intergenic
977514725 4:98006941-98006963 CCTGGAGATAAGCCTAGGTGAGG - Intronic
977557915 4:98503455-98503477 CCGGGAGGTATGTCAGGGTGAGG - Intronic
977719613 4:100224121-100224143 CCTGGAAGAATACCTGGGTGGGG + Intergenic
977764182 4:100777644-100777666 CCTGGAGATCTGCCTGGGCATGG + Intronic
977764275 4:100778255-100778277 CCTGGAGACTTGCCTGGATGTGG + Intronic
978333797 4:107644530-107644552 CCTGCAGACAGGGCTGGGTGTGG - Intronic
979139554 4:117154068-117154090 CTTGGAGATCTGCCTGGGCATGG + Intergenic
979139572 4:117154182-117154204 CCTGGAGATCTGCCTGAGCATGG + Intergenic
979150775 4:117311314-117311336 CCTGGAGATCTGCCTGTGTATGG + Intergenic
979504924 4:121485078-121485100 CTTGGAGATCTGCCTGGGTGTGG + Intergenic
979737405 4:124104551-124104573 CCTGGATACCTGCCTGGGTGTGG + Intergenic
979737442 4:124104777-124104799 CCTGGTGATCTGCCTGGGCATGG + Intergenic
979962420 4:127036702-127036724 CCTGAAGATGTGTCTGGGAGTGG - Intergenic
980023808 4:127740583-127740605 CCTGGAAATCTGCCTGGTTGTGG + Intronic
980032185 4:127844319-127844341 CCTGGGAATATGCCTGGGTTTGG - Intergenic
980032228 4:127844548-127844570 CCTGAAGATATGCCTCGGTGTGG - Intergenic
980296372 4:130923422-130923444 CCTGGAGATCTGCCTGGTCAGGG + Intergenic
981679617 4:147381685-147381707 CCTGGAGATCTGCCTGAGTGTGG - Intergenic
981739223 4:147984998-147985020 CATAGAGATGTGCCTAGGTGTGG + Intronic
981739244 4:147985107-147985129 CCAGGAGATCTGCTTGGGTATGG + Intronic
981739263 4:147985220-147985242 CCTGGAGATACTCCTGGGTGTGG + Intronic
981739285 4:147985332-147985354 CATGGAAATCTGCCTGGGGGTGG + Intronic
981763952 4:148226558-148226580 CCTGGATAAATACCTGGGAGTGG + Intronic
981987401 4:150874756-150874778 CCTGGAGATCTGCCTGGGCATGG - Intronic
982843730 4:160223934-160223956 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
983218356 4:165021444-165021466 TCTGGAGAGAAACCTGGGTGTGG + Intergenic
983267679 4:165524304-165524326 TCAGGAGATATTCCTGTGTGCGG - Intergenic
983284692 4:165724634-165724656 CATGGAGATGTGCGTGTGTGCGG - Intergenic
983474388 4:168196267-168196289 CCTGGAGATCTACCTGGATGTGG - Intergenic
983831986 4:172339163-172339185 TCTGGAGATATGCCTGGGCATGG + Intronic
984171826 4:176368640-176368662 CCTGGAGATATGCCTGCAGGTGG + Intergenic
985448177 4:190038808-190038830 CCCGGAGATTCGCCTGGGGGTGG - Intergenic
985630598 5:1011993-1012015 CCTGGGGATGTGCGTGGGTGAGG + Intronic
985808444 5:2065800-2065822 CCTGGAACTGAGCCTGGGTGTGG - Intergenic
987669658 5:20990491-20990513 CCTGGAGATCTGCCTGGGCATGG - Intergenic
987669710 5:20990833-20990855 CCTGGAGAAGTGCCTGGGTATGG - Intergenic
987669755 5:20991081-20991103 CCTGGAGATATGCCTGGGCATGG - Intergenic
988220135 5:28333882-28333904 CATGGAAATATGCCTGGGCATGG + Intergenic
988304845 5:29481030-29481052 TCTGGAGATCTGCCCGGGTATGG - Intergenic
988646916 5:33105085-33105107 CCTGGTGATCTGCCTGGCTGAGG + Intergenic
