ID: 1196632647

View in Genome Browser
Species Human (GRCh38)
Location X:117961457-117961479
Sequence GTTAAGATGTGGACATCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1650
Summary {0: 3, 1: 14, 2: 167, 3: 508, 4: 958}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196632647_1196632650 -8 Left 1196632647 X:117961457-117961479 CCTAAAGATGTCCACATCTTAAC 0: 3
1: 14
2: 167
3: 508
4: 958
Right 1196632650 X:117961472-117961494 ATCTTAACCCCAGGAATCTGTGG 0: 1
1: 0
2: 4
3: 43
4: 583
1196632647_1196632654 8 Left 1196632647 X:117961457-117961479 CCTAAAGATGTCCACATCTTAAC 0: 3
1: 14
2: 167
3: 508
4: 958
Right 1196632654 X:117961488-117961510 TCTGTGGATATGTTGTTACATGG 0: 1
1: 1
2: 8
3: 22
4: 213
1196632647_1196632655 14 Left 1196632647 X:117961457-117961479 CCTAAAGATGTCCACATCTTAAC 0: 3
1: 14
2: 167
3: 508
4: 958
Right 1196632655 X:117961494-117961516 GATATGTTGTTACATGGCAAAGG 0: 1
1: 4
2: 5
3: 40
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196632647 Original CRISPR GTTAAGATGTGGACATCTTT AGG (reversed) Intronic
900717913 1:4156982-4157004 ATTAGGATGGGGACATCTTTGGG - Intergenic
900783402 1:4632284-4632306 ATGAGGACGTGGACATCTTTGGG + Intergenic
900872570 1:5314539-5314561 ATTAGGACATGGACATCTTTGGG + Intergenic
900890920 1:5449176-5449198 ATTAGGACGTGGACATCTGTGGG - Intergenic
901130204 1:6957788-6957810 ATTATGACGTGGACATCTTTAGG + Intronic
901389894 1:8938114-8938136 ATTAGGATGTGGACATTTTGGGG - Intergenic
901752014 1:11416117-11416139 AATAAGATGTGGACATCTTTTGG + Intergenic
901825997 1:11861697-11861719 ATTAGAATATGGACATCTTTTGG - Intergenic
902085100 1:13853893-13853915 ATTAGGATGCAGACATCTTTGGG + Intergenic
902180519 1:14684914-14684936 TTTAGGATGGGGACATCTTTGGG + Intronic
902221282 1:14967472-14967494 ATTAGGCTGGGGACATCTTTGGG - Intronic
902934838 1:19757551-19757573 ATTAGGATGTGAACATCTTTGGG + Intronic
903041156 1:20531741-20531763 ATTGAGAAGTGGACATCTTTGGG - Intergenic
903150225 1:21402419-21402441 GTTTAGATTGGGACTTCTTTCGG + Intergenic
903316988 1:22515770-22515792 ATTAGGACATGGACATCTTTGGG + Intronic
903376927 1:22872471-22872493 ATTAAGACGTGAACATCTTTGGG + Intronic
903741048 1:25558827-25558849 ATTAGGATGTGGACATCTTGGGG + Intronic
904147142 1:28402040-28402062 GTTAAATTATGGATATCTTTTGG + Intronic
904312505 1:29638083-29638105 ATTAGCATGTGGATATCTTTGGG + Intergenic
904417272 1:30371011-30371033 ATTAGGAAGTGGACCTCTTTAGG + Intergenic
904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG + Intergenic
905009044 1:34734475-34734497 ATTAAAATGGGAACATCTTTGGG - Intronic
905023343 1:34833140-34833162 TTTAAGACATGGACATCTTGGGG - Intronic
905255497 1:36679572-36679594 ATTAAGATGTGGACACCATTGGG + Intergenic
905336081 1:37245486-37245508 GTTGGGATGTGGCCATCTTCAGG - Intergenic
905470822 1:38190472-38190494 TTTAGGATGTGGACCTCTTCAGG + Intergenic
905526320 1:38642721-38642743 ATTAAGATGTGGGTATCTTTGGG - Intergenic
905855426 1:41308395-41308417 ATTAGGATATGGACATCTTGGGG + Intergenic
906484808 1:46226112-46226134 ATTAGGAATTGGACATCTTTGGG + Intergenic
906646240 1:47477526-47477548 ATGAGGATGTGGACATCTTGAGG + Intergenic
906768874 1:48464731-48464753 GTCAAGATGTGGTTACCTTTGGG + Intronic
906771186 1:48486255-48486277 ATTAGGATGCAGACATCTTTGGG - Intergenic
906935481 1:50210797-50210819 ATTAGAATGTGGACATTTTTAGG - Intergenic
907237018 1:53059318-53059340 ATTAAGGTGTGGATATCTTTGGG + Intergenic
907493886 1:54828861-54828883 CTTAAGATGTGTACATCACTGGG - Intronic
907647645 1:56260204-56260226 ATCAAGATATGAACATCTTTGGG - Intergenic
907674694 1:56507654-56507676 CTTAGGATGCGGGCATCTTTGGG - Intronic
908037942 1:60075838-60075860 ATTAAAAGGTGGACATCTTGAGG - Intergenic
908067315 1:60420994-60421016 ATTAGAATGTGGACATCTTTGGG - Intergenic
908289869 1:62654618-62654640 GTTAGGATGTGGAGAATTTTTGG - Intronic
908649111 1:66312657-66312679 ATTAGGATGCAGACATCTTTAGG + Intronic
908854722 1:68412504-68412526 GTTAGGATGTGAACACCTTTGGG + Intergenic
908979880 1:69942826-69942848 ATTAGGATGTGAACATCTTTGGG + Intronic
909026249 1:70485674-70485696 ATTAGGATATGGACATCTTTGGG - Intergenic
909363749 1:74796116-74796138 ATTAGGACGTGGACATCTTTGGG - Intergenic
909410455 1:75344392-75344414 ATTAGGATGTGAACATCTTTGGG - Intronic
909924396 1:81422151-81422173 GTAAATATGTGGATATTTTTTGG - Intronic
909973786 1:82022017-82022039 ATTAGGACATGGACATCTTTGGG - Intergenic
910144799 1:84067245-84067267 ATTAGGACATGGACATCTTTGGG + Intergenic
