ID: 1196613786

View in Genome Browser
Species Human (GRCh38)
Location X:117743724-117743746
Sequence CTCTCCTGGATTAGGAGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 18, 1: 38, 2: 67, 3: 73, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196613780_1196613786 9 Left 1196613780 X:117743692-117743714 CCAGGCATATCTCCAGGCATCTT No data
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613779_1196613786 10 Left 1196613779 X:117743691-117743713 CCCAGGCATATCTCCAGGCATCT No data
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613775_1196613786 26 Left 1196613775 X:117743675-117743697 CCCTCTGGACTCCACACCCAGGC No data
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613777_1196613786 15 Left 1196613777 X:117743686-117743708 CCACACCCAGGCATATCTCCAGG 0: 5
1: 35
2: 69
3: 169
4: 466
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613776_1196613786 25 Left 1196613776 X:117743676-117743698 CCTCTGGACTCCACACCCAGGCA No data
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203
1196613781_1196613786 -3 Left 1196613781 X:117743704-117743726 CCAGGCATCTTGAGTACCCACTC No data
Right 1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG 0: 18
1: 38
2: 67
3: 73
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196613786 Original CRISPR CTCTCCTGGATTAGGAGTTT AGG Intergenic
902715354 1:18269039-18269061 TGCTCCTGGATTAAGAGGTTTGG - Intronic
905332783 1:37218581-37218603 CTCTGTTGGAGTAGGAGTTCAGG - Intergenic
906843005 1:49160460-49160482 CTCTCCTGTATGAGGTGTCTGGG + Intronic
908592752 1:65651558-65651580 ATCTCCTCTGTTAGGAGTTTTGG - Intergenic
908622540 1:66000521-66000543 CTTTCCTGAACTAGGAGGTTGGG + Intronic
908705328 1:66947739-66947761 CTGGCCTGGTTGAGGAGTTTGGG - Intronic
910579379 1:88805981-88806003 ATCTTCTGAATTAAGAGTTTTGG + Exonic
911392390 1:97262629-97262651 CTCTACAGAATTAGCAGTTTGGG + Intronic
911948963 1:104147745-104147767 CTCTCCTAGATTAGGAGCTTAGG - Intergenic
912040422 1:105383327-105383349 CTCTTTTGGATTAAGAGTTTAGG - Intergenic
916670567 1:167015066-167015088 TTCTTCTGGATTGGGAGTTGTGG - Intronic
917062099 1:171052467-171052489 CTATTCTAGATTAGGAGCTTAGG - Intronic
917821561 1:178768861-178768883 CTCTCCTGGATTATGAGTTTAGG - Intronic
918740854 1:188128660-188128682 CTCTCCTGCATTAGGAGTTTAGG + Intergenic
920732016 1:208496512-208496534 GTCTCCTGAATTAGCAGTTTAGG - Intergenic
922003595 1:221505021-221505043 CTCTCCTGGATTAGGAGTTTAGG + Intergenic
922068863 1:222170888-222170910 CTCTCCTAGATTAGGAGTTTAGG + Intergenic
922375455 1:224959382-224959404 CTCTTCTGAATTAGGACTATTGG + Intronic
923974991 1:239252455-239252477 CTCTCATGGAATAGCAGATTTGG + Intergenic
924253318 1:242157740-242157762 CTCTCCTGGATGAGGTGTCTGGG + Intronic
924683252 1:246259927-246259949 CTCTTCTGGATTTGGAGTTTAGG - Intronic
1064306117 10:14168079-14168101 CTCTTCTGCATTAGAAGTTCAGG - Intronic
1065987926 10:30974971-30974993 CTCTCCAGGATTATCAGGTTAGG - Intronic
1068197177 10:53731978-53732000 CTCTCCTCGCTTTGGAATTTAGG - Intergenic
1069228032 10:65968750-65968772 GTCCCCTGGATTAGGAGTTTAGG + Intronic
1069346586 10:67477149-67477171 CTTTCCTGGACTAAGAGTTTAGG + Intronic
1071894544 10:90051442-90051464 CTCTCCTGGATTAGGGGTTTAGG - Intergenic
1072374803 10:94803732-94803754 CTCACCTGGATTAGAAGTTTAGG - Intronic
1073101316 10:101008209-101008231 CTATCCTGGCTTGGGAGGTTGGG + Intronic
1075180177 10:120204295-120204317 CTTTCTTGGATTAGGAGTTTAGG - Intergenic
1075660316 10:124190062-124190084 CTCTCCTGGTTTTGGTGTTAGGG + Intergenic
1075951641 10:126482877-126482899 CTCTGCTGGAAAAGGAGTTAAGG + Intronic
1077106513 11:844663-844685 CTCTCCTGGGTGTGGAGTGTTGG + Intronic
1077953498 11:6988433-6988455 CTGTTCTAAATTAGGAGTTTAGG - Intergenic