988646937 5:33105198-33105220 CCTGGAGGTCTGCCTGGATGTGG + Intergenic
989447003 5:41541767-41541789 CCTGGAAATATTCCTGGGCATGG + Intergenic
989460832 5:41696644-41696666 CTTGGAATTATGCCTGGGTATGG + Intergenic
989460872 5:41696890-41696912 CCTGGAAATATGCCCAGGTGTGG + Intergenic
992420529 5:76599990-76600012 CCTGGAGATCTGGCCAGGTGTGG + Intronic
993009059 5:82459135-82459157 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
993217811 5:85048378-85048400 CCTGGAGATCTGCCTACTTGTGG - Intergenic
993217839 5:85048603-85048625 CCTGGGGATATGCCTGGGAGTGG - Intergenic
993279797 5:85910322-85910344 CCTGGAGATCTGCCTGAGCATGG + Intergenic
993443251 5:87980867-87980889 CCTGGAGATCTGCCTGGGCATGG + Intergenic
993779711 5:92051233-92051255 CCTAGAGTTATGCCTGTGTTAGG + Intergenic
994026452 5:95089977-95089999 CCTGGGGAGAGGCCTGAGTGTGG - Intronic
994399728 5:99264083-99264105 CCTAGAGATATGCCTGGGCATGG - Intergenic
994824736 5:104698703-104698725 CCTAGAAATCTGCCTGGGTGTGG - Intergenic
994824777 5:104698926-104698948 CCTGGAGATGTGCCTGGATGTGG - Intergenic
994824809 5:104699152-104699174 GCTGGAGATCTGCCTAAGTGTGG - Intergenic
995148257 5:108810927-108810949 CCTGGAGACCTGCCCTGGTGAGG + Intronic
995148280 5:108811039-108811061 CCTGGAGATCTGCCTGGCCGTGG + Intronic
995148329 5:108811265-108811287 CCTAGAGATCTGCCTGGGTATGG + Intronic
995318525 5:110803976-110803998 CCTGGAGATCTTTCTGGGAGTGG + Intergenic
995388683 5:111615611-111615633 CCTGGAGATCTGCCTCGGTATGG + Intergenic
996493033 5:124121383-124121405 TCTGGAGATTTGCCTGGGTGGGG + Intergenic
997055465 5:130438374-130438396 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
997783647 5:136685746-136685768 CCTGGAGATCTGCATGGGTGTGG - Intergenic
997783686 5:136685972-136685994 CCTGGAGATCTGCCTGAGCATGG - Intergenic
998364072 5:141617764-141617786 CCTGGAGAGAGGCGTTGGTGTGG + Intronic
998510251 5:142707117-142707139 ACTGGAGAGATGGCCGGGTGTGG - Intergenic
998703914 5:144737520-144737542 CCTGGAGATTTGCCTGGGCATGG + Intergenic
998703937 5:144737634-144737656 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
998898031 5:146821054-146821076 CCTGGTGAGAAGCCAGGGTGTGG - Intronic
999376248 5:151088216-151088238 CCTGAAAATATGCCTGGGGAGGG + Intronic
1002301873 5:178262013-178262035 CCTGGGGAAATGGCTGGGTGAGG - Intronic
1003155497 6:3590163-3590185 CTTGGACTTAAGCCTGGGTGGGG - Intergenic
1004818373 6:19337357-19337379 GCTGGAGATATGTCTGGAGGAGG + Intergenic
1004866781 6:19860425-19860447 CCTTGAGATGTGACTGTGTGAGG - Intergenic
1005207421 6:23420759-23420781 CCTAGAAATCTGCCTGAGTGTGG - Intergenic
1005836078 6:29710599-29710621 CCTGGAGACATGCTGGGGTGGGG + Intergenic
1006391706 6:33762406-33762428 TGTGGAGAAATGCCTGTGTGGGG - Intergenic
1006641881 6:35493847-35493869 CCTGGAGATGACACTGGGTGTGG - Intronic
1008936591 6:56999163-56999185 CCTGGAGATCTGCCTGGGCATGG - Intronic
