ID: 1196619474

View in Genome Browser
Species Human (GRCh38)
Location X:117806286-117806308
Sequence CTCCACCATGCAGCCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196619474_1196619476 -1 Left 1196619474 X:117806286-117806308 CCATCTGTGGCTGCATGGTGGAG No data
Right 1196619476 X:117806308-117806330 GAGAGAGAATCTGCGCACTTGGG No data
1196619474_1196619479 24 Left 1196619474 X:117806286-117806308 CCATCTGTGGCTGCATGGTGGAG No data
Right 1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG No data
1196619474_1196619477 5 Left 1196619474 X:117806286-117806308 CCATCTGTGGCTGCATGGTGGAG No data
Right 1196619477 X:117806314-117806336 GAATCTGCGCACTTGGGAACAGG No data
1196619474_1196619478 23 Left 1196619474 X:117806286-117806308 CCATCTGTGGCTGCATGGTGGAG No data
Right 1196619478 X:117806332-117806354 ACAGGAGAGCACAGTGACTGTGG No data
1196619474_1196619480 30 Left 1196619474 X:117806286-117806308 CCATCTGTGGCTGCATGGTGGAG No data
Right 1196619480 X:117806339-117806361 AGCACAGTGACTGTGGGACTTGG No data
1196619474_1196619475 -2 Left 1196619474 X:117806286-117806308 CCATCTGTGGCTGCATGGTGGAG No data
Right 1196619475 X:117806307-117806329 AGAGAGAGAATCTGCGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196619474 Original CRISPR CTCCACCATGCAGCCACAGA TGG (reversed) Intergenic
No off target data available for this crispr