910207828 1:84765399-84765421 TTTAGGACATGGACATCTTTGGG + Intergenic
910393445 1:86768155-86768177 GATTAGACATGGACATCTTTGGG + Intergenic
910791903 1:91060237-91060259 ATTAAGGTGTGGATATCTTTGGG - Intergenic
910810967 1:91235920-91235942 ATTAGAATGTGGACATCTTCAGG + Intergenic
910989899 1:93044940-93044962 AATCAGATGTGGAGATCTTTAGG + Intergenic
911217168 1:95207527-95207549 ATTAGGACATGGACATCTTTGGG - Intronic
911742770 1:101405045-101405067 ATTAGGATGTTGACATCTTGGGG + Intergenic
912154157 1:106896793-106896815 GTTAAAATGTGTACTTCTTTAGG - Intergenic
912234012 1:107828837-107828859 GTTAAGATATGGACATCTTAGGG + Intronic
912256271 1:108061709-108061731 ATTAAGATGTGGACATCGTCGGG - Intergenic
912553584 1:110500089-110500111 ATTAGGATCTGGACATCTTTGGG + Intergenic
912819748 1:112857326-112857348 ATTAAAACATGGACATCTTTGGG - Intergenic
912999347 1:114564114-114564136 ATTAAGATCTGGACATCTTTAGG + Intergenic
913387666 1:118277480-118277502 ATTAAGATGTGGACATCTTTAGG + Intergenic
913390637 1:118307716-118307738 ATTAGAATGTGGACATCTTTAGG - Intergenic
913753780 1:122049298-122049320 GTGGAGATTTGGACCTCTTTGGG + Intergenic
913968443 1:143395661-143395683 GTTAGGACGTGGACATCTTTGGG - Intergenic
914062821 1:144221257-144221279 GTTAGGACGTGGACATCTTTGGG - Intergenic
914116329 1:144745097-144745119 GTTAGGACGTGGACATCTTTGGG + Intergenic
914324768 1:146601816-146601838 GTCAGGACCTGGACATCTTTGGG - Intergenic
914349543 1:146828376-146828398 ATTAGGATGTGGACATCTTTCGG + Intergenic
914667898 1:149847295-149847317 ATTAGGATATGGACATATTTGGG + Intronic
915157959 1:153893984-153894006 GTTAGTATGGGGACATTTTTTGG - Intronic
915239032 1:154506754-154506776 ATTAGGATGTGGACCACTTTTGG + Intronic
915393684 1:155565886-155565908 ATTAAGAAGTGGATATCCTTGGG - Intergenic
915743326 1:158136920-158136942 ACTAGGATGTGGACATCTTTGGG - Intergenic
916034808 1:160912395-160912417 ATTAGAATGTGGACATCTTTGGG + Intergenic
916337977 1:163694620-163694642 ATTAGGATGTGGACATATTTGGG - Intergenic
916345945 1:163791667-163791689 ATTAGAATGTGGACATCTCTGGG - Intergenic
916378283 1:164180057-164180079 GTGAGTATGTGAACATCTTTGGG + Intergenic
916475097 1:165161785-165161807 GATAGGATGTGGACATCTTTTGG - Intergenic
916671124 1:167021318-167021340 ATTTAGATGTGTACATTTTTGGG + Intronic
916820030 1:168389238-168389260 ATTAGGATGTGGATGTCTTTGGG - Intergenic
916885717 1:169065781-169065803 GTAAGGATGTAGACATCTTTGGG + Intergenic
916986176 1:170193343-170193365 GTAAACATGTGGACTTATTTGGG + Intergenic
917134713 1:171778474-171778496 ATTAGGAGGTAGACATCTTTAGG + Intergenic
917137324 1:171800189-171800211 ATTAGGACATGGACATCTTTGGG - Intronic
917141343 1:171839012-171839034 ATTAAAATGTGGACATCTTTGGG + Intergenic
917593577 1:176503466-176503488 ATTAGGAAGTAGACATCTTTGGG + Intronic
917976359 1:180241708-180241730 GTTTAGATCTGCAAATCTTTAGG - Intronic
918057286 1:181032991-181033013 ATTAGGTTGTGGACATCTTTGGG + Intergenic
918153793 1:181823475-181823497 GTTAGGACATGGATATCTTTAGG - Intergenic
918489355 1:185064048-185064070 ATTAGGACGTGGACACCTTTGGG + Intronic
918522303 1:185428099-185428121 ATTGGGATGTGGACATCTTGTGG + Intergenic
918555419 1:185793559-185793581 GTTAGGATGTGGACATCTTTGGG + Intronic
918905328 1:190485001-190485023 ATTAGGATGTGGACATTTTGGGG - Intergenic
919126820 1:193404936-193404958 ATTAGGACGTGAACATCTTTGGG - Intergenic
920056782 1:203198608-203198630 TCTAAGACATGGACATCTTTGGG - Intergenic
920521691 1:206632208-206632230 ATTAGGATGCGGACATCTTTGGG + Intergenic
920579295 1:207089913-207089935 GTTTAGAAGTGGACAACTTGTGG + Intronic
920979511 1:210820271-210820293 AAAAGGATGTGGACATCTTTGGG - Intronic
921151548 1:212407012-212407034 ATTAACACTTGGACATCTTTGGG - Intronic
921493420 1:215807004-215807026 ATTAGGATGTGGACATCTTAGGG - Intronic
921971252 1:221151532-221151554 GTTAAGATGTCAATGTCTTTGGG + Intergenic
922038167 1:221870321-221870343 ATAAGGATATGGACATCTTTGGG - Intergenic
922121943 1:222679859-222679881 ATTGGGATGTGGACATCTTTGGG + Intronic
922564917 1:226595535-226595557 ATATGGATGTGGACATCTTTAGG - Intronic
923181252 1:231521963-231521985 ATAAGGATGTGGACATCTTTGGG + Intergenic
923891586 1:238221242-238221264 ATTAGGTTCTGGACATCTTTGGG - Intergenic
924214713 1:241809234-241809256 GATTAGATGTAGACATATTTGGG - Intergenic
924238897 1:242022509-242022531 ATTAGGATGTGAACATCTTTGGG + Intergenic
924644712 1:245866998-245867020 AGCAGGATGTGGACATCTTTGGG - Intronic
924811484 1:247406608-247406630 GTTAGGCTATGGGCATCTTTGGG + Intergenic