1078005825 11:7531554-7531576 CTCTCCTGGATTAAGAGGGAAGG + Intronic
1078322516 11:10349409-10349431 CTCTGCTGGTTTAGAAGTCTTGG + Intronic
1078989542 11:16632743-16632765 CTCTTTTGGATTAGGAATTTAGG - Intronic
1079258445 11:18853142-18853164 CTCTTCTGGATTAGCAGTTTAGG + Intergenic
1079743999 11:24101779-24101801 CTCTCTGGGATTAGGAGTTTAGG + Intergenic
1085875925 11:80405966-80405988 CTCTTCTAGATTAGGTGTTTAGG + Intergenic
1086042440 11:82495424-82495446 CTCTCCTGGTTTAGGATTTTAGG - Intergenic
1086494142 11:87385098-87385120 CTTTCCCAGATTAGGAGTTTAGG + Intergenic
1087356287 11:97098240-97098262 CACGCCTGGATTAGGAGTTTAGG + Intergenic
1087562011 11:99802575-99802597 CTTTCCTAGATTAGGAGTTTAGG - Intronic
1087604939 11:100366172-100366194 CTCTCCTGGATTAGGAGTTTAGG - Intergenic
1087668604 11:101079928-101079950 CTCTCCTGAATCAGGAGCTTAGG + Intronic
1088425503 11:109697064-109697086 CTCTCCTGGATTAGGAGTTTAGG + Intergenic
1088471011 11:110187539-110187561 CTCTCCTAGAGCAGGAGTTTAGG + Intronic
1090630049 11:128637927-128637949 CTCTCCTGGATTAGGAGCTTAGG + Intergenic
1091962594 12:4710584-4710606 CCCTCCTGGATGAGCAGTTGGGG + Intronic
1092674563 12:10901314-10901336 CTCTCCTGGATTAAGAGTTTAGG + Intronic
1093026610 12:14251217-14251239 CTTACCTGGATTAGGAGTATGGG - Intergenic
1094452974 12:30601623-30601645 CTCTCCTGGATAAGGAGTTTAGG + Intergenic
1095626180 12:44318049-44318071 CTCTACTGGATTAGGAGTTCGGG - Intronic
1095780100 12:46049509-46049531 CTCTCTTGGATTAGAAGTTTAGG + Intergenic
1095845009 12:46735054-46735076 TTCTCCTGGATTTTGAGTTTAGG + Intergenic
1095908045 12:47397508-47397530 CTCTCCTGGATTAGGAGTTTAGG + Intergenic
1095915698 12:47475537-47475559 TTCTCCTGGATTTGGAATTTAGG + Intergenic
1096189892 12:49609650-49609672 CTCTCCTGGATTAGGAGTTTAGG + Intronic
1097160825 12:57045547-57045569 CTTTCCTGGCTTAATAGTTTTGG - Intronic
1097583602 12:61488270-61488292 CTCTACTGGATTGGAAGTTTAGG - Intergenic
1097662489 12:62446034-62446056 CTTTCTTGGATTAAGTGTTTTGG - Intergenic
1098839288 12:75459622-75459644 CTCTCCTAGATTAGAAGTTTAGG + Intergenic
1098931754 12:76424865-76424887 CTCTCCTGGATATGTACTTTTGG - Intronic
1099743349 12:86669489-86669511 TTCTCCTGGATTAGGGTTTTAGG + Intronic
1099768469 12:87021234-87021256 CTCTTCTGGGTTAGGAATTTAGG + Intergenic
1099901488 12:88716245-88716267 CTCTTCTAGATTAGTAGTTTAGG - Intergenic
1100931982 12:99619713-99619735 TTCTCCTAGATTAGGAGTTTAGG + Intronic
1101521411 12:105485653-105485675 CTTTCCTCTCTTAGGAGTTTGGG + Intergenic
1103314276 12:120039754-120039776 CTGGCCTGGAGGAGGAGTTTGGG + Intronic
1104918949 12:132280654-132280676 CTCTGCTGGCTCAGGAGTCTGGG - Intronic
1106046067 13:26143418-26143440 CACTACTGAATTGGGAGTTTAGG - Intronic
1106156690 13:27164812-27164834 CTCTTCTAGACTAGGAGATTGGG + Intronic
1106249571 13:27973287-27973309 CTCTACTTAATTTGGAGTTTAGG + Intergenic
1107217011 13:37934062-37934084 CTTTTCTGGATTAGTAATTTAGG + Intergenic
1108968223 13:56339286-56339308 TTCTCCTGGTTTAGGAGTTTAGG + Intergenic
1109078256 13:57865203-57865225 CTCTTCTGGATTAGGAGTTCAGG + Intergenic
1109309113 13:60671790-60671812 CTCTCCTAGATTAGGAGTTTAGG - Intergenic
1109596814 13:64567012-64567034 CTTTCCTGGTTTTGGAGTTAGGG + Intergenic
1110007562 13:70292179-70292201 CTCTTCTGGGAAAGGAGTTTAGG - Intergenic
1110128593 13:71978950-71978972 TTCCTCTGGATTAGGAGATTAGG + Intergenic
1110491824 13:76118468-76118490 CTCTCCTGAATTAAGAATTTAGG + Intergenic
1110638289 13:77791383-77791405 CTCACTTGGATTAAGAATTTAGG + Intergenic
1111143653 13:84154561-84154583 CTCTCCTGGGTTAGGAGTTTAGG - Intergenic
1111464600 13:88592507-88592529 CTCTCCTGGTATACGAGCTTAGG + Intergenic
1112078269 13:95936658-95936680 CTGTCCTCGATTAGGAGTTTAGG - Intronic
