ID: 1196613783

View in Genome Browser
Species Human (GRCh38)
Location X:117743716-117743738
Sequence AGTACCCACTCTCCTGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 5, 1: 10, 2: 47, 3: 54, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196613780_1196613783 1 Left 1196613780 X:117743692-117743714 CCAGGCATATCTCCAGGCATCTT No data
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153
1196613777_1196613783 7 Left 1196613777 X:117743686-117743708 CCACACCCAGGCATATCTCCAGG 0: 5
1: 35
2: 69
3: 169
4: 466
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153
1196613775_1196613783 18 Left 1196613775 X:117743675-117743697 CCCTCTGGACTCCACACCCAGGC No data
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153
1196613779_1196613783 2 Left 1196613779 X:117743691-117743713 CCCAGGCATATCTCCAGGCATCT No data
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153
1196613776_1196613783 17 Left 1196613776 X:117743676-117743698 CCTCTGGACTCCACACCCAGGCA No data
Right 1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG 0: 5
1: 10
2: 47
3: 54
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196613783 Original CRISPR AGTACCCACTCTCCTGGATT AGG Intergenic
903164880 1:21513317-21513339 GGCAACCACTCTCCTGAATTTGG + Intronic
905987785 1:42302627-42302649 AGCACCCACTTTTCTAGATTAGG - Intronic
907873978 1:58467866-58467888 GGTAACCTCTCTCCTGAATTTGG + Intronic
909419822 1:75450985-75451007 AGCATCCACTGTCTTGGATTAGG + Intronic
911948966 1:104147753-104147775 AGCACCCACTCTCCTAGATTAGG - Intergenic
912183790 1:107250283-107250305 AGTAACCACCATCCTGAATTTGG - Intronic
912259431 1:108095576-108095598 ACTCCCCACTCTGCTGGCTTAGG + Intergenic
912445950 1:109736810-109736832 AGTACCCACTCTCAGGGCTTGGG + Exonic
912509485 1:110178900-110178922 AGCAACCACTTTCCTGAATTTGG + Intronic
913230577 1:116737588-116737610 ATTGCCCTCTCTCCTGGAGTGGG + Intergenic
915000533 1:152585409-152585431 AGCACCCACTCTCCTGGATTAGG + Intronic
917062102 1:171052475-171052497 AGTACCCACTATTCTAGATTAGG - Intronic
917062138 1:171052696-171052718 CTTACCCACTCCCCTGGATTAGG - Intronic
918740851 1:188128652-188128674 AGTACCCACTCTCCTGCATTAGG + Intergenic
920592035 1:207229433-207229455 AGTTCCTGCTTTCCTGGATTTGG + Intergenic
921105841 1:211977177-211977199 GGTAACCACTATCCTGAATTTGG - Intronic
921431093 1:215067017-215067039 AATAACCACTCTCCTGGAGTTGG - Intronic
922003594 1:221505013-221505035 AGCACTCACTCTCCTGGATTAGG + Intergenic
922021265 1:221706947-221706969 TGTAACCACTCTGCTGTATTGGG - Intronic
922068861 1:222170880-222170902 AGTTTCCACTCTCCTAGATTAGG + Intergenic
922571786 1:226638687-226638709 ACAACCCACACTCCTGGACTCGG + Intronic
923686631 1:236158039-236158061 AGTAATCACTATCCTGAATTTGG - Intronic
1062925318 10:1311916-1311938 AGTACAGACTCTCAGGGATTAGG - Intronic
1063023938 10:2158741-2158763 AGTTCTCACTCTCCTGAAGTTGG + Intergenic