1008998922 6:57690310-57690332 TCTGGAGATTTACCTGGGGGTGG - Intergenic
1009187407 6:60589689-60589711 TCTGGAGATTTACCTGGGGGTGG - Intergenic
1009787527 6:68358594-68358616 CCTGGAGATATGCCTGGGCATGG + Intergenic
1009849703 6:69180186-69180208 CCTGGAGATCTGCCTGGGTGTGG + Intronic
1009849750 6:69180526-69180548 CCTGGAGATCTGCCTAGGAATGG + Intronic
1010543562 6:77122921-77122943 CCTGGAGATCTGCTTGGAGGTGG + Intergenic
1010948391 6:82005656-82005678 CCTGGAGATATGCTTGGGTGTGG - Intergenic
1010948407 6:82005769-82005791 CCTGGAGATCTGCCTGGGAACGG - Intergenic
1010988995 6:82458450-82458472 CCTGGAGAACTGCCTGAGTGTGG + Intergenic
1010989014 6:82458561-82458583 CCTGGAGATCTGCCTGGGGGTGG + Intergenic
1011311168 6:85981255-85981277 CCTGGAGATCTGCCTGGGTTTGG + Intergenic
1011845806 6:91561803-91561825 CCTGGAGTTCTGCCTGGGCATGG - Intergenic
1011845824 6:91561907-91561929 CTTGGAAATATCCCTGGGTGTGG - Intergenic
1011955030 6:93016018-93016040 CCTGGAGATATGTCTGAGAATGG - Intergenic
1011955054 6:93016130-93016152 CCTGGAGTTATGCCCGGGTGTGG - Intergenic
1011957155 6:93037483-93037505 CCTGGAGACCTGCCTGGGCATGG + Intergenic
1012118985 6:95339936-95339958 CCTGGAGATTTGCCTGGGCATGG + Intergenic
1012676127 6:102115275-102115297 CCTGGAGATTTGCCTGGACATGG + Intergenic
1012870727 6:104670341-104670363 CATGGAGATAAGCCTGAGTTTGG + Intergenic
1013255401 6:108379994-108380016 CCTGGAGATTTGCCTGGGCATGG + Intronic
1013779133 6:113710977-113710999 CCCTGAGACATGGCTGGGTGAGG - Intergenic
1015306591 6:131715635-131715657 CCTGGAGATCTGCCTGGTTGTGG - Intronic
1015350225 6:132209788-132209810 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
1015734624 6:136385502-136385524 CCTGAGGATAGGCCTGCGTGTGG - Intronic
1015800151 6:137052344-137052366 CCTGGGGATAGGGCTGGGGGTGG - Intergenic
1016110598 6:140218870-140218892 CCTGGTGAAATACTTGGGTGAGG + Intergenic
1016175593 6:141074758-141074780 ACTGGAGATCTGCCTAGGCGTGG + Intergenic
1016175619 6:141074907-141074929 CCTGGAGATCTGCTTGGGCATGG + Intergenic
1016220856 6:141668508-141668530 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1017061135 6:150486110-150486132 CCTGGGGATATGACTCAGTGAGG - Intergenic
1017541113 6:155404313-155404335 CCTGGAGCCAGGGCTGGGTGTGG + Intronic
1017991416 6:159492597-159492619 ACTGGAGAAATGCCTTGATGGGG - Intergenic
1018359057 6:163046617-163046639 CGTGGAGAGCAGCCTGGGTGTGG - Intronic
1019664216 7:2243311-2243333 CCTGGGCACAGGCCTGGGTGTGG + Intronic
1021189400 7:17602709-17602731 CCTGGAGTTGTGCCTGCGCGTGG - Intergenic
1021351730 7:19602375-19602397 CCTGGAGATCTGCCTGAGGGTGG + Intergenic
1021351815 7:19602905-19602927 CCTGAAGATTTGCCTGGGCATGG + Intergenic
1021351832 7:19603018-19603040 CCTGGAGATCTGCCTGGCCATGG + Intergenic
1022254632 7:28643787-28643809 CCTGGAGTCCTGGCTGGGTGTGG + Intronic
1022887086 7:34657747-34657769 CCTTGTGATATGACTGGGAGGGG - Intergenic
