ID: 1196613780

View in Genome Browser
Species Human (GRCh38)
Location X:117743692-117743714
Sequence AAGATGCCTGGAGATATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196613780_1196613783 1 Left 1196613780 X:117743692-117743714 CCAGGCATATCTCCAGGCATCTT No data
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153
1196613780_1196613782 -5 Left 1196613780 X:117743692-117743714 CCAGGCATATCTCCAGGCATCTT No data
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data
1196613780_1196613786 9 Left 1196613780 X:117743692-117743714 CCAGGCATATCTCCAGGCATCTT No data
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613780_1196613788 30 Left 1196613780 X:117743692-117743714 CCAGGCATATCTCCAGGCATCTT No data
Right 1196613788 X:117743745-117743767 GGCTTCCCACCTCCCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196613780 Original CRISPR AAGATGCCTGGAGATATGCC TGG (reversed) Intergenic
No off target data available for this crispr