ID: 1196624259

View in Genome Browser
Species Human (GRCh38)
Location X:117860177-117860199
Sequence CAAGCAACACCCTCTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196624259_1196624262 -2 Left 1196624259 X:117860177-117860199 CCTCTCAGAGAGGGTGTTGCTTG No data
Right 1196624262 X:117860198-117860220 TGAACAGAGGTTTGAGTGAAGGG No data
1196624259_1196624263 8 Left 1196624259 X:117860177-117860199 CCTCTCAGAGAGGGTGTTGCTTG No data
Right 1196624263 X:117860208-117860230 TTTGAGTGAAGGGAAGAGCAAGG No data
1196624259_1196624261 -3 Left 1196624259 X:117860177-117860199 CCTCTCAGAGAGGGTGTTGCTTG No data
Right 1196624261 X:117860197-117860219 TTGAACAGAGGTTTGAGTGAAGG No data
1196624259_1196624264 16 Left 1196624259 X:117860177-117860199 CCTCTCAGAGAGGGTGTTGCTTG No data
Right 1196624264 X:117860216-117860238 AAGGGAAGAGCAAGGCCATCTGG No data
1196624259_1196624265 19 Left 1196624259 X:117860177-117860199 CCTCTCAGAGAGGGTGTTGCTTG No data
Right 1196624265 X:117860219-117860241 GGAAGAGCAAGGCCATCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196624259 Original CRISPR CAAGCAACACCCTCTCTGAG AGG (reversed) Intergenic
No off target data available for this crispr