1062991741 10:1825694-1825716 ATGAAGATGTGGATATCTTTGGG + Intergenic
1063793159 10:9478402-9478424 ATTAGGATTTGGACATCTTTAGG + Intergenic
1064286771 10:13998418-13998440 GATAAGATGTGGACATTATCAGG - Intronic
1064504467 10:16013962-16013984 ATTAGAAGGTGGACATCTTTTGG + Intergenic
1064512442 10:16110296-16110318 ATTAGGTTGTGGACATCATTGGG - Intergenic
1064561365 10:16598088-16598110 GATCAGATGTGGCCATCTTTGGG - Intronic
1064618254 10:17186237-17186259 ATTAAGATGTGGATATCTTTGGG - Intronic
1064897113 10:20249728-20249750 ATTAGGACATGGACATCTTTGGG + Intronic
1065062000 10:21911690-21911712 ATTAAGTTGGGGACATCTGTAGG - Intronic
1065241646 10:23711204-23711226 ATTAGAATGTGGACATCTTCTGG - Intronic
1065272627 10:24050892-24050914 GTTAAGAAGTGGACATTTGAAGG - Intronic
1065400948 10:25300517-25300539 ATTAGGGTGTGGGCATCTTTGGG + Intronic
1065404383 10:25347466-25347488 ATTAGGATGTGGCCATCTTTGGG + Intronic
1065416017 10:25487097-25487119 ATTAAGAGGTGGATATCTGTGGG + Intronic
1065694992 10:28371497-28371519 ATTAGGATGTGGACATCTTTCGG + Intergenic
1065739165 10:28781416-28781438 ATTAGGATGTGAACACCTTTAGG + Intergenic
1065841526 10:29705284-29705306 ATTAGAATGTGGATATCTTTTGG - Intronic
1065859597 10:29860811-29860833 ATTAGGACGTGGACATCTTTGGG - Intergenic
1066021894 10:31312234-31312256 ATTAGGACGTGGACATCGTTGGG - Intergenic
1066061483 10:31727440-31727462 ATTAGGATGTGAACATCGTTAGG - Intergenic
1066434970 10:35389104-35389126 ATTAGGACGAGGACATCTTTGGG + Intronic
1066589127 10:36973885-36973907 ATTAGAATGTGGACATCTTTTGG - Intergenic
1067132325 10:43575849-43575871 GTTAGGACATGGACATATTTGGG + Intergenic
1067966145 10:50915054-50915076 ATCAGGATGTGGACATCTTCAGG - Intergenic
1068043436 10:51856278-51856300 ATTATGACATGGACATCTTTGGG + Intronic
1068189298 10:53629516-53629538 ATGAGGATGTGAACATCTTTAGG - Intergenic
1068391398 10:56401889-56401911 GTTAAGACTTGAACATCTCTGGG - Intergenic
1068581527 10:58745851-58745873 GTTAGGATGTGGAGATCTTTGGG + Intronic
1068633331 10:59321087-59321109 ATGAAGACATGGACATCTTTGGG - Intronic
1068680155 10:59810763-59810785 ATTAGCATGTGGACATCTTTAGG - Intronic
1068773909 10:60851282-60851304 ATTAGGATGTGGACATTTTGTGG + Intergenic
1069125042 10:64619583-64619605 GTTAGGATGTAGTTATCTTTTGG + Intergenic
1069202871 10:65645012-65645034 ATTAAGATGTGGAAATCTTCAGG - Intergenic
1069510217 10:69036537-69036559 ATTAAGACATGGACATCTTTGGG + Intergenic
1069802685 10:71091879-71091901 ATTAGGATGTGGACATCTTTTGG - Intergenic
1070170649 10:73930247-73930269 ATTAGGATGTGTACATCTTTGGG + Intergenic
1071370745 10:84949046-84949068 TTTAGGATGTAGACATCTTTGGG + Intergenic
1071528907 10:86374385-86374407 ATTAGCATGTGGACATCTGTTGG - Intergenic
1071805597 10:89117063-89117085 ATTAGGATGTAGACATCTTTGGG - Intergenic
1071943965 10:90619632-90619654 GTGAGGACCTGGACATCTTTAGG + Intergenic
1071944249 10:90623712-90623734 GTGAGGATCTGGACATGTTTTGG + Intergenic
1072257328 10:93632323-93632345 ATTAGGATATAGACATCTTTGGG + Intronic
1073681711 10:105712011-105712033 ATTAAGATGTGAACATCTTGAGG - Intergenic
1073715192 10:106098077-106098099 GTTAAGAAATTGATATCTTTAGG + Intergenic
1073738977 10:106384364-106384386 ATTATGATGTGAATATCTTTGGG - Intergenic
1073816105 10:107209196-107209218 GTTAGGATGTGGACACTTTTGGG - Intergenic
1073987031 10:109221389-109221411 ATTGGGATGTGGACATCTTTAGG - Intergenic
1074471041 10:113726921-113726943 GTTAGGGCGTGGACATCTTTGGG + Intronic
1074645002 10:115439585-115439607 GGGAGGATGTAGACATCTTTCGG - Intronic
1074667776 10:115750979-115751001 ACTAGGATGTGCACATCTTTGGG - Intronic
1074726399 10:116314648-116314670 ATTAAGATGCAGATATCTTTGGG - Intergenic
1074845095 10:117390774-117390796 ATTAGGATGTGGACAACTTTGGG - Intergenic
1075301420 10:121327985-121328007 TTTGAGATGTCCACATCTTTTGG + Intergenic
1075421579 10:122305042-122305064 AGTGAGATGTGGACATCTGTGGG - Intronic
1075476646 10:122741093-122741115 ATTAGAATGTGGATATCTTTGGG + Intergenic
1075923418 10:126232076-126232098 ATTAGAATGTGTACATCTTTGGG - Intronic
1075955140 10:126517083-126517105 ATTAAGACATGAACATCTTTGGG + Intronic
1075994023 10:126861966-126861988 ATTTAGATGTGGACATCATTGGG - Intergenic
1076152472 10:128173714-128173736 ATTAGGATGTGGACACATTTTGG - Intergenic
1077629649 11:3802503-3802525 GTTGAGCTGTGGACATCTCTGGG - Intronic
1077697931 11:4412028-4412050 GTTAAATTGTGGAAATCTCTTGG + Intergenic
1077721563 11:4635494-4635516 TTGAAGATGTGGAAATATTTCGG + Intergenic