1023497640 7:40815397-40815419 CCTGGAGGTCTGCCTGGTTATGG + Intronic
1023497665 7:40815510-40815532 CCTGGAGATGTGCCTGAGTGTGG + Intronic
1023497682 7:40815598-40815620 CCTGGAGATTTGCCTGGGCATGG + Intronic
1023808283 7:43890673-43890695 CCTGGAGAGATGTCTATGTGGGG - Intronic
1025602601 7:63014241-63014263 GCTGGGGATATGCATGCGTGAGG + Intergenic
1027934807 7:84589040-84589062 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1027934851 7:84589286-84589308 CTTGAAGACCTGCCTGGGTGTGG - Intergenic
1027934880 7:84589512-84589534 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1027934902 7:84589625-84589647 CCTGGAGATCTCCCTGGGCGTGG - Intergenic
1028287892 7:89026569-89026591 CCTGGGTATAACCCTGGGTGTGG + Intronic
1028304546 7:89246799-89246821 TCTGGAGATATGCCTAAGTATGG - Intronic
1028333156 7:89621962-89621984 CTTGGAGATCTGCCTGGGCATGG - Intergenic
1028333189 7:89622187-89622209 TCTAGAGATATGCCTGAGTGTGG - Intergenic
1028333209 7:89622306-89622328 CCTGGAGATGTGCCTGGATGTGG - Intergenic
1028333227 7:89622419-89622441 CCTGGAGATGTGCCTGGGTGTGG - Intergenic
1028333262 7:89622641-89622663 CCTGAAAATTTGACTGGGTGTGG - Intergenic
1028333279 7:89622753-89622775 CCTGGAGATCTGCCTGGGCTTGG - Intergenic
1028333299 7:89622866-89622888 CTTGGAGATCTGCCTGGGCATGG - Intergenic
1028431196 7:90749190-90749212 CCTGGAGATCTGCCCGGGTGTGG - Intronic
1028431251 7:90749531-90749553 CCTGGAGATCTGCCTGGGTGTGG - Intronic
1028868323 7:95738068-95738090 CCTGGAGTTCTGCCTAGGAGTGG - Intergenic
1028868414 7:95738622-95738644 CCTGGAGATCTGCCTGGATGTGG - Intergenic
1029157288 7:98526243-98526265 CCCAGTGATATGCCTGAGTGTGG + Intergenic
1029379995 7:100207220-100207242 TCTTGAGATATACCTGGGAGTGG + Intronic
1029557615 7:101281253-101281275 GCTGGGGATATGCATGCGTGAGG + Intergenic
1029576738 7:101408341-101408363 CCTGGACATATCCCTGCCTGGGG - Intronic
1029936611 7:104431899-104431921 CCTGGAGGTTTGACTGGGAGAGG + Intronic
1030754151 7:113268377-113268399 CCTGGAGAAATGCCTGGGTGTGG - Intergenic
1030754169 7:113268490-113268512 CCCAGAGATATGCCTGGGCATGG - Intergenic
1030754240 7:113269026-113269048 CCTGGAGATATGTGTGGGCGTGG - Intergenic
1031011047 7:116525695-116525717 GCTGGAGCTCTGCCCGGGTGTGG + Intronic
1031058882 7:117026757-117026779 CCTGGATATCTGCCAGGGTAGGG + Intronic
1031237669 7:119197313-119197335 CCTGGAGAGCTGCCTGTGTGTGG - Intergenic
1031243095 7:119270843-119270865 CCTGGAGATCTGCCTAGGTGTGG + Intergenic
1031316032 7:120258132-120258154 ACAGGAAGTATGCCTGGGTGGGG - Intergenic
1031421362 7:121555846-121555868 CCTCGAGATAAGTCTGGCTGAGG - Intergenic
1031507505 7:122604448-122604470 CCAGGAGATATGCCTGGGGCTGG - Intronic
1031688287 7:124759454-124759476 GGTGGAGATATGTGTGGGTGTGG - Intronic
1031904592 7:127446860-127446882 CCTAGAGATCTGTCTGGGTGTGG - Intergenic
1031904652 7:127447208-127447230 CCTGAAGATCTGCCTGGATATGG - Intergenic
