ID: 1196613782

View in Genome Browser
Species Human (GRCh38)
Location X:117743710-117743732
Sequence ATCTTGAGTACCCACTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196613779_1196613782 -4 Left 1196613779 X:117743691-117743713 CCCAGGCATATCTCCAGGCATCT No data
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data
1196613780_1196613782 -5 Left 1196613780 X:117743692-117743714 CCAGGCATATCTCCAGGCATCTT No data
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data
1196613777_1196613782 1 Left 1196613777 X:117743686-117743708 CCACACCCAGGCATATCTCCAGG 0: 5
1: 35
2: 69
3: 169
4: 466
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data
1196613776_1196613782 11 Left 1196613776 X:117743676-117743698 CCTCTGGACTCCACACCCAGGCA No data
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data
1196613775_1196613782 12 Left 1196613775 X:117743675-117743697 CCCTCTGGACTCCACACCCAGGC No data
Right 1196613782 X:117743710-117743732 ATCTTGAGTACCCACTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196613782 Original CRISPR ATCTTGAGTACCCACTCTCC TGG Intergenic
No off target data available for this crispr