1078120775 11:8506710-8506732 ATTAGGACGTGGACACCTTTGGG + Intronic
1078230349 11:9435885-9435907 GCTAAGATGTTGACATTTCTAGG - Intronic
1078360174 11:10661846-10661868 GTTAGGATGTAGACATCTTGGGG + Intronic
1078388615 11:10915298-10915320 ATTGGGATGTGCACATCTTTGGG + Intergenic
1078451207 11:11442413-11442435 ATTAGGATGTGGACCTCTTTGGG + Intronic
1078451505 11:11443995-11444017 ATTAGGATGTGGACATCTTTGGG + Intronic
1078457738 11:11488528-11488550 ATTAGGATGTGGACCTCTTTGGG + Intronic
1078485643 11:11720900-11720922 ATTAGGATGTGCACATCTTTGGG + Intergenic
1078508838 11:11970500-11970522 AATAGGATGTGAACATCTTTGGG - Intronic
1078815169 11:14813668-14813690 TTTAGGATATGGACATCTTTGGG + Intronic
1078837063 11:15041058-15041080 ATTAGGACATGGACATCTTTGGG + Intronic
1078859305 11:15232588-15232610 ATTAGGATGTGGACATCCCTGGG - Intronic
1078921403 11:15834323-15834345 ATTAGGATGTGAATATCTTTGGG - Intergenic
1079147857 11:17869793-17869815 ATTAGGACATGGACATCTTTAGG - Intronic
1079345163 11:19645446-19645468 ATTCAGACGTGAACATCTTTGGG + Intronic
1079386970 11:19989114-19989136 ATTAGAATGTGGCCATCTTTGGG - Intronic
1079684507 11:23340920-23340942 GTTAGGAAGTGGATATCTTTGGG - Intergenic
1079701355 11:23552607-23552629 ATTAAGGTATGGACATTTTTGGG + Intergenic
1079901180 11:26187238-26187260 TTTAAGAATGGGACATCTTTGGG - Intergenic
1079986549 11:27206222-27206244 GTTAGAACATGGACATCTTTGGG - Intergenic
1080050093 11:27850902-27850924 ATCAGGATGTGGACATCTTTGGG + Intergenic
1080156199 11:29114179-29114201 ATAAGGATGTGAACATCTTTGGG + Intergenic
1080269321 11:30434197-30434219 ATTAGGATGTGGACATCTTTAGG + Intronic
1080592026 11:33732799-33732821 GTTAGGATACGGACATTTTTGGG - Intronic
1081001197 11:37674653-37674675 ATTTGGATGTAGACATCTTTGGG + Intergenic
1081017125 11:37896347-37896369 ATAAGGATATGGACATCTTTGGG - Intergenic
1081101578 11:39008409-39008431 CATAGGATGTGGACATCTTTAGG - Intergenic
1081346056 11:41987904-41987926 ATTAGGATGTGGATATCTTTGGG - Intergenic
1081350503 11:42046077-42046099 ATTAGGACGTTGACATCTTTGGG - Intergenic
1081384071 11:42450005-42450027 ATTCAGATGTGGATATCTTTGGG - Intergenic
1081417841 11:42837036-42837058 ATTATGACATGGACATCTTTGGG - Intergenic
1081500559 11:43662502-43662524 TTTGAGATGTGGCCAACTTTGGG - Intronic
1081772414 11:45658300-45658322 GTTAAGCTGTGGGCATCCATCGG - Intronic
1081844814 11:46232735-46232757 ATTAGGATATGGACATTTTTGGG - Intergenic
1082163966 11:48920643-48920665 GTGAATATTTGGACTTCTTTGGG - Intergenic
1082274137 11:50203089-50203111 ATTAGGATTTGGGCATCTTTAGG + Intergenic
1082735616 11:56852503-56852525 ATTAAGATGTGGAAGGCTTTAGG - Intergenic
1082751950 11:57028936-57028958 ATTAGGATGCAGACATCTTTGGG + Intergenic
1082909987 11:58360851-58360873 GTTAAGATATGACCACCTTTGGG + Intergenic
1082984948 11:59160523-59160545 ATTATGGTGTGAACATCTTTGGG - Intergenic
1082993172 11:59226433-59226455 GTTAGAATGTAGACATCTTTGGG + Intergenic
1083484282 11:62973689-62973711 ATTAGGATGTGGGCATATTTGGG + Intronic
1084081987 11:66833442-66833464 GTTAGGATTTGGACATATTTGGG + Intronic
1084643521 11:70440454-70440476 ATTAGGATCTAGACATCTTTGGG - Intergenic
1085273172 11:75282296-75282318 ATTAGGGTGTGGACATCTTTGGG - Intronic
1085275438 11:75295663-75295685 ATTATGATGTAGACATCTTTGGG + Intronic
1085401485 11:76238550-76238572 GGCAAGATATGGCCATCTTTGGG + Intergenic
1085407884 11:76274766-76274788 ATCAGGCTGTGGACATCTTTCGG - Intergenic
1085570966 11:77557723-77557745 GTTAAGATGCTGCCATCTTGTGG + Intronic
1085898948 11:80674048-80674070 ATTAGGTTGTGGACATCTTTTGG + Intergenic
1085916657 11:80897324-80897346 ATTAAAATGTGGAAAACTTTGGG - Intergenic
1085985843 11:81786870-81786892 ATTAGGATGTGGACATCTTTAGG + Intergenic
1086191996 11:84090813-84090835 TTAAATATATGGACATCTTTTGG - Intronic
1086514570 11:87596855-87596877 ATGAAGATGTAGACATATTTTGG - Intergenic
1086676232 11:89610264-89610286 ATTAGGGTGTGAACATCTTTGGG + Intergenic
1086787757 11:90992660-90992682 ATTAAGGTGTGGACATCTCTGGG + Intergenic
1086885427 11:92200147-92200169 ATTAGGATGCAGACATCTTTGGG - Intergenic
1087021893 11:93611354-93611376 ATTAGGACATGGACATCTTTGGG + Intergenic
1087110336 11:94459873-94459895 TTTAAGACGTGGACATCTTTAGG - Intronic
1087332950 11:96805813-96805835 ATTAGAATGTGGACATCTTTGGG + Intergenic
1087358251 11:97122621-97122643 GTTATGGCATGGACATCTTTGGG + Intergenic
1087586496 11:100128413-100128435 ATTAGGATATGGACCTCTTTGGG - Intronic
1087822973 11:102732033-102732055 GTCAGGATGTGGGCATTTTTGGG + Intergenic