1063181728 10:3607424-3607446 AGCACTGACTCTCCAGGATTAGG + Intergenic
1065639674 10:27768910-27768932 AATACCCTCTCTTCTGGTTTTGG + Intergenic
1067982775 10:51105652-51105674 TGTCCCCACTCTCCAGGTTTAGG - Intronic
1068147339 10:53088487-53088509 AATACTCACACTACTGGATTAGG - Intergenic
1068192326 10:53667741-53667763 AGCACCCACTCTTCTGAACTGGG + Intergenic
1068433638 10:56963470-56963492 AGCACCCATTCTCCTGGATTAGG + Intergenic
1069228029 10:65968742-65968764 AGTACCCAGTCCCCTGGATTAGG + Intronic
1070552907 10:77504974-77504996 AGACCCGAGTCTCCTGGATTTGG - Intronic
1071894549 10:90051450-90051472 AGCACCCACTCTCCTGGATTAGG - Intergenic
1072190306 10:93072671-93072693 AGCACCCCCTCACCTGGATGAGG + Intergenic
1075180180 10:120204303-120204325 AGCACCCACTTTCTTGGATTAGG - Intergenic
1075954305 10:126508821-126508843 AGTACCTACTCTTCAGGCTTAGG + Intronic
1078541737 11:12218448-12218470 GGTCCCCACTCTCCTGCATGAGG + Intronic
1079743997 11:24101771-24101793 AGCACCTACTCTCTGGGATTAGG + Intergenic
1080063761 11:27985341-27985363 AGAACCCAGTCTCCTGCTTTTGG + Intergenic
1080141503 11:28926354-28926376 AGTCCCCACTCTCAAGTATTTGG - Intergenic
1084622414 11:70281996-70282018 AGAACCCACTCACCTCGCTTAGG + Intronic
1085875922 11:80405958-80405980 GGTACCCACTCTTCTAGATTAGG + Intergenic
1086042443 11:82495432-82495454 AGCACCCACTCTCCTGGTTTAGG - Intergenic
1086559866 11:88155010-88155032 AGCACTTACTCTCTTGGATTAGG + Intronic
1086755630 11:90558354-90558376 AGAACTCACTCTCCTGGGTTCGG + Intergenic
1087356284 11:97098232-97098254 AGCACCCACACGCCTGGATTAGG + Intergenic
1087604941 11:100366180-100366202 AGCATCCACTCTCCTGGATTAGG - Intergenic
1087668601 11:101079920-101079942 AGCACCCACTCTCCTGAATCAGG + Intronic
1088425501 11:109697056-109697078 AGAACCTACTCTCCTGGATTAGG + Intergenic
1090630048 11:128637919-128637941 AGCTCTCACTCTCCTGGATTAGG + Intergenic
1092334690 12:7620606-7620628 AGTCCCCACTATTCTGGCTTAGG - Intergenic
1092872169 12:12815033-12815055 AGTACCAACTTTACAGGATTAGG + Intronic
1093134817 12:15437707-15437729 AGCACCCACTCTCCTGGATTAGG + Intronic
1093809346 12:23473019-23473041 AGCACCCACTCTCTTGGATTAGG + Intergenic
1094452969 12:30601615-30601637 AGTGCCCCCTCTCCTGGATAAGG + Intergenic
1095400877 12:41813805-41813827 AACACCCATTCTCCTGCATTAGG - Intergenic
1095626183 12:44318057-44318079 TGCATCCACTCTACTGGATTAGG - Intronic
1095867086 12:46983812-46983834 AGCACCCAATCTTCTGGATTAGG + Intergenic
1095915697 12:47475529-47475551 AGCAGTCATTCTCCTGGATTTGG + Intergenic
1096189891 12:49609642-49609664 AGCATGCACTCTCCTGGATTAGG + Intronic
1098119887 12:67225179-67225201 GGTAACCATTCTCCTGCATTTGG - Intergenic
1099743345 12:86669481-86669503 AGGACCCATTCTCCTGGATTAGG + Intronic
1100184172 12:92120939-92120961 AATAGCCACTTTCCTGAATTTGG + Intronic
1100931980 12:99619705-99619727 AGAACCTATTCTCCTAGATTAGG + Intronic