1112223270 13:97513275-97513297 TGCTCCTGGATTATGAGTTTAGG - Intergenic
1112576713 13:100642764-100642786 TACTCCTGGAATAGGAGTTTGGG + Intronic
1113294056 13:108938572-108938594 CTCTCCTGGAGTAGGAGGTTAGG - Intronic
1113353227 13:109550162-109550184 CTCCCCTATTTTAGGAGTTTAGG + Intergenic
1114832703 14:26164239-26164261 CTCTGCTGGATTAGGAGTTTAGG - Intergenic
1115963530 14:38862797-38862819 CTCTCTTGGATTAGGAATTTAGG - Intergenic
1116195736 14:41723040-41723062 CTCTCCTGGATTAGGAGTTGAGG - Intronic
1116332210 14:43611479-43611501 CTCTCCTAGATTAGGAGTTTAGG - Intergenic
1116781323 14:49240803-49240825 CTCGCCTATATTAGGAGGTTAGG - Intergenic
1120121075 14:80680681-80680703 CTCTCCTAGATTAGAAGTGTAGG + Intronic
1120279376 14:82419916-82419938 CCCCACTGAATTAGGAGTTTAGG - Intergenic
1120723217 14:87909868-87909890 CTCTTCTGAAATAGGAGGTTAGG - Intronic
1121218972 14:92271627-92271649 CCCTCCTAAATTAGGAGTTGAGG + Intergenic
1121808998 14:96862640-96862662 CTCTGCTGGATGAGAAGTTGGGG + Intronic
1122721780 14:103726346-103726368 CTTCCCTGGTTTAGGGGTTTAGG + Intronic
1202843438 14_GL000009v2_random:145215-145237 CTCTCCTGTATTCGGAGATCAGG - Intergenic
1202879806 14_KI270722v1_random:47227-47249 CTCTCCTGTATTCGGAGATCAGG + Intergenic
1125369006 15:38949887-38949909 CTCTCTAGGATTAAGAGTCTGGG - Intergenic
1125383879 15:39115620-39115642 CCCTCCTGGATTAGAAGTTTAGG + Intergenic
1129753212 15:78080297-78080319 CCCTCCTGGACTAAGAGTCTGGG + Intronic
1130715543 15:86329923-86329945 CTCTCCTGGATTAGGAATTTAGG + Intronic
1131585135 15:93684709-93684731 TTCTCCTGGATTAGTAGTTTAGG + Intergenic
1131675703 15:94668094-94668116 CTCTCCAGGATTAGGAGGAAAGG - Intergenic
1131698757 15:94909930-94909952 TTCTCCTGGATTAGGAGTTTAGG - Intergenic
1131838107 15:96409934-96409956 CTGTCCTGACTTAGGACTTTCGG - Intergenic
1131852842 15:96561362-96561384 CTCTCCTGGATTTGAAATGTGGG - Intergenic
1133526353 16:6609616-6609638 CTTTACTGGATTAGCTGTTTGGG + Intronic
1133876397 16:9738963-9738985 CTCAGCTTGATTAGGAGTGTCGG - Intergenic
1133970841 16:10567024-10567046 CTCTGCTGACTTAGGAGTTGGGG - Intronic
1136640180 16:31557488-31557510 CTCACCTGGATTTTGAGTTCTGG + Intergenic
1136644244 16:31595982-31596004 CACTCCTGCATTTGGAGTCTTGG - Intergenic
1136660878 16:31760591-31760613 CACTCCTGCATTTGGAGTCTTGG + Exonic
1138507253 16:57484558-57484580 CTCTCCTGGCTTAAGGGTCTGGG - Intronic
1138810152 16:60139857-60139879 TTCTCCTGGATTAGGAGTTTAGG - Intergenic
1139342655 16:66278511-66278533 CTGTCCTGGATTAGAAGTGTAGG + Intergenic
1141210336 16:81973679-81973701 CTCTCCTGAATTAGGAATTTAGG + Intergenic
1141783064 16:86177304-86177326 CTATACTGGACTAGGATTTTGGG + Intergenic
1145809436 17:27755704-27755726 CTCTCCGGCATTAGGGGTTAGGG + Intergenic
1146675046 17:34767641-34767663 CTCCCCTGGATTTGGAATTAGGG - Intergenic
1147891698 17:43721883-43721905 CCTTCCTGGCTTAGGATTTTAGG + Intergenic
1149020812 17:51962220-51962242 CTTTCCTGAATCAGGAGTTTAGG + Intronic
1149112134 17:53046615-53046637 CTCTCCTGGATAAGGAGTTTAGG + Intergenic
1152039416 17:77893298-77893320 GTGTCCTGGTTTAGGGGTTTAGG - Intergenic
1155676851 18:28440380-28440402 CTCTCCTGGATTATGAATTTAGG - Intergenic
1156666011 18:39408047-39408069 CTCTCCTGGATCATGTATTTGGG + Intergenic
1156886484 18:42141332-42141354 CTTTCCTGGATCAGAAGTTTAGG + Intergenic
1156927276 18:42597033-42597055 CTCACCTGGATTAGGAGTTTAGG - Intergenic
1157193120 18:45597777-45597799 CTCTCCTGGATTAGGTGAATAGG - Intronic
1159069094 18:63603267-63603289 CTCTCCTGGAAGTGTAGTTTTGG + Intronic
1159304060 18:66616537-66616559 ATCTCCTAGATTAGGAGTTTAGG + Intergenic
1159320284 18:66839073-66839095 TTCTCTTGGATTAGGAGTTTGGG + Intergenic