1088035674 11:105311124-105311146 GTTAACATGTGAAAATATTTTGG - Intergenic
1088266950 11:107996991-107997013 ATTAGGATGTGGTCATCTTTAGG - Intergenic
1088340390 11:108758871-108758893 ATTAGCATGTGGACATTTTTTGG + Intronic
1088572543 11:111237050-111237072 GTTAGGATTTGGACATCTTTGGG + Intergenic
1088766072 11:112980085-112980107 CTAATGATGTTGACATCTTTTGG - Intronic
1088947090 11:114525320-114525342 ATTAGGATGTGGATATCTTTGGG - Intronic
1089216824 11:116839229-116839251 ATGAGGCTGTGGACATCTTTGGG - Intergenic
1089754537 11:120676841-120676863 TTTAGGATGTGGGCATCTTTGGG + Intronic
1090229699 11:125092679-125092701 ATTAGGATGTGGACATCTTATGG - Intergenic
1090230374 11:125098635-125098657 ATTAGGATGTGGATATCTTTGGG - Intronic
1090467850 11:126951108-126951130 GTTAGGATGTGGATATCTTTTGG + Intronic
1090891036 11:130922641-130922663 GTCCAGATGTGAACATATTTTGG + Intergenic
1091049582 11:132355322-132355344 ATTAGGATGTGGAGATCTTTAGG + Intergenic
1091323720 11:134668975-134668997 GTGAAGATGAGGACATATTGCGG - Intergenic
1091868802 12:3869257-3869279 ATTAATATGTGGATATCTTTAGG + Intronic
1091900051 12:4137300-4137322 GATAAGATGTAAACATCTTGGGG - Intergenic
1092293157 12:7177184-7177206 AGTACGACGTGGACATCTTTGGG - Intergenic
1092581107 12:9842981-9843003 ATTAGAATGTGGACATCTTTGGG - Intronic
1092654487 12:10670949-10670971 ATTAGGACATGGACATCTTTGGG - Intronic
1092655355 12:10678124-10678146 ATTAGGGTGTGGACATATTTGGG + Intergenic
1093127453 12:15348041-15348063 GTTAGGGTATGGTCATCTTTTGG - Intronic
1093168002 12:15828094-15828116 ATTAGGACATGGACATCTTTGGG - Intronic
1093414690 12:18906813-18906835 GTTAGGATTTTAACATCTTTTGG + Intergenic
1093483358 12:19627696-19627718 ATTAAGAAGTGGACATCGTCTGG + Intronic
1093485822 12:19651297-19651319 ATTAAGCTATGGACATATTTGGG - Intronic
1093518507 12:20019914-20019936 ATTAGAATGTGGACATCTTTAGG + Intergenic
1093636316 12:21473981-21474003 ATTAGGACGTGAACATCTTTGGG + Intronic
1094115546 12:26908243-26908265 GTCAATATGAGGAAATCTTTTGG + Intronic
1094394662 12:29992692-29992714 ATTAAGGTGTTGACATCTGTTGG + Intergenic
1094659738 12:32457368-32457390 CTTAAGATCATGACATCTTTAGG - Intronic
1094718686 12:33038982-33039004 ATTAAGATATAGACACCTTTGGG + Intergenic
1095044828 12:37490410-37490432 ATGACGATATGGACATCTTTGGG + Intergenic
1095301740 12:40592384-40592406 TTTAGGATATGAACATCTTTGGG - Intergenic
1095302832 12:40606805-40606827 TTTAGGACGTGCACATCTTTGGG - Intergenic
1095673090 12:44883550-44883572 ATTAGGTTGTAGACATCTTTGGG + Intronic
1095948983 12:47771438-47771460 ATGAGGACGTGGACATCTTTGGG - Intronic
1096055826 12:48651124-48651146 ATTAGGATGTGGACATCTTTGGG + Intergenic
1096356741 12:50947667-50947689 ATTAGGATGTGGACATTTCTGGG + Intergenic
1096524324 12:52201540-52201562 ATTAGGATGTGGACAGCTTTGGG - Intergenic
1096572092 12:52529346-52529368 ATTAAGATGGGGTCTTCTTTGGG - Intergenic
1096641489 12:52998211-52998233 ATTTAGATTTGGAGATCTTTGGG - Intergenic
1096883236 12:54689958-54689980 ATTAGGATGTGGACATCTTTTGG - Intergenic
1097144711 12:56932074-56932096 ATGAGGATGGGGACATCTTTGGG - Intronic
1097354120 12:58582564-58582586 ATTAAGATGTGAACATCTTTAGG - Intronic
1097387783 12:58970332-58970354 GTTAAAATGGGGACTCCTTTGGG + Intergenic
1097677551 12:62619357-62619379 GTTAGGACGTGAACATCATTAGG - Intergenic
1097927209 12:65142226-65142248 ATTAGGATGTGGACATATTTGGG - Intergenic
1098209820 12:68151812-68151834 ACTAGGATGTGGACATCTTTGGG - Intergenic
1098295879 12:69003792-69003814 GTTAAGATGAGGTCATATTGGGG + Intergenic
1098431001 12:70420238-70420260 ATTATGGTGTGGACATCTTTGGG - Intronic
1098445948 12:70565753-70565775 GTTAGGACATGGACATCTTTGGG - Intronic
1098603866 12:72366205-72366227 ATTAAGATGTAGCTATCTTTGGG + Intronic
1098936068 12:76480817-76480839 ATTAGGGTGTGGACATCTTTGGG - Intronic
1098958642 12:76714756-76714778 ATTAAGATGTAGACATCTTTAGG + Intergenic
1098976480 12:76907601-76907623 ATTAGGATGTGGACATCTTTGGG - Intergenic
1099084011 12:78222331-78222353 GTTAAGAAGTGGACATTTATTGG - Intergenic
1099714613 12:86275467-86275489 ATTAAGACATGGACATCTTCGGG - Intronic
1099833287 12:87873367-87873389 ATTAAGTTGTGGACATTTTGGGG + Intergenic
1099841776 12:87975546-87975568 ATCAGGATGTGGACATCTTTGGG - Intergenic
1099863477 12:88248861-88248883 ATTAGTATGTGGACATCTTTTGG - Intergenic
1099864617 12:88264096-88264118 ATTAGGATGTGGACATATTTGGG - Intergenic
1099880072 12:88457012-88457034 ATTAAGCTATGGACATCTCTGGG + Intergenic