1101813198 12:108125512-108125534 GGTAACCTCTCTCCTGAATTTGG + Intergenic
1102062907 12:109947650-109947672 AGGACCCTTTCTTCTGGATTGGG + Intronic
1102346089 12:112162331-112162353 GGCACCCACTCTGCTGGCTTGGG - Exonic
1102672131 12:114629130-114629152 AGTAGCCACTACCCTGAATTTGG - Intergenic
1103885785 12:124199090-124199112 TGTACCCACTGGCCTGGGTTAGG - Intronic
1105236095 13:18554965-18554987 AGCACCCACCTTCCTGAATTAGG + Intergenic
1108075303 13:46673220-46673242 AGTGGCCACCCTCCTGGATTCGG + Intronic
1108154976 13:47575710-47575732 AGCACCCACTCTCCTAGATTAGG + Intergenic
1109078255 13:57865195-57865217 AGCAACTACTCTTCTGGATTAGG + Intergenic
1109309116 13:60671798-60671820 AGCACCCACTCTCCTAGATTAGG - Intergenic
1109646452 13:65264469-65264491 AGCACCCACTCTCCTGGATTAGG + Intergenic
1110742932 13:79018774-79018796 AGTACCCAATCTCCTGGTTTGGG - Intergenic
1111143655 13:84154569-84154591 AGCACCTACTCTCCTGGGTTAGG - Intergenic
1111496879 13:89062217-89062239 AATACCCACTCTCTTGGATTAGG - Intergenic
1112078272 13:95936666-95936688 AACACCCACTGTCCTCGATTAGG - Intronic
1113294060 13:108938580-108938602 AGCACCCACTCTCCTGGAGTAGG - Intronic
1114582479 14:23775087-23775109 AGTAACCACTCTCATGAATTTGG - Intergenic
1114832704 14:26164247-26164269 AACACTCACTCTGCTGGATTAGG - Intergenic
1115963531 14:38862805-38862827 AGCATCTACTCTCTTGGATTAGG - Intergenic
1116195737 14:41723048-41723070 AGCACTCACTCTCCTGGATTAGG - Intronic
1116332211 14:43611487-43611509 AGTACTCACTCTCCTAGATTAGG - Intergenic
1116781327 14:49240811-49240833 AGCACCCACTCGCCTATATTAGG - Intergenic
1116890431 14:50262614-50262636 GGTAACCACTCTCCTGAATTAGG + Intronic
1117818323 14:59621138-59621160 AATACCTACTTTTCTGGATTGGG - Intronic
1117824593 14:59688268-59688290 AACACTCACTCTCCTGGATTAGG + Intronic
1118743166 14:68755913-68755935 AGTGCCCACTCAGCTGGAGTGGG - Intergenic
1119066321 14:71530737-71530759 AGAAGCCACTATCCTGGTTTTGG + Intronic
1120455071 14:84719563-84719585 AGTGGCCACTCTCCTGGATTAGG + Intergenic
1125130595 15:36279550-36279572 AGCACCCACTTGCCTGGACTGGG - Intergenic
1125506039 15:40268147-40268169 GGAAACCACTCCCCTGGATTTGG - Intronic
1128130918 15:65226512-65226534 ACAACCCACTCTCCAGGATCTGG - Intergenic
1129820769 15:78600368-78600390 GGTACCCACCATCCTGGCTTAGG - Intronic
1130715541 15:86329915-86329937 AGCATCCACTCTCCTGGATTAGG + Intronic
1130854250 15:87826907-87826929 AAAACCCATTCTCCTCGATTTGG + Intergenic
1131185679 15:90271992-90272014 AGTACTCACTCTTCTTGCTTAGG + Exonic
1131630718 15:94174199-94174221 AGTACCTGCTCTCCTGCTTTGGG + Intergenic
1131698760 15:94909938-94909960 AGCACCCATTCTCCTGGATTAGG - Intergenic
1132121218 15:99177353-99177375 ATTAGCCACTGTCCTTGATTTGG + Intronic
1133858852 16:9575156-9575178 AGTAACCACGCTGCTGGATTGGG + Intergenic
1134029072 16:10977456-10977478 AGTCCCCAGTCCCCTGGAATGGG + Intronic
1137627018 16:49915562-49915584 TGTACACACTGTCCTGGACTTGG - Intergenic
