ID: 1196616581

View in Genome Browser
Species Human (GRCh38)
Location X:117773106-117773128
Sequence CTCTATGAAATGAGGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196616576_1196616581 29 Left 1196616576 X:117773054-117773076 CCACAGCCTCAAGGAAAATAGTA No data
Right 1196616581 X:117773106-117773128 CTCTATGAAATGAGGAAGCAAGG No data
1196616577_1196616581 23 Left 1196616577 X:117773060-117773082 CCTCAAGGAAAATAGTATTCTTC No data
Right 1196616581 X:117773106-117773128 CTCTATGAAATGAGGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196616581 Original CRISPR CTCTATGAAATGAGGAAGCA AGG Intergenic
No off target data available for this crispr