ID: 1196616216

View in Genome Browser
Species Human (GRCh38)
Location X:117769421-117769443
Sequence TGCCCACTAGTCCCGCAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196616216_1196616219 1 Left 1196616216 X:117769421-117769443 CCGCCTTGCGGGACTAGTGGGCA No data
Right 1196616219 X:117769445-117769467 CTCCACATGCAGCCCTGGTGCGG No data
1196616216_1196616222 11 Left 1196616216 X:117769421-117769443 CCGCCTTGCGGGACTAGTGGGCA No data
Right 1196616222 X:117769455-117769477 AGCCCTGGTGCGGGATCCGCTGG No data
1196616216_1196616227 26 Left 1196616216 X:117769421-117769443 CCGCCTTGCGGGACTAGTGGGCA No data
Right 1196616227 X:117769470-117769492 TCCGCTGGGTGAAGCCAGCTGGG No data
1196616216_1196616220 2 Left 1196616216 X:117769421-117769443 CCGCCTTGCGGGACTAGTGGGCA No data
Right 1196616220 X:117769446-117769468 TCCACATGCAGCCCTGGTGCGGG No data
1196616216_1196616218 -4 Left 1196616216 X:117769421-117769443 CCGCCTTGCGGGACTAGTGGGCA No data
Right 1196616218 X:117769440-117769462 GGCAGCTCCACATGCAGCCCTGG 0: 2
1: 495
2: 291
3: 228
4: 505
1196616216_1196616226 25 Left 1196616216 X:117769421-117769443 CCGCCTTGCGGGACTAGTGGGCA No data
Right 1196616226 X:117769469-117769491 ATCCGCTGGGTGAAGCCAGCTGG No data
1196616216_1196616223 12 Left 1196616216 X:117769421-117769443 CCGCCTTGCGGGACTAGTGGGCA No data
Right 1196616223 X:117769456-117769478 GCCCTGGTGCGGGATCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196616216 Original CRISPR TGCCCACTAGTCCCGCAAGG CGG (reversed) Intergenic
No off target data available for this crispr