1159365787 18:67464363-67464385 CTCTCCTGGATGTGGAGTTTAGG - Intergenic
1160440049 18:78882873-78882895 CTCTCCTGGATTAGCAGCTTAGG - Intergenic
1160440298 18:78884383-78884405 CTCTCCTGGATTAGTAGCTTAGG + Intergenic
1161543458 19:4866347-4866369 CTCACTAGGAATAGGAGTTTGGG + Intronic
1164486256 19:28658120-28658142 TTCTTCTAGATTAGGAGTTTAGG + Intergenic
1166267516 19:41694464-41694486 CTCACCTGGATTTGGACTTTGGG - Intronic
1166278213 19:41770467-41770489 TTCTCCTTGAATAGGAGTATAGG - Intronic
1167735114 19:51289655-51289677 ATTTCCTAGATTAGGAATTTGGG + Intergenic
1168660589 19:58162706-58162728 TGCACCTTGATTAGGAGTTTGGG + Intergenic
1168677432 19:58289004-58289026 CTTGCATGGATTAGGAGTATGGG + Intronic
1202655424 1_KI270708v1_random:16246-16268 CTCTCCTGTATTCGGAGATCAGG + Intergenic
925246120 2:2384761-2384783 CTGTCCTGGGTTAGGATTCTGGG + Intergenic
925768460 2:7259761-7259783 TTCTCCTGGATTAGAAGCTTAGG + Intergenic
926331401 2:11828878-11828900 CTCTCCTGGAGCAGTAGATTAGG - Intergenic
927617445 2:24613567-24613589 CTCTCCTGGATTAAGAGTTCAGG - Intronic
928799339 2:35067965-35067987 CTCTTCTAGATTAGGAGTTTAGG + Intergenic
930210802 2:48635049-48635071 CTACCCTGGATTAGAATTTTAGG - Intronic
931528501 2:63186062-63186084 CTCACCTGGTCTAGGAGCTTTGG - Intronic
931970587 2:67581670-67581692 CTCTCCTGGATTAGGAGTTTAGG + Intergenic
932534768 2:72581643-72581665 ATCTCCTGGACAAGGAGTTTGGG + Intronic
933336771 2:80968281-80968303 CTCTTCTGGATTAGGAGTTGAGG + Intergenic
934581583 2:95445322-95445344 CATTCCTGGATGAGGTGTTTTGG + Intergenic
934597867 2:95631392-95631414 CATTCCTGGATGAGGTGTTTTGG - Intergenic
936561093 2:113540763-113540785 ATTTCCTGGTTTTGGAGTTTGGG + Intergenic
936587058 2:113767310-113767332 ATCTCCCTGATTTGGAGTTTGGG - Intergenic
936621988 2:114109547-114109569 TTCATCTGGATTAGGAGCTTGGG + Intergenic
936820155 2:116510592-116510614 CTCTCCTGGATTAGAAGTTTAGG - Intergenic
937552528 2:123112419-123112441 CTCACTTGCATTAGGAGTTTAGG + Intergenic
937594642 2:123659152-123659174 TTCTCCTGGATGATGAGTCTTGG - Intergenic
937823247 2:126335280-126335302 TTCTCCTGTATTAGGTATTTAGG + Intergenic
938241828 2:129748148-129748170 CTCTCCTGGATTAGGAATTTAGG + Intergenic
939124874 2:138165613-138165635 GTCCCCTGGATTAGGAGTTCAGG + Intergenic
939247484 2:139644811-139644833 GTTTTCTGAATTAGGAGTTTAGG - Intergenic
940042160 2:149371966-149371988 CTCCCCTGGGTTTGGAATTTTGG - Intronic
940404277 2:153283316-153283338 CTCTCATGAATTAGGCATTTAGG - Intergenic
940445357 2:153770972-153770994 CTCTTCTAGATTAGAAGTTTAGG - Intergenic
940581728 2:155588428-155588450 CTCTGCTGGATTAGGGATTCTGG - Intergenic
941043931 2:160651729-160651751 ATATCCTGTATGAGGAGTTTAGG + Intergenic
941587593 2:167379869-167379891 TTCTCCTGTGTTAGAAGTTTAGG - Intergenic
945494925 2:210498736-210498758 CTCTACTGGAATAAGAATTTAGG - Intronic
946037077 2:216752753-216752775 TTCCCCTGGATTAGAAGATTAGG - Intergenic
946225289 2:218261240-218261262 CTCTCCAGGATCTGGGGTTTGGG - Intronic
947350612 2:229240469-229240491 CTCTCCTGGATATAGAGTTCTGG + Intronic
1169515595 20:6312628-6312650 CCCTCCTGGATTAGGAGTTTAGG + Intergenic
1171257535 20:23701472-23701494 CTCCCCTGGATTAGGAATTTAGG + Intergenic
1171264950 20:23763631-23763653 CTCCCCTGGATTAGGAATTGAGG + Intergenic
1171274595 20:23845322-23845344 CTCCCCTGGATTAGGAATTTAGG + Intergenic
1172219270 20:33261660-33261682 CTCTCTTGGATCACGTGTTTTGG - Intergenic
1173256555 20:41398008-41398030 CTCTCCTGGAGAACGTGTTTTGG + Intergenic
1174837828 20:53874881-53874903 CACTCCTGGACTATGACTTTTGG - Intergenic
1175022530 20:55865778-55865800 CTCTCCTGGATTAGGAGTTTAGG + Intergenic
1176632197 21:9150126-9150148 CTCTCCTGTATTCGGAGATCAGG - Intergenic