1141210333 16:81973671-81973693 AGCACCCACTCTCCTGAATTAGG + Intergenic
1141368448 16:83465461-83465483 GTTACCCACTCTCCTGGAAAGGG - Intronic
1143854994 17:9841974-9841996 GGTACCAACTCTCCATGATTTGG - Intronic
1149561341 17:57609858-57609880 AGCACCCACTCTCCTGGCTTGGG + Intronic
1151814015 17:76462200-76462222 AGTCCCCACTCTCCTGGCTCTGG - Intronic
1152182254 17:78830150-78830172 AGTCACCACTATCCTGAATTAGG + Intronic
1155961007 18:31994846-31994868 AGTACCCACTTTCCTAGAAGTGG - Intergenic
1156927278 18:42597041-42597063 AGCACCTTCTCACCTGGATTAGG - Intergenic
1158256716 18:55558853-55558875 AGTACTCACTTTCCTAGATGGGG + Intronic
1158527117 18:58225012-58225034 AGAAACCACTCACCTGGAGTGGG - Intronic
1159304057 18:66616529-66616551 AACACCCAATCTCCTAGATTAGG + Intergenic
1159320280 18:66839065-66839087 AGCACCCATTCTCTTGGATTAGG + Intergenic
1159365790 18:67464371-67464393 AACTCCCACTCTCCTGGATGTGG - Intergenic
1160902456 19:1435382-1435404 AGTCCCCTCGCTCCTGGCTTTGG + Exonic
1164486253 19:28658112-28658134 AGCACCCATTCTTCTAGATTAGG + Intergenic
925704889 2:6675042-6675064 AGCACACACTCACCTGGAATTGG + Intergenic
929069442 2:38014531-38014553 AGTACCCAGTCTCATGAAGTTGG + Intronic
930914694 2:56672489-56672511 AGCAACTGCTCTCCTGGATTAGG - Intergenic
930942379 2:57028245-57028267 AGCACCCACTTTCCTGGATTAGG - Intergenic
931970584 2:67581662-67581684 AGCACCCACTCTCCTGGATTAGG + Intergenic
933336768 2:80968273-80968295 AGCACCCACTCTTCTGGATTAGG + Intergenic
933363928 2:81324551-81324573 AGCACCCACTATCTAGGATTAGG - Intergenic
937510172 2:122586713-122586735 TGAAGCCACTATCCTGGATTTGG + Intergenic
938513692 2:131979644-131979666 AGCACCCACCTTCCTGAATTAGG - Intergenic
939124873 2:138165605-138165627 AGCACTCAGTCCCCTGGATTAGG + Intergenic
940445440 2:153771561-153771583 AGTAAACACTCACCTGGATTGGG - Intergenic
942218621 2:173747209-173747231 AGGACCCACTTTGCTGGCTTTGG - Intergenic
942609383 2:177727163-177727185 AGTGCGCACTCTCCAGGTTTAGG - Intronic
945035595 2:205701231-205701253 AGGACCCAGCCTCCTGGTTTTGG - Intronic
1169515593 20:6312620-6312642 AGCACTCACCCTCCTGGATTAGG + Intergenic
1169671352 20:8106202-8106224 AGCACCCACTCTCTGAGATTAGG + Intergenic
1170841993 20:19931167-19931189 GGTAACCACTATCCTGGATTAGG + Intronic
1171254567 20:23679713-23679735 AGAACCTTCTCACCTGGATTAGG - Intergenic
1171254589 20:23679825-23679847 AGTACCCACTTACCTGGAATAGG - Intergenic
1171257534 20:23701464-23701486 AGCACGCACTCCCCTGGATTAGG + Intergenic
1171261053 20:23734985-23735007 AGAACCTTCTCACCTGGATTAGG - Intergenic
1171261100 20:23735320-23735342 TGTGCCCCCTCACCTGGATTAGG - Intergenic
1171264949 20:23763623-23763645 AGCACTGACTCCCCTGGATTAGG + Intergenic
1171270172 20:23810827-23810849 AGAACCTTCTCACCTGGATTAGG - Intergenic
1171270221 20:23811162-23811184 TGTGCCCCCTCACCTGGATTAGG - Intergenic
1171274592 20:23845314-23845336 AGCACCCACTCCCCTGGATTAGG + Intergenic