1032639172 7:133746542-133746564 CCTGCAGATATGCCAGTGAGAGG + Intronic
1033528559 7:142241384-142241406 CCTGGAGATATAGGTGGGTCAGG + Intergenic
1033679847 7:143583580-143583602 CCTGGAGATCTGCCTGGTTGTGG - Intergenic
1033691987 7:143745863-143745885 CCTGGAGATCTGCCTGGTTGTGG + Intergenic
1033730958 7:144178865-144178887 CCTGGAGATCTGCCTGGTTGTGG + Intergenic
1034026811 7:147713642-147713664 CTTGGAAAAATGCCTGGGAGTGG + Intronic
1034113084 7:148557417-148557439 CCTGGAGATCTGCCTGGGTGTGG + Intergenic
1034711231 7:153193148-153193170 CCTGGAGAGGAGCTTGGGTGAGG + Intergenic
1035136001 7:156703654-156703676 CCTGGGAAAATGCTTGGGTGAGG - Intronic
1035695352 8:1591710-1591732 CCAGGAGATATGCGGGTGTGTGG - Intronic
1036004016 8:4641641-4641663 CGTGGAGATATAACTGGGTTTGG - Intronic
1037118328 8:15252628-15252650 ATTGGAGATCTGGCTGGGTGCGG - Intergenic
1037887213 8:22601421-22601443 CCTGGAGCTCTCTCTGGGTGGGG + Intronic
1038652942 8:29422114-29422136 CTTGGGGATATGGCTGGGTGCGG + Intergenic
1039383333 8:37106771-37106793 CCTGGAGACATGTATGGGTGGGG - Intergenic
1039965865 8:42283336-42283358 CCTGAACCTATGACTGGGTGGGG + Intronic
1041530049 8:58855554-58855576 CCTGGATAGATGAATGGGTGTGG - Intronic
1043171478 8:76972255-76972277 GCTGGAGATCTGCCTGGGCATGG - Intergenic
1043171538 8:76972598-76972620 CCTGGAGATCTGCCTGGGTAGGG - Intergenic
1043213150 8:77550870-77550892 CTTGGAGATATCCCTGGGCATGG + Intergenic
1043655762 8:82663119-82663141 CCTGGAGTTCTGCCTGGGAGTGG + Intergenic
1044228767 8:89750193-89750215 CCTGGAGAAATGCCCAGGTGAGG - Intergenic
1044955570 8:97476161-97476183 CCTAGAGATCTGCTTAGGTGTGG - Intergenic
1045043795 8:98254733-98254755 CATGGACAGAGGCCTGGGTGAGG - Intronic
1045094621 8:98784848-98784870 CCTGGAGATTTGCCTGGGCATGG - Intronic
1045727088 8:105186408-105186430 CCTGGATATATGCCTGGGGGTGG + Intronic
1046069783 8:109236381-109236403 CTTGGATATATACCTAGGTGAGG + Intergenic
1046606301 8:116375305-116375327 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1046606321 8:116375403-116375425 CCTGGAGATATGTCTGGGCATGG + Intergenic
1046869637 8:119190901-119190923 CCTCGAGGTATGCCTGTGTTAGG - Intronic
1047566203 8:126046845-126046867 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1047575450 8:126149202-126149224 CCTGGAGATCTGTCTGGGTGTGG - Intergenic
1047575473 8:126149315-126149337 TCTGGAGATATGCCTGAGCCTGG - Intergenic
1047930999 8:129728230-129728252 CCTGGAGATCTACCTGAGTGTGG - Intergenic
1048719991 8:137312494-137312516 CTGGGAGATAGGGCTGGGTGGGG + Intergenic
1049002318 8:139833865-139833887 CCTGGTGTTATTCCTGGGTATGG + Intronic
1049057988 8:140254210-140254232 CCTGGAAACCTGCCTGGCTGAGG - Intronic
1049242635 8:141546048-141546070 CTTGGGGATAGGCCTGGGAGTGG + Intergenic
1050295129 9:4196937-4196959 CCTGGAGTTCTGCCTAGGGGTGG - Intronic
1050295151 9:4197046-4197068 CTTGGAGATCTGCCTGGGCATGG - Intronic