1176641110 21:9304690-9304712 CTCTCCTGTATTCGGAGATCAGG + Intergenic
1178201244 21:30408722-30408744 CTCTCCTGGATTAAGAGTTTAGG + Intronic
1180350131 22:11794072-11794094 CTCTCCTGTATTCGGAGATCAGG + Intergenic
1180374416 22:12077517-12077539 CTCTCCTGTATTCGGAGATCAGG + Intergenic
1180388079 22:12198180-12198202 CTCTCCTGTATTCGGAGATCAGG - Intergenic
1181368603 22:22398871-22398893 CTGTCATAGATGAGGAGTTTGGG - Intergenic
1181389035 22:22565817-22565839 TTTTCCTGGATCAGGAGTCTGGG + Exonic
1183781190 22:39999979-40000001 CCCTCCTGGATTGGGAACTTTGG + Intronic
1185064076 22:48621944-48621966 TTTTCCTAGATGAGGAGTTTGGG + Intronic
949435295 3:4022877-4022899 TTCACCTGGATTAGAAGTTTGGG - Intronic
949663023 3:6303755-6303777 CTCCCCTGAGTTAGGAGTCTAGG + Intergenic
951236419 3:20241151-20241173 CTCTCCTGGGTTAGGAATTTAGG + Intergenic
951284392 3:20791171-20791193 CTCTCCTGGAATAGGAGCTTAGG + Intergenic
951325455 3:21297150-21297172 CTTTCCTGGATCAGGAATTTAGG + Intergenic
951723793 3:25732382-25732404 TTCTCCAGGTTTAGGGGTTTTGG + Exonic
952667262 3:35922138-35922160 CTCTCCTGGATTAGGAGTTTAGG - Intergenic
954130047 3:48556300-48556322 CTCTCCTGGCCAAGGAGTGTGGG - Intronic
954485910 3:50851172-50851194 ATCTCCTGGATTAGGAGTTTAGG - Intronic
955214264 3:56971932-56971954 CTCTCCTGGATGAGGAGACAAGG - Intronic
955381516 3:58442214-58442236 CTTTCCTCGCTTTGGAGTTTAGG - Intergenic
955581002 3:60422201-60422223 CTCTCCAGTATTTGGACTTTGGG - Intronic
955667048 3:61361047-61361069 TTCTCCTGAATTAAGATTTTAGG + Intergenic
957923293 3:86775142-86775164 CTCTCCTTCATTAGAATTTTAGG - Intergenic
958156393 3:89761342-89761364 CTGTCTTGGATTAGGACATTAGG - Intergenic
958156481 3:89761911-89761933 CTGTCCTGGATTAGCAATCTAGG - Intergenic
958823946 3:99007606-99007628 CTCTCTTACATTAGGAGTTTAGG - Intergenic
959138679 3:102456983-102457005 CTCTCCTGGAGTACGTGCTTTGG - Intronic
959299145 3:104576831-104576853 CTATCTTGGATTAGGAGTTTTGG - Intergenic
959430658 3:106251381-106251403 CTCTCCTGGATTAGGAGTTTAGG + Intergenic
959739098 3:109695359-109695381 TTCTCCTGGATTAGGAGTTGAGG - Intergenic
959948100 3:112148948-112148970 CTCTTCTAGATTAGGAGCTTAGG - Intronic
961093635 3:124136741-124136763 GTGTCCTGGATTAGGATTCTAGG - Intronic
961470871 3:127111158-127111180 CTCTCCCCGCTTTGGAGTTTAGG + Intergenic
964919187 3:161875388-161875410 CTCTTCTGTATTAAGAGTTTAGG + Intergenic
965413833 3:168367315-168367337 TTCTCCTGCATTTAGAGTTTTGG - Intergenic
1202745784 3_GL000221v1_random:100336-100358 CTCTCCTGTATTCGGAGATCAGG - Intergenic
969577408 4:8044372-8044394 CTCGCCTAGATAAGGAATTTTGG + Intronic
969905911 4:10395980-10396002 CTCTCCTGGATGAGCAGTTTAGG - Intergenic
970333989 4:15013841-15013863 CTTTCCTAGAGTAGGAGTTTAGG + Intronic
970668492 4:18366659-18366681 CTTTCTTGAATTAGGAGTTTAGG + Intergenic
971531298 4:27692639-27692661 CTCACCTGAATTAGGAGTTTAGG - Intergenic
971614097 4:28764797-28764819 CTCTCCTGGATAAGGAGTTTAGG + Intergenic
971944513 4:33255984-33256006 CTGTCCTGTATTAGATGTTTCGG + Intergenic
971950075 4:33333040-33333062 CTATCCTGAATTAGGAGTTTAGG + Intergenic
973001824 4:44961355-44961377 CTCTCCTGGATTAGGAGTTTTGG - Intergenic
975201294 4:71592998-71593020 CTCTTCTAGCTTAGGAGTCTGGG + Intergenic
975276302 4:72505745-72505767 CTTTCCAGGATTAGAAGTCTAGG - Intronic
975698324 4:77037063-77037085 CTGGCCTGGATTAGTAATTTCGG - Exonic
975753863 4:77552765-77552787 CTCTGTTGGATCAGAAGTTTAGG - Intronic
977761767 4:100746272-100746294 CTTTCCCAGATTTGGAGTTTAGG + Intronic
979150742 4:117311073-117311095 CTCTCCTGAATTAGGAGTTCAGG - Intergenic
979504916 4:121485040-121485062 CTCTCTTGGAGTAAGAGTTTAGG - Intergenic
979913851 4:126405223-126405245 CTCCCTTGGATTAAGGGTTTAGG + Intergenic