1099887657 12:88551752-88551774 ATTAGGACATGGACATCTTTGGG - Intronic
1100397493 12:94197682-94197704 ATTAGGACCTGGACATCTTTGGG + Intronic
1100777856 12:97991929-97991951 ATTAAGACATGGACATCTTTGGG + Intergenic
1101004253 12:100386173-100386195 GATTTGATGTGGATATCTTTTGG + Intronic
1101229427 12:102724866-102724888 ATTGGGATGTGGACATCATTGGG - Intergenic
1101258876 12:103008844-103008866 GTTAGAGTGTGTACATCTTTGGG + Intergenic
1101841611 12:108331547-108331569 ATTAGGATGTGGACATCTTTGGG - Intronic
1102351865 12:112198564-112198586 GTGCAGATGGGGACATATTTTGG + Intronic
1102386785 12:112516705-112516727 ATGAGGATGAGGACATCTTTGGG + Intergenic
1102391193 12:112550120-112550142 ATTAGGATGTGGATATCTTGTGG + Intergenic
1102399130 12:112613444-112613466 ATTAGGACATGGACATCTTTGGG - Intronic
1102418744 12:112787257-112787279 ATGAAAATGTGGACATCTTTTGG + Intronic
1102447752 12:113016647-113016669 ATTAGGATATGGACATCTTTGGG - Intergenic
1102495480 12:113316304-113316326 GTTAGGATATGGATGTCTTTAGG + Intronic
1102591922 12:113962814-113962836 ATTAGGATGTGGGCATCTTTTGG - Intronic
1102762788 12:115403475-115403497 ATTAGGATGTGGACATAGTTGGG + Intergenic
1102770494 12:115471902-115471924 ATTAGGATGTGGAAGTCTTTGGG - Intergenic
1102924390 12:116815739-116815761 ATTGGGATATGGACATCTTTGGG + Intronic
1103157848 12:118702161-118702183 ATTAGGATGTGGAAATCTTTGGG - Intergenic
1103166086 12:118771918-118771940 TTTGACATGGGGACATCTTTTGG - Intergenic
1103833022 12:123795711-123795733 ATTAGGACGTGGACATCTTTGGG + Intronic
1103875828 12:124126404-124126426 ATTAGGATGTGGATATCTGTGGG + Intronic
1103901474 12:124305803-124305825 GTTAGGGTGTGGACAGCTTTGGG + Intronic
1103981590 12:124740294-124740316 ATTAGGACATGGACATCTTTGGG + Intergenic
1104043355 12:125144916-125144938 ATTAGGATGTGGATATCTTTGGG + Intergenic
1104111633 12:125710152-125710174 ATTAGGATGTGGACATCTTTTGG - Intergenic
1104135348 12:125932478-125932500 ATTAGGATGTAGACATCTTTGGG - Intergenic
1104170339 12:126274498-126274520 ATTAGGATGCGAACATCTTTTGG + Intergenic
1104228508 12:126860589-126860611 ATTGAGATGTGTACATCTTTGGG - Intergenic
1104289090 12:127452134-127452156 ATTAGAATGTGGACATCTTTGGG + Intergenic
1104299607 12:127552334-127552356 ACTAACATGTGGACATATTTAGG + Intergenic
1104368284 12:128197984-128198006 ATTAGGACATGGACATCTTTGGG - Intergenic
1104452969 12:128886398-128886420 AGTAGGATGTGGACATCTCTGGG - Intronic
1104453045 12:128886767-128886789 ATTAGGATGTGGACATCTCTGGG + Intronic
1104460149 12:128948729-128948751 GTTAAGATCTGCAAACCTTTGGG + Intronic
1104468474 12:129008861-129008883 ATTAAGATGTGGACATCTCCGGG + Intergenic
1104595504 12:130117609-130117631 ATTAGGATGTGGACATCCTTTGG - Intergenic
1104597959 12:130132831-130132853 ATGAGGGTGTGGACATCTTTGGG - Intergenic
1104920739 12:132289451-132289473 ATTAGGGTGTGGACAGCTTTGGG - Intronic
1105513574 13:21071766-21071788 ATTAAGGCATGGACATCTTTGGG - Intergenic
1105731824 13:23225169-23225191 GTTAGGATGTGGACATCCTTGGG - Intronic
1106001382 13:25726742-25726764 ATTAGGGTGTGGACATCTTTGGG + Intronic
1106131178 13:26940811-26940833 ATTCAGGTGTGGACATCTTTGGG - Intergenic
1106155779 13:27154691-27154713 ATTAGGATGTGGACATTTTGAGG - Intronic
1106270951 13:28152971-28152993 TTTAAGATGTCCACATCCTTTGG + Intronic
1106454694 13:29916921-29916943 ATGAGGATGTGGACATCTTTGGG - Intergenic
1106473346 13:30077195-30077217 GTTAGGATGGGGACATCTTTGGG + Intergenic
1107032358 13:35866309-35866331 GTTAAGATCTGCACAATTTTCGG - Intronic
1107102234 13:36606168-36606190 ATTAGGATGTGGACTTCTTCAGG + Intergenic
1107135526 13:36939871-36939893 GTTTTGGTGTGGATATCTTTGGG + Intergenic
1107357332 13:39582082-39582104 GTTGAGTTCTGGACAGCTTTTGG - Intronic
1107418396 13:40222507-40222529 ATTAGGACTTGGACATCTTTGGG + Intergenic
1107614486 13:42150792-42150814 ATTAGGATGTGAACATCTTTGGG - Intronic
1107691814 13:42961004-42961026 GATAAAACGTGGACATCTTGGGG + Intronic
1107879533 13:44821055-44821077 ATCAGGATGTGGATATCTTTTGG - Intergenic
1108036620 13:46296824-46296846 ATTAGGATGTAGATATCTTTGGG + Intergenic
1108047384 13:46396074-46396096 ATTAAAATGTGGACATCTTTGGG - Intronic
1108391326 13:49950805-49950827 TTTAAGATGTGGAGATCTTTGGG - Intergenic
1109147438 13:58797921-58797943 ATTAAGAAGGGGATATCTTTGGG - Intergenic
1109245017 13:59943654-59943676 GTGAAGATGTGAAGATCTATTGG + Intronic
1109251020 13:60021118-60021140 TTTAAGATGTGCAGATCTTTTGG - Intronic
1109379900 13:61545458-61545480 ATTAGGATGTGCATATCTTTGGG + Intergenic