1050619011 9:7433475-7433497 GCTGTAGATCTGCCTGGGTGTGG + Intergenic
1050687801 9:8191089-8191111 CCTGGAGATCTACTTGGGAGTGG - Intergenic
1051920346 9:22257340-22257362 CCTGGAGATCTGTGAGGGTGGGG + Intergenic
1053287897 9:36861712-36861734 GCTGGAGAGAAGCCAGGGTGGGG + Intronic
1054943771 9:70772611-70772633 TCTGATGATATGGCTGGGTGTGG - Intronic
1055736513 9:79336486-79336508 CCTGGAGGCCTGCCTGGGTGTGG + Intergenic
1055760261 9:79599413-79599435 TCTGGAGTGAGGCCTGGGTGTGG + Intronic
1055818157 9:80231757-80231779 CCTGGAGATCTGCCAGGATGTGG + Intergenic
1055818179 9:80231870-80231892 CCTGGAGATATGCCTGGGCTTGG + Intergenic
1055818234 9:80232209-80232231 CATGGAGTTCTGCCTGGATGTGG + Intergenic
1055883133 9:81026610-81026632 CCTGGGTATATACCTGGGAGTGG - Intergenic
1056460064 9:86800765-86800787 GCTGCAGCTATGCCTGGGTGAGG - Intergenic
1057821922 9:98338770-98338792 CTTGGATATATACCTGGGAGTGG - Intronic
1058292623 9:103261081-103261103 TCTTGAGATATGGCCGGGTGCGG - Intergenic
1059181311 9:112215110-112215132 CCTGTAGATATGCCGTGGTCAGG + Intergenic
1059702707 9:116791143-116791165 TCTGGAGATAGGGCTGGGTGCGG - Intronic
1060314799 9:122499458-122499480 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1060314837 9:122499684-122499706 CCTGAAGATCTGCCTGGCTGTGG + Intergenic
1060361074 9:122958242-122958264 CCTGGAGGGCTGCCTGGGGGAGG - Intronic
1062089120 9:134665268-134665290 CCTGCAGATATACGTGTGTGTGG + Intronic
1062419823 9:136475021-136475043 CCTGGAGAGAGGCTTTGGTGGGG - Exonic
1062558354 9:137127463-137127485 CCAGGAGAGCTGCCTGGCTGTGG - Intergenic
1185809627 X:3094231-3094253 CCTGGAGATAAGCCAGGGTTGGG + Intronic
1188297642 X:28469508-28469530 CCTGTAGATATTTATGGGTGTGG - Intergenic
1188364009 X:29291836-29291858 CCTGAAGATATTTATGGGTGTGG - Intronic
1188806015 X:34590707-34590729 CCTGGAGATCCGACTGTGTGTGG + Intergenic
1189768269 X:44394506-44394528 CATGGAGAAATGCCTAAGTGTGG + Intergenic
1190457993 X:50643949-50643971 CCTGCAGAGATGGCTGGGTGGGG - Intronic
1190966705 X:55307790-55307812 CCTGGAGATCTGCCTGAGCGTGG + Intergenic
1191087884 X:56588369-56588391 TCTGGAGATCTGCCTGGGCATGG + Intergenic
1191087902 X:56588482-56588504 CCTAGAAATCTGCCTGGGTGTGG + Intergenic
1191774070 X:64793363-64793385 CCTGGAGATCTGCTTGGGCATGG - Intergenic
1192199416 X:69056029-69056051 CTTGGAGAAATGGCTGGGTCAGG + Intergenic
1192762013 X:74104012-74104034 CCTGGAGATCTGCCTATGTGTGG - Intergenic
1192762063 X:74104350-74104372 CCTGGAGATATACCTTGGCGTGG - Intergenic
1192762100 X:74104576-74104598 CCTGGAGATCTGCCTCAGGGTGG - Intergenic
1192762119 X:74104685-74104707 CTTAGAGCTGTGCCTGGGTGTGG - Intergenic
1193026556 X:76851540-76851562 CCTGGAGATCTGCCTGCATGTGG + Intergenic
1193031821 X:76907018-76907040 CCTGGAGATCTGCCTGGGCATGG - Intergenic
1193031871 X:76907355-76907377 CCTGGAGACCTGCCTGGGCATGG - Intergenic
1193031886 X:76907466-76907488 TCTGGAGATATGACTGGGCATGG - Intergenic