979962460 4:127036959-127036981 CTCACCTGGATTAGTCATTTAGG + Intergenic
980067756 4:128208942-128208964 CAAGCCTGGAATAGGAGTTTAGG + Intronic
980296365 4:130923384-130923406 TGCTCCTGGATTAAGAGTTTAGG - Intergenic
981198058 4:141943385-141943407 CTCTCCTAGATTGAGAGTTTAGG + Intergenic
981679622 4:147381723-147381745 CTCTCCTGGATTAAGAATTAAGG + Intergenic
981987501 4:150875321-150875343 TTTTCCTGGATTAGGAGTTTAGG + Intronic
982398853 4:154943502-154943524 CTCTCCTTGCTTTGAAGTTTAGG + Intergenic
982647108 4:158037708-158037730 CTTTCCTGGGTTAGGAGTTTAGG + Intergenic
982843721 4:160223896-160223918 CTCTCCTGGATTAGAAGTTTAGG - Intergenic
983831952 4:172338902-172338924 CTCTCCTGGATTAGGAGTTTAGG - Intronic
984171748 4:176368162-176368184 CTCTCCTGGATTAGGAGTTTAGG - Intergenic
985170876 4:187148737-187148759 CTCTCCTGGAGGAGGAGAGTGGG + Intergenic
985308862 4:188575374-188575396 CTCTCCTGGATTAGGGATAATGG + Intergenic
985362262 4:189188288-189188310 CTCTCCTGGAGCAGAACTTTTGG + Intergenic
1202755999 4_GL000008v2_random:62956-62978 CTCTCCTGTATTCGGAGATCAGG + Intergenic
986557371 5:9025330-9025352 CTCCCCTGCATTAGGAGTTTAGG - Intergenic
986822816 5:11486507-11486529 CCTTCCTGGATAAGGAATTTGGG - Intronic
987962123 5:24824040-24824062 CTCTACTGGATTAGCAGTTTAGG - Intergenic
988069352 5:26266926-26266948 CTCTCCTGGATTAGAGGTTTAGG - Intergenic
988304852 5:29481068-29481090 CTCTCCTGTATTAAGAATATAGG + Intergenic
989460804 5:41696488-41696510 CTCTTTTTGATTAGGAGTTTAGG - Intergenic
992979730 5:82156377-82156399 AACTCCTGGATTAGAATTTTGGG + Intronic
993217902 5:85048981-85049003 CCCTCTTGGATTAGGAGTTTAGG + Intergenic
993279602 5:85908327-85908349 CTCCACTGGATTAGGAGTTTAGG + Intergenic
993279788 5:85910280-85910302 CTCCACTGGATTAGGAGTTTAGG - Intergenic
993443195 5:87980524-87980546 CTCTCCTAGGTTAGGCCTTTAGG - Intergenic
993971894 5:94429859-94429881 CTCTCCTAGATTACAAGTTTAGG - Intronic
995244915 5:109924355-109924377 CCCTCCTGAATTGGGAGATTTGG + Intergenic
995622231 5:114039195-114039217 TTCTTCTAGATTAGAAGTTTAGG - Intergenic
996567024 5:124891316-124891338 TTCTCCAGGATTACAAGTTTAGG + Intergenic
996837643 5:127811345-127811367 CTCTCCTTGCATAGGAGTTGGGG + Intergenic
997783705 5:136686111-136686133 CTTTCTTGAATTAGGAGTTTAGG + Intergenic
999591163 5:153148209-153148231 GTCTCCTGGATTGAGAGTTTAGG + Intergenic
1000589703 5:163143925-163143947 CTCTCCTGGATTGGGAGTTTAGG - Intergenic
1002639656 5:180624756-180624778 CTCTCCTGCTTTAGGAGCTGCGG + Intronic
1004599391 6:17132986-17133008 ATCTCCTGCATTAGGAATTTGGG + Intergenic
1004788592 6:18997863-18997885 CTCTTCTGGATTAGGAATTTAGG - Intergenic
1005207512 6:23421356-23421378 CTCTCCTAGATTAGGAGTTCAGG + Intergenic
1006046326 6:31301813-31301835 CTCAGCTGGTCTAGGAGTTTGGG + Intronic
1007132709 6:39491441-39491463 TTTTTCTGGATCAGGAGTTTGGG - Intronic
1007411151 6:41662537-41662559 CTCTGCTGGAGAAGGAGCTTTGG + Intergenic
1007582264 6:42966579-42966601 CTCTCCTGGCTGAGGACTTTGGG - Exonic
1008990819 6:57599244-57599266 CTCTCATGGATTAAGAGCTCAGG - Intronic
1009526298 6:64750995-64751017 TTCTTCTAGATTAGGAGTTTAGG + Intronic
1009656885 6:66558685-66558707 CTCTTCTAGATTGGGAGTTTAGG - Intergenic
1009787491 6:68358438-68358460 CTCTCCTGGATTAGGAGCTTAGG - Intergenic
1010543750 6:77124500-77124522 CTATCCTGGATTAAGAATTCAGG + Intergenic
1011255641 6:85418133-85418155 TTCTCCTGAATTTGGAGTCTGGG - Intergenic
1011310785 6:85977538-85977560 CTCTCCTGGATTAGGAGTGTAGG + Intergenic
1011311114 6:85980879-85980901 CTCTCTTGGGTTAGGAGTGTAGG - Intergenic
1011652055 6:89515767-89515789 CTCTCCTGGATTACTAGGGTAGG + Intronic
1011955108 6:93016503-93016525 CTCTTCTAGATTAGGAATTTAGG + Intergenic
1011957133 6:93037344-93037366 CTCTTCTGAATTAGTAGTTTAGG - Intergenic