1109815431 13:67576022-67576044 ATTAAGATGTGGACATCTTTGGG + Intergenic
1110305909 13:73986542-73986564 ATTAGGACATGGACATCTTTAGG - Intronic
1110441962 13:75536389-75536411 ATTAGCATGTGGACATATTTGGG - Intronic
1110450242 13:75632626-75632648 GTTAAGAAGTGCACAGCCTTGGG - Intronic
1110457307 13:75703982-75704004 ATAATGATGTGGACATCTTATGG + Intronic
1110574483 13:77040017-77040039 GCTAAGACGTGGACAGATTTGGG + Intergenic
1110614546 13:77526892-77526914 ATTAGGATATGAACATCTTTGGG - Intergenic
1110655794 13:77997209-77997231 ATTAGGATATGGGCATCTTTTGG + Intergenic
1110849176 13:80224334-80224356 ATTAAGATGTGGCTATATTTTGG + Intergenic
1111768603 13:92567413-92567435 ATTAGAATATGGACATCTTTGGG - Intronic
1112191778 13:97185389-97185411 ATTGGGATGTGGACATCTTTGGG - Intergenic
1112257844 13:97851064-97851086 ATTAGGATGTGGACATCTTTGGG - Intergenic
1112407161 13:99131269-99131291 ATTAGGATGTGGACATTGTTGGG - Intergenic
1112463381 13:99622280-99622302 ATAAGGACGTGGACATCTTTGGG + Intronic
1112569677 13:100582403-100582425 ATTAGGATGTAAACATCTTTGGG - Intronic
1112586474 13:100723042-100723064 ATTAGAATGCGGACATCTTTGGG - Intergenic
1112647304 13:101349366-101349388 GTTAGAATGGGGACATCTTTAGG - Intronic
1112958295 13:105088797-105088819 GTTAGGATGTAGACATCTTGAGG + Intergenic
1112987433 13:105468276-105468298 ATTAAGAACTGGACATTTTTGGG + Intronic
1113252442 13:108469088-108469110 CTGAAGATGTGGACATGGTTTGG - Intergenic
1113753979 13:112796279-112796301 ATCAGGATGTGGACATCTGTGGG - Intronic
1114446068 14:22789253-22789275 ATTAGGGGGTGGACATCTTTGGG - Intronic
1114713056 14:24797685-24797707 ATTAGGATGTGGACACTTTTGGG + Intergenic
1114833113 14:26169246-26169268 GTGAAGATATGGTAATCTTTGGG - Intergenic
1114835550 14:26199156-26199178 ATTAAGATATGGATATCTTTGGG - Intergenic
1114899414 14:27038010-27038032 ATTAGGATGTGGATATCTTTTGG + Intergenic
1115341217 14:32294841-32294863 ATTAGGATGAGGACATCTGTGGG + Intergenic
1115957900 14:38801880-38801902 CTTAATATGTGCACATCTGTTGG - Intergenic
1116062490 14:39941487-39941509 ATTAGGACATGGACATCTTTGGG + Intergenic
1116089421 14:40285901-40285923 GTTAAGAGGTGTTCAACTTTGGG + Intergenic
1116278369 14:42867881-42867903 GTTAAGATTTGGTGATCTGTTGG + Intergenic
1116655895 14:47653571-47653593 ATTAGGATGTGAACTTCTTTTGG - Intronic
1116802283 14:49455327-49455349 AATAGAATGTGGACATCTTTGGG - Intergenic
1117192253 14:53304666-53304688 TTTAGGACGTGGGCATCTTTGGG + Intergenic
1117662557 14:58022421-58022443 ATTAAGAGGTAGACATCTTTTGG + Intronic
1117814123 14:59579931-59579953 ATTAGGATGTGGACATTTTGAGG - Intergenic
1117838834 14:59836225-59836247 GATTAGACGTGGACACCTTTGGG + Intronic
1117858060 14:60056196-60056218 ATTAGGATGTAGATATCTTTAGG + Intronic
1118042317 14:61930596-61930618 ATTAGGATGTGAACATCTTGAGG - Intergenic
1118098873 14:62572190-62572212 GTTAAGCTGAGCACTTCTTTGGG + Intergenic
1118150405 14:63182972-63182994 ATTAGCATGTGGCCATCTTTGGG + Intergenic
1118157021 14:63252291-63252313 ACTAGGATGTGGGCATCTTTGGG + Intronic
1118377896 14:65192720-65192742 ATTAAGATGTGGACATCTTGGGG - Intergenic
1118728404 14:68649034-68649056 ATGAAGAGGTGGAGATCTTTTGG + Intronic
1118919189 14:70134258-70134280 GTTAAAATGAAGACATCTCTGGG - Intronic
1119206160 14:72795110-72795132 ATTAGGACATGGACATCTTTGGG + Intronic
1120090286 14:80324124-80324146 GTGAGGATGTGGACATTTTTGGG - Intronic
1120125398 14:80736043-80736065 GTTAGGTTGTGGACATCTTTTGG + Intronic
1120185980 14:81394455-81394477 ATCAAGATGTGGACATCTTGGGG - Intronic
1120234309 14:81873528-81873550 ATTAGGATATGGACATCTTTGGG + Intergenic
1120261606 14:82192024-82192046 AATAGGATGTTGACATCTTTTGG - Intergenic
1120321781 14:82971499-82971521 GTTAATATATGGAGATATTTAGG - Intergenic
1120414301 14:84199970-84199992 ATTAAGAGGTAGATATCTTTGGG + Intergenic
1120827528 14:88969181-88969203 ATTAGGACATGGACATCTTTGGG - Intergenic
1120836498 14:89042509-89042531 ATTAGGATGTGGACATCTTTGGG - Intergenic
1120858752 14:89235552-89235574 ATCAGGATGTGGACATCCTTTGG - Intronic
1120978905 14:90274040-90274062 CTTAGGGTGTGGCCATCTTTAGG + Exonic
1121077571 14:91082081-91082103 ATTAGGATGTGGACATCTTTTGG + Intronic
1121251717 14:92504732-92504754 ATTAGGATGTGGACATTTCTGGG - Intergenic
1121284038 14:92720715-92720737 ATTAGGATGTGGACATCCTTTGG - Intronic
1121373438 14:93382366-93382388 ATTCAGACCTGGACATCTTTGGG - Intronic
1121454693 14:94030660-94030682 ATTAGGACGTGGACATCATTGGG - Intronic
1121472951 14:94170459-94170481 ATTAGGATGTGGACGTCTTTGGG + Intronic