1193779209 X:85682647-85682669 CCTGGAGATATGCCTGGGTGTGG + Intergenic
1193779225 X:85682760-85682782 CCTGGACATCTGCCTAGGTGTGG + Intergenic
1193779284 X:85683195-85683217 CTTGGAGATCTGCTTGAGTGTGG + Intergenic
1194024575 X:88735933-88735955 CCTGGAGATATGACTGTGCATGG + Intergenic
1194024609 X:88736157-88736179 CCTGGAGAAATGCCTGGGCATGG + Intergenic
1194024644 X:88736382-88736404 CCTGGAGATATGCCTGGGTATGG + Intergenic
1194157098 X:90404577-90404599 CCTGGATTTCTGCCTGGGAGTGG - Intergenic
1194333445 X:92614851-92614873 CCTAGAGATATGCCTGGGTGTGG + Intronic
1194552774 X:95321538-95321560 CCTGGAGATATGCCTGGGTGTGG - Intergenic
1194575499 X:95609169-95609191 CCTTGGGATGTGTCTGGGTGTGG + Intergenic
1194880406 X:99243862-99243884 CCTGGACATTTGCCTAGGCGAGG - Intergenic
1194897950 X:99468935-99468957 TCTGGATATCTGCCAGGGTGTGG - Intergenic
1194897968 X:99469046-99469068 CCTGGATATCTGCCTGGGCATGG - Intergenic
1194923502 X:99796081-99796103 CTTGGAGATCTGCCTGGGCATGG + Intergenic
1194923551 X:99796306-99796328 CCTGGAGAACTGCCTGGGCATGG + Intergenic
1194931376 X:99891655-99891677 CCTGGAGATATGGGTTGGGGTGG + Intergenic
1195415799 X:104618550-104618572 CCTGGAGATCTACCTGAGTGTGG + Intronic
1195734740 X:108000808-108000830 CCTGGAGTTCTGCATGGGGGTGG - Intergenic
1195734823 X:108001253-108001275 CCTGGAGATCTGCCTGGGTGTGG - Intergenic
1196528066 X:116750540-116750562 TCTGGAGATCTGCCTGGGCATGG + Intergenic
1196613741 X:117743460-117743482 CCTGGAGATCTACCTGGGTGTGG - Intergenic
1196613777 X:117743686-117743708 CCTGGAGATATGCCTGGGTGTGG - Intergenic
1197285763 X:124593314-124593336 CCTGGAGATCTGCCTGGGCTTGG + Intronic
1197285777 X:124593427-124593449 CCTGGAGATTTGCCTTGGTGTGG + Intronic
1197394005 X:125903550-125903572 CCTGAAGATCTGCCTGTGTCTGG + Intergenic
1197412772 X:126139208-126139230 CCTGGAGATAAGCCTGGGCATGG + Intergenic
1197472857 X:126883861-126883883 CATGGAGATCTGCCTGGGTTTGG - Intergenic
1198968161 X:142249962-142249984 CTTGGAGATCTGCCTGGGCGTGG + Intergenic
1198968231 X:142250414-142250436 TCTGGAGATCTGCCTGTGTGTGG + Intergenic
1198968246 X:142250527-142250549 TCTGGAGATCTGCCTGGATGTGG + Intergenic
1198968280 X:142250752-142250774 CCTGGAGATCTGCCTGGGCATGG + Intergenic
1198968298 X:142250856-142250878 CCTAGAGATCTGCCTGGGAATGG + Intergenic
1199322365 X:146455621-146455643 CCTGGAGATCTGCCTGGGTCTGG - Intergenic
1199322409 X:146455908-146455930 CCTGCAGATCTGCCTGGGCATGG - Intergenic
1200175970 X:154116566-154116588 CATGGTGATGTGCCTGGGGGAGG + Intergenic
1200503430 Y:3981559-3981581 CCTGGATTTCTGCCTGGGAGTGG - Intergenic
1200642130 Y:5733857-5733879 CCTGGAGATATGCCTGGGTGTGG + Intronic
1202266617 Y:23026132-23026154 CCTAGAAATAAGGCTGGGTGTGG - Intergenic
1202419610 Y:24659875-24659897 CCTAGAAATAAGGCTGGGTGTGG - Intergenic
1202451176 Y:25010209-25010231 CCTAGAAATAAGGCTGGGTGTGG + Intergenic