1012676078 6:102114898-102114920 CTCTCCTGGATTAAGTGTTTAGG - Intergenic
1013255355 6:108379731-108379753 CTCTCCTGGATGAGGAGCTTAGG - Intronic
1013895146 6:115078970-115078992 CTCTCTTGGCTTTGGTGTTTTGG - Intergenic
1015306598 6:131715673-131715695 CTCTCCTGGAGTAAGAGATTAGG + Intronic
1015350217 6:132209750-132209772 CTCTCCTGGGTTAGTAGTTTAGG - Intergenic
1016220927 6:141668979-141669001 CTTTCATGGATTAGGAGTTTAGG + Intergenic
1016293799 6:142552272-142552294 CCCTCCTCCCTTAGGAGTTTAGG + Intergenic
1017688960 6:156944438-156944460 CTCTCCTGTATGATCAGTTTGGG + Intronic
1018802582 6:167235691-167235713 CCCGCCTGGATTAGGAGGTCAGG + Intergenic
1018816670 6:167337463-167337485 CTCCCCTGGAATAGGCTTTTAGG - Intronic
1019177145 6:170165725-170165747 CTTTCCAGGATTAGGAGGTGAGG - Intergenic
1021307061 7:19045442-19045464 CTCTTCTGGATTATTAGTTTAGG + Intronic
1021351722 7:19602337-19602359 CCCTCCTGGAATAGCAGTTTAGG - Intergenic
1023290153 7:38660034-38660056 CCCTCCTGGGTTAGAAGTTTAGG + Intergenic
1024657593 7:51464899-51464921 CTCTGCTGGTTTAGGCATTTTGG - Intergenic
1024701481 7:51908362-51908384 CTCAAATGGATTAAGAGTTTCGG + Intergenic
1026131098 7:67621586-67621608 ATCTCCTGTATCAGAAGTTTAGG - Intergenic
1027495172 7:78879044-78879066 CTCTCCTGAATTAGGAGATTAGG + Intronic
1028304588 7:89247063-89247085 CTCTCCTGGATTAGGAGTTTAGG + Intronic
1028333306 7:89622904-89622926 CTCTCCTTGATTAGGAGTTTAGG + Intergenic
1028431278 7:90749682-90749704 CACTCCTGGATTAGGAGTTTAGG + Intronic
1028868440 7:95738773-95738795 CTTTCCTAGATTAGGAGTTTAGG + Intergenic
1030754247 7:113269064-113269086 CACTTCTAGATTAGGAATTTAGG + Intergenic
1033220314 7:139523323-139523345 CTCTCCTTTATCAAGAGTTTGGG + Intergenic
1033679854 7:143583618-143583640 CTCTCCTGGATTAAGAGATCAGG + Intergenic
1033691980 7:143745825-143745847 CTCTCCTGGATTAAGAGATCAGG - Intergenic
1033730951 7:144178827-144178849 CTCTCCTGGAGTAAGAGATTAGG - Intergenic
1034063151 7:148111216-148111238 CTACCCTGGATTGTGAGTTTGGG - Intronic
1034113075 7:148557379-148557401 CTCTCCTGGATTAGGAATTTAGG - Intergenic
1034460191 7:151193789-151193811 CACTCCTGGATTATGAGTGGTGG + Intronic
1035904080 8:3490494-3490516 CTCTCTTAAATTAGGTGTTTTGG + Intronic
1037209686 8:16371449-16371471 CTCTCCTGTCTTTGGAGTTCGGG - Intronic
1038646943 8:29369858-29369880 CTCTCTAACATTAGGAGTTTAGG + Intergenic
1041445612 8:57948377-57948399 CTCTCCTGGATTAGGAGTTTAGG - Intergenic
1042109710 8:65367645-65367667 CTCTCCTGAATTAGGAGTTTAGG + Intergenic
1042773719 8:72405883-72405905 CTCTCCTGTATGAGGTGTCTGGG - Intergenic
1042820323 8:72923260-72923282 CTCTCCTGGATAAGGGGGTTTGG + Intronic
1043171550 8:76972636-76972658 CTCTCATGGACAGGGAGTTTAGG + Intergenic
1043655715 8:82662852-82662874 CTCTCCTTGATTAGGAGTTTAGG - Intergenic
1044172493 8:89072177-89072199 CCCTCCTGTATTACGAGTTTAGG - Intergenic
1044426555 8:92058064-92058086 CCCACCTGGATTAGGAGTCAGGG - Intronic
1044955603 8:97476427-97476449 CTCTCCTGGATTAAAAGCTTAGG + Intergenic
1045514321 8:102843673-102843695 CTTTCCTGGTTTATGACTTTCGG - Exonic
1046204300 8:110971391-110971413 CTCTCATGGATTAAGTGATTAGG + Intergenic
1046388743 8:113540134-113540156 CTCCCCAGGATTAGCTGTTTAGG + Intergenic
1046606291 8:116375267-116375289 CTCTCCTGGGTTAGTAGTTTAGG - Intergenic
1047890595 8:129303900-129303922 CTGTCCTGGATTAGGAGTTTAGG - Intergenic
1049466368 8:142752839-142752861 CTCTCCTGGATGAGGGGGGTGGG - Intergenic
1049891589 9:74566-74588 ATTTCCTGGTTTTGGAGTTTGGG - Intergenic
1050295215 9:4197428-4197450 CTCTCCTGGATTAGGAGTTTAGG + Intronic
1050640131 9:7658549-7658571 CTATCCTAAATTAGGACTTTGGG - Intergenic
1050687810 9:8191127-8191149 CTCTCCTGCATTAGGAGCTTAGG + Intergenic