1172117747 20:32582597-32582619 AGTCCACCCTCTCCTGGAGTTGG - Intronic
1172570891 20:35969467-35969489 AGTAACCACTTTCCTGAAGTTGG + Intronic
1174601205 20:51726486-51726508 AGTAACTACTCTTCTGAATTTGG - Intronic
1175022528 20:55865770-55865792 AACAACCACTCTCCTGGATTAGG + Intergenic
1175090608 20:56500464-56500486 AATACCCAATCTCCTGGGCTCGG - Intronic
1176200584 20:63858546-63858568 GGTTCCCACCCTCCTGCATTGGG - Intergenic
1176780093 21:13183252-13183274 AGCACCCACCTTCCTGAATTAGG + Intergenic
1177977747 21:27872269-27872291 AGCACCCACCTTCCTGAATTAGG + Intergenic
1179957974 21:44751694-44751716 AGCACCCATTCTCCCTGATTTGG - Intergenic
1180074775 21:45456835-45456857 AGTACCCATCCTCCTGGGTCGGG - Intronic
951284391 3:20791163-20791185 AGCAACAACTCTCCTGGAATAGG + Intergenic
952667265 3:35922146-35922168 AGTACCCACTCTCCTGGATTAGG - Intergenic
954485911 3:50851180-50851202 AGTACTCAATCTCCTGGATTAGG - Intronic
955828387 3:62974287-62974309 AGTACTCACTATCCTGAATTTGG - Intergenic
958156396 3:89761350-89761372 AGCACCCACTGTCTTGGATTAGG - Intergenic
958497552 3:94864248-94864270 AGCACCTATTCTCTTGGATTAGG - Intergenic
959299148 3:104576839-104576861 AGCACCCACTATCTTGGATTAGG - Intergenic
959430656 3:106251373-106251395 AGTATCCACTCTCCTGGATTAGG + Intergenic
959739101 3:109695367-109695389 AGCACCCATTCTCCTGGATTAGG - Intergenic
959948103 3:112148956-112148978 AGCACCCACTCTTCTAGATTAGG - Intronic
962813980 3:138982214-138982236 AGTGCCCTCCTTCCTGGATTGGG + Intergenic
965940064 3:174168917-174168939 AGTACTCACTCTCTTGGATTAGG - Intronic
966459915 3:180165477-180165499 AACACCCATTCTCCTGGATTAGG - Intergenic
970311572 4:14787746-14787768 AGGACCCATTTTCCTGGATTAGG + Intergenic
971206089 4:24570761-24570783 TGCAGCCACTCTCCTGGGTTGGG + Exonic
971614094 4:28764789-28764811 AGCACCCACTCTCCTGGATAAGG + Intergenic
973001825 4:44961363-44961385 AAAACTCACTCTCCTGGATTAGG - Intergenic
973828947 4:54738645-54738667 GGTGCCCACTATCCTGGAGTTGG - Exonic
974180641 4:58380026-58380048 AGCATTCACTCTCCTGGACTAGG - Intergenic
974562689 4:63541876-63541898 AACACCTGCTCTCCTGGATTAGG + Intergenic
977761764 4:100746264-100746286 AGCACCCACTTTCCCAGATTTGG + Intronic
977764094 4:100777057-100777079 AGCACCTACTCTCCTGAATTAGG - Intronic
979150745 4:117311081-117311103 AGAACCCACTCTCCTGAATTAGG - Intergenic
980032405 4:127845804-127845826 CTCACCCACTCACCTGGATTAGG + Intergenic
981719907 4:147790956-147790978 AGTAACCACTATTGTGGATTTGG + Intronic
982647106 4:158037700-158037722 AGCAACCACTTTCCTGGGTTAGG + Intergenic
983338711 4:166429596-166429618 AGTAACTACTCTTCTGGAATTGG + Intergenic
983831954 4:172338910-172338932 AACATCCACTCTCCTGGATTAGG - Intronic
984171749 4:176368170-176368192 AGCACTCACTCTCCTGGATTAGG - Intergenic
984799666 4:183702651-183702673 GGTAACCACTATCCTGAATTGGG - Intronic
985140320 4:186832816-186832838 AGAACACACTCTACAGGATTGGG + Intergenic
