ID: 1196615632

View in Genome Browser
Species Human (GRCh38)
Location X:117764045-117764067
Sequence CTGCTACTTTCTAGGAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196615632_1196615637 0 Left 1196615632 X:117764045-117764067 CCAACCTTCCTAGAAAGTAGCAG No data
Right 1196615637 X:117764068-117764090 ACTATGGAATCAAATTCAGGTGG No data
1196615632_1196615636 -3 Left 1196615632 X:117764045-117764067 CCAACCTTCCTAGAAAGTAGCAG No data
Right 1196615636 X:117764065-117764087 CAGACTATGGAATCAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196615632 Original CRISPR CTGCTACTTTCTAGGAAGGT TGG (reversed) Intergenic
No off target data available for this crispr