1050863817 9:10471331-10471353 CTCTACTGAATTGGGGGTTTGGG + Intronic
1051920265 9:22256829-22256851 CCCTTCTGGATTAGAAGCTTAGG - Intergenic
1053733018 9:41075660-41075682 ATTTCCTGGTTTTGGAGTTTGGG - Intergenic
1054695405 9:68355899-68355921 ATTTCCTGGTTTTGGAGTTTGGG + Intronic
1055181443 9:73392116-73392138 CCCTCCTGAATTACGAATTTTGG + Intergenic
1055567457 9:77583496-77583518 TTCTCCTTGATTAAGAGGTTGGG + Intronic
1055584633 9:77745247-77745269 GTTTCCTGGGTTAGGAGTCTGGG - Intronic
1055761192 9:79610273-79610295 CTGTGCTGGAAAAGGAGTTTGGG + Intronic
1059984290 9:119806918-119806940 CTTTCCAGGATTAGGAGTGTGGG + Intergenic
1060314769 9:122499309-122499331 CTCTCCTGGATTAAAAGCTTAGG - Intergenic
1062060970 9:134494819-134494841 CTCTCCTGATTTAAGAGTTTGGG - Intergenic
1062177501 9:135172080-135172102 CTCTCCTAGTTTTGGAGTTCAGG + Intergenic
1203687602 Un_GL000214v1:10006-10028 CTCTCCTGTATTCGGAGATAAGG + Intergenic
1203755024 Un_GL000218v1:117752-117774 CTCTCCTGTATTCGGAGATCAGG - Intergenic
1203714405 Un_KI270742v1:130292-130314 CTCTCCTGTATTCGGAGATCAGG - Intergenic
1203536802 Un_KI270743v1:47793-47815 CTCTCCTGTATTCGGAGATCAGG + Intergenic
1203648673 Un_KI270751v1:94047-94069 CTCTCCTGTATTCGGAGATAAGG - Intergenic
1186457017 X:9717641-9717663 CTCGGCTGGATTAGGCGTGTTGG + Exonic
1186562440 X:10626925-10626947 CTTTCCTGGTTTATGAATTTTGG - Intronic
1187475431 X:19606851-19606873 CTCTCTTGGAGTCTGAGTTTGGG - Intronic
1188805992 X:34590557-34590579 CTCTCCTGGATTAGAAATTTAGG - Intergenic
1190321849 X:49184436-49184458 CTCTCCTGGGAAAGGACTTTGGG + Intronic
1190966675 X:55307629-55307651 CTCTCCTGGACTTAGAGCTTAGG - Intergenic
1191087878 X:56588331-56588353 CTCTCCTGGAATAGGAGCTTAGG - Intergenic
1191604107 X:63042906-63042928 CTCTCCTCCCTTTGGAGTTTGGG + Intergenic
1191774107 X:64793624-64793646 CTCTCCTGGATTAGGACTTTAGG + Intergenic
1192762108 X:74104614-74104636 CACTTCTGGATTAAGAATTTCGG + Intergenic
1193026537 X:76851393-76851415 CTCTCTTGGATGAGGAGTTTAGG - Intergenic
1193031895 X:76907504-76907526 TTCTCCTGGATTAGGAGTTTAGG + Intergenic
1193646850 X:84080100-84080122 CTCTCCTGTATGAGGTGTTAGGG - Intronic
1193697794 X:84730231-84730253 ATCTCATGGATTAGGAGTTTAGG - Intergenic
1193774788 X:85628376-85628398 CTCTCTTAAATTAAGAGTTTAGG - Intergenic
1193775379 X:85635158-85635180 CTCTCCTGTATTAGGAGTTTAGG + Intergenic
1194024536 X:88735663-88735685 CTCTCCTGGATTGGGAGCATAGG - Intergenic
1194172265 X:90601854-90601876 CTCTCCTGTATTAGGAGATTAGG + Intergenic
1194260217 X:91685466-91685488 CCCTCCTGGAGTAGGAGTTTAGG + Intergenic
1194333437 X:92614809-92614831 CCGACCTGGATTAGGAATTTAGG - Intronic
1194898052 X:99469534-99469556 TTTTCCTGGATTAAGAGTTTAGG + Intergenic
1194923496 X:99796043-99796065 CTCTCCTGGATTAGGAGTTTAGG - Intergenic
1195734833 X:108001291-108001313 CTCTCTTGGATTAGGAGTTTAGG + Intergenic
1196528038 X:116750392-116750414 ATCTCCCAGATTAGGAGTATAGG - Intergenic
1196613786 X:117743724-117743746 CTCTCCTGGATTAGGAGTTTAGG + Intergenic
1197393999 X:125903512-125903534 CTCTCCTAGATTAGAGGTTTAGG - Intergenic
1197472863 X:126883899-126883921 CTCTCTTTAATTAGGAGTTTAGG + Intergenic
1198968152 X:142249924-142249946 CTCTCCTGGATTAGGAGTTCTGG - Intergenic
1199227425 X:145394199-145394221 CTCTCTTTAATTAGGAGTTTAGG - Intergenic
1199343358 X:146708670-146708692 CTCTCCTGGATTAGGAGTTTAGG - Intergenic
1200578910 Y:4924524-4924546 CCCTCCTGGAGTAGGAGTTTAGG + Intergenic
1200642122 Y:5733815-5733837 CTGACCTGGATTAGGAATTTAGG - Intronic
1201168649 Y:11235361-11235383 CTCTCCTGTATTCGGAGATCAGG - Intergenic
1201313662 Y:12621542-12621564 CTGTCTTGGATTAGGAGTTTAGG + Intergenic
1201677856 Y:16607770-16607792 TTTTCCTGGACTAGGAGTTGGGG + Intergenic