985223913 4:187738513-187738535 AGCATCCACTTTTCTGGATTAGG + Intergenic
986557374 5:9025338-9025360 AGGACCCACTCCCCTGCATTAGG - Intergenic
988406339 5:30827668-30827690 AGTACCCACTCTCCTGGATTAGG - Intergenic
988646899 5:33104942-33104964 AGTACCCACTCTCCTGGATTAGG - Intergenic
989378626 5:40791870-40791892 AGTAACCACTATCCTGAATTTGG + Intronic
989446983 5:41541635-41541657 AGCACCCACTCTTCTAGGTTAGG - Intergenic
989460807 5:41696496-41696518 AGCACCCACTCTTTTTGATTAGG - Intergenic
992134271 5:73727499-73727521 AGAACCCACTTTCCTGGATAAGG + Intronic
992373137 5:76165922-76165944 AGTTCTCACTCTCCTGGTCTGGG - Intronic
993217896 5:85048973-85048995 AGCCCCCACCCTCTTGGATTAGG + Intergenic
994399764 5:99264295-99264317 AGTATCCACTCTACTGGATTAGG + Intergenic
995148202 5:108810582-108810604 AGTACCCACTCTCCTGGATTAGG - Intronic
995388677 5:111615581-111615603 AGCACCCACTTTCCTGGATTAGG - Intergenic
1000589704 5:163143933-163143955 AGCACTCACTCTCCTGGATTGGG - Intergenic
1003323472 6:5073848-5073870 ATTACCCACTCCCCTGGGTGTGG - Intergenic
1004788595 6:18997871-18997893 AGCACCCACTCTTCTGGATTAGG - Intergenic
1005207509 6:23421348-23421370 AGCACCCACTCTCCTAGATTAGG + Intergenic
1006509188 6:34512548-34512570 AGTCCCCACCCTCCTGGCCTAGG + Intronic
1006994185 6:38242860-38242882 AGTAACCTTTCTCCTGGACTAGG + Intronic
1007049108 6:38807962-38807984 AGTAACCACTATCCTGAACTTGG + Intronic
1007524441 6:42479669-42479691 AGTTCCCATACTCCTGCATTGGG - Intergenic
1009656888 6:66558693-66558715 AGCTCCCACTCTTCTAGATTGGG - Intergenic
1009787494 6:68358446-68358468 AGCACCCACTCTCCTGGATTAGG - Intergenic
1010948435 6:82005923-82005945 AGTACCCATTATCTTGGATTAGG + Intergenic
1011310784 6:85977530-85977552 AACACTTACTCTCCTGGATTAGG + Intergenic
1013255358 6:108379739-108379761 AGCACCCACTCTCCTGGATGAGG - Intronic
1016175589 6:141074728-141074750 AGAACTCATTCTCCTGGAATAGG - Intergenic
1016220925 6:141668971-141668993 AGCACCTACTTTCATGGATTAGG + Intergenic
1016439463 6:144068283-144068305 AGAACCTGCTCTCCTGGGTTGGG + Intergenic
1022890159 7:34688920-34688942 AGCACCAACTCTTCTAGATTAGG + Intronic
1024338620 7:48234883-48234905 AGGACCCACTCTCTTCCATTAGG + Intronic
1024405114 7:48970056-48970078 AGCACCCATGCTCCTAGATTAGG + Intergenic
1024722108 7:52148867-52148889 AGTTCATACTCTCCTGGATCAGG - Intergenic
1027495170 7:78879036-78879058 AGCATCCACTCTCCTGAATTAGG + Intronic
1028304585 7:89247055-89247077 AGCACCCACTCTCCTGGATTAGG + Intronic
1028333304 7:89622896-89622918 AGCATCCACTCTCCTTGATTAGG + Intergenic
1028431277 7:90749674-90749696 AGCACTTACACTCCTGGATTAGG + Intronic
1028868437 7:95738765-95738787 AGCACCCACTTTCCTAGATTAGG + Intergenic
1031904657 7:127447238-127447260 AACACTCACTCTCCTGGATTAGG + Intergenic
1032734495 7:134678896-134678918 AGTCCCCATTCTTCTGGAATTGG + Exonic
1034113077 7:148557387-148557409 AGCACCTACTCTCCTGGATTAGG - Intergenic
