ID: 1196619479

View in Genome Browser
Species Human (GRCh38)
Location X:117806333-117806355
Sequence CAGGAGAGCACAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196619473_1196619479 25 Left 1196619473 X:117806285-117806307 CCCATCTGTGGCTGCATGGTGGA No data
Right 1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG No data
1196619471_1196619479 26 Left 1196619471 X:117806284-117806306 CCCCATCTGTGGCTGCATGGTGG No data
Right 1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG No data
1196619470_1196619479 27 Left 1196619470 X:117806283-117806305 CCCCCATCTGTGGCTGCATGGTG No data
Right 1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG No data
1196619474_1196619479 24 Left 1196619474 X:117806286-117806308 CCATCTGTGGCTGCATGGTGGAG No data
Right 1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196619479 Original CRISPR CAGGAGAGCACAGTGACTGT GGG Intergenic
No off target data available for this crispr