1039651656 8:39347057-39347079 ATTTCCCACTTTCATGGATTGGG + Intergenic
1041171073 8:55142263-55142285 AGTTGCCATTCTCCTGGATAAGG + Exonic
1041445613 8:57948385-57948407 AACATTCACTCTCCTGGATTAGG - Intergenic
1042109707 8:65367637-65367659 AGCACCCACTCTCCTGAATTAGG + Intergenic
1042354375 8:67810143-67810165 AGTTCCCACTGACTTGGATTTGG - Intergenic
1043034548 8:75179349-75179371 AGCACTCACTCTCCTGGATTAGG + Intergenic
1043171547 8:76972628-76972650 AGCACCCACTCTCATGGACAGGG + Intergenic
1043213108 8:77550614-77550636 AGTACTCACTCTCCTGAGTTAGG - Intergenic
1043655718 8:82662860-82662882 AGCACCCACTCTCCTTGATTAGG - Intergenic
1045094709 8:98785342-98785364 AGCACCTACTCTTCAGGATTAGG + Intronic
1047890598 8:129303908-129303930 AACACCCACTGTCCTGGATTAGG - Intergenic
1048192092 8:132299344-132299366 ATTACACACTCTCCTACATTTGG + Intronic
1050295214 9:4197420-4197442 AGCATTCACTCTCCTGGATTAGG + Intronic
1050687809 9:8191119-8191141 GGCACACACTCTCCTGCATTAGG + Intergenic
1055736486 9:79336342-79336364 AGCAACCACTCTCCTGGATTAGG - Intergenic
1057388541 9:94624797-94624819 AGTACCCACTCCCTTCCATTTGG - Intronic
1060084781 9:120687732-120687754 TGTAACCACTATCCTGAATTTGG - Intronic
1061770524 9:132916880-132916902 AGGCCCCAGTCTCCTGGATTCGG + Intronic
1062402719 9:136379485-136379507 AGTGCCCACTGCCCTGGCTTTGG - Intronic
1189314025 X:40040965-40040987 TGTATCTACTGTCCTGGATTTGG + Intergenic
1191087879 X:56588339-56588361 AACACTCACTCTCCTGGAATAGG - Intergenic
1191774104 X:64793616-64793638 AACACCCACTCTCCTGGATTAGG + Intergenic
1193026540 X:76851401-76851423 AGCACCCACTCTCTTGGATGAGG - Intergenic
1193031892 X:76907496-76907518 AACACCCATTCTCCTGGATTAGG + Intergenic
1193697797 X:84730239-84730261 ATCACCCAATCTCATGGATTAGG - Intergenic
1194024537 X:88735671-88735693 AGCACACACTCTCCTGGATTGGG - Intergenic
1194172264 X:90601846-90601868 AGAACACACTCTCCTGTATTAGG + Intergenic
1194424856 X:93723763-93723785 AGTAACCAATATCCTGAATTTGG - Intergenic
1194897992 X:99469188-99469210 AGCGCCCACTCTCCTGGATCAGG + Intergenic
1194923497 X:99796051-99796073 AGCACTCACTCTCCTGGATTAGG - Intergenic
1195064003 X:101222849-101222871 AGTAACCACTATCCTGGATTTGG + Intronic
1195734830 X:108001283-108001305 AGCACCCACTCTCTTGGATTAGG + Intergenic
1196528041 X:116750400-116750422 AGCACCCAATCTCCCAGATTAGG - Intergenic
1196613783 X:117743716-117743738 AGTACCCACTCTCCTGGATTAGG + Intergenic
1198153162 X:133931278-133931300 ACTACCCCCTCCACTGGATTAGG - Intronic
1198968155 X:142249932-142249954 AGCACCCTCTCTCCTGGATTAGG - Intergenic
1199343361 X:146708678-146708700 AGCACCCACTCTCCTGGATTAGG - Intergenic
1200518495 Y:4179582-4179604 AGAACACACTCTCCTGTATTAGG + Intergenic
1200979376 Y:9248089-9248111 AGTACCCACATTTCAGGATTGGG - Intergenic
1202111642 Y:21427433-21427455 AGTACCCACATTTCAGGATTGGG + Intergenic
1202116802 Y:21476704-21476726 AGTACCCACATTTCAGGATTGGG - Intergenic