1121571195 14:94947766-94947788 ATTAGGACATGGACATCTTTGGG - Intergenic
1121612366 14:95290285-95290307 ATTGGGATCTGGACATCTTTGGG - Intronic
1121875778 14:97450294-97450316 GTAAAGATGTTAACATTTTTTGG + Intergenic
1121928467 14:97949844-97949866 GTTATGATTTGGACATCACTGGG - Intronic
1122034294 14:98936258-98936280 ACTAGGATGTGGACATTTTTGGG - Intergenic
1122349907 14:101083095-101083117 ATTAGGACGTGCACATCTTTGGG - Intergenic
1122349926 14:101083181-101083203 ATTAGGACATGGACATCTTTGGG - Intergenic
1122448691 14:101785712-101785734 ATTAGGATGTGGACATCTTTAGG + Intronic
1122866809 14:104609654-104609676 ATTGGGATGTGGACATCTTTGGG + Intergenic
1123690268 15:22832871-22832893 GTGAGGACGTGGATATCTTTGGG + Intergenic
1123759120 15:23419216-23419238 ATTAGGATGTGGACCTCTTTGGG - Intergenic
1123922067 15:25077214-25077236 CTTAGGATGTGGTCCTCTTTGGG + Intergenic
1123999603 15:25743985-25744007 AGTAAGATGTGGGCATCTTTCGG + Intronic
1124425573 15:29559858-29559880 ATTAGGATGTGGACTTCTCTGGG + Intronic
1124884861 15:33675984-33676006 ATTGGGATGTGAACATCTTTGGG - Intronic
1125356344 15:38820572-38820594 ATGAAGACATGGACATCTTTGGG + Intergenic
1125391739 15:39199913-39199935 ATTAGGATGTGGATATGTTTGGG + Intergenic
1125425294 15:39542741-39542763 ATTAGGATATAGACATCTTTGGG + Intergenic
1126277793 15:46904423-46904445 ATTAAGATATGGACATCTTTGGG + Intergenic
1126290081 15:47065629-47065651 ATGAGGATGTGGACATCTTTGGG - Intergenic
1126309775 15:47302451-47302473 ATTAAGATGTGGACATATTTTGG - Intronic
1126466955 15:48969557-48969579 ATTAGGGTATGGACATCTTTGGG - Intergenic
1126522983 15:49618148-49618170 GTAAGGATATAGACATCTTTGGG + Intronic
1126785318 15:52173914-52173936 ATTAGGATGTGGATACCTTTGGG - Intronic
1126869168 15:52969337-52969359 ATTAGGATGTGGACATCTTTAGG - Intergenic
1127057806 15:55150427-55150449 ATTAGGATATGAACATCTTTGGG - Intergenic
1127451767 15:59123645-59123667 CTTAAGCTGTGGAAAGCTTTAGG + Intronic
1127485456 15:59413933-59413955 ATTAGAATGTGGACGTCTTTGGG - Intronic
1127849667 15:62901701-62901723 GTAAAGTTGTGGAGCTCTTTGGG - Intergenic
1127989942 15:64106506-64106528 ATTAAGATGTGGACTTCTTTGGG - Intronic
1128091638 15:64923106-64923128 ATTAGGATATGGACATCTTTGGG - Intronic
1128480181 15:68030725-68030747 ATTAGGACATGGACATCTTTGGG - Intergenic
1128645211 15:69373312-69373334 ATTAGGATGTGAACATTTTTGGG + Intronic
1128790285 15:70428178-70428200 ATTAGGATGTGGATATCCTTGGG - Intergenic
1128934298 15:71732212-71732234 ATTAGGATGTGGACATCTTTAGG + Intronic
1129043796 15:72714679-72714701 GTTAAGATATTGACAAATTTAGG + Intronic
1129202909 15:74015917-74015939 GTTTAGACATGGACAGCTTTAGG + Intronic
1129914217 15:79254172-79254194 ATTAGGATGTGGACATCTTTGGG - Intergenic
1130012736 15:80164488-80164510 ATTAGGATCTGGATATCTTTTGG + Intronic
1130067586 15:80617435-80617457 ATTAGGATGTGGACGTCTTTGGG + Intergenic
1130195836 15:81779569-81779591 ATTAGGATGTAGACCTCTTTGGG + Intergenic
1130202538 15:81845545-81845567 GTTAGAATGTGGACACCTTTGGG - Intergenic
1130320537 15:82837324-82837346 ATTAGGATGTGGACATCTTTGGG + Intronic
1130923766 15:88369971-88369993 ATTAGGATGTGAACATCTTTGGG - Intergenic
1130959710 15:88651723-88651745 ACTAGGGTGTGGACATCTTTGGG + Intronic
1130962833 15:88674991-88675013 GATTTGATGTGGATATCTTTTGG + Intergenic
1131963394 15:97811804-97811826 ATTCAAGTGTGGACATCTTTAGG + Intergenic
1131997450 15:98145937-98145959 ATTAGGAGGTGGACATCTTTTGG - Intergenic
1132018538 15:98339967-98339989 ATTAGGATGTGGACATCTTTGGG + Intergenic
1132018553 15:98340109-98340131 ATTAGGATGTGGACATCCTTGGG + Intergenic
1132071046 15:98776801-98776823 TTTAAGATGTGGTTCTCTTTTGG - Intronic
1132181929 15:99761698-99761720 ATTAGAATATGGACATCTTTGGG + Intergenic
1132247997 15:100312086-100312108 ATTAGGATGTGGACATCCTTGGG - Intronic
1133092133 16:3412851-3412873 ATTAGGATGTGGACACATTTGGG + Intronic
1133723255 16:8514624-8514646 ACTAAGATATGGATATCTTTGGG + Intergenic
1133788750 16:8993009-8993031 ATTAGGGTGTGGACATGTTTGGG - Intergenic
1133832158 16:9333214-9333236 ATTAAGATGTGGATGTCTTTGGG + Intergenic
1133901059 16:9975229-9975251 TTAAAGGTGTGGACATCTTTGGG - Intronic
1134150562 16:11801444-11801466 GTCAGCATGTGGACATCTTTGGG + Intergenic
1134284234 16:12846258-12846280 ATTAGGACGTGAACATCTTTGGG + Intergenic
1134319848 16:13152788-13152810 ATTAGGATGTGCACCTCTTTGGG - Intronic
1134401954 16:13918432-13918454 ATTAGGATATGAACATCTTTGGG + Intergenic
1134448157 16:14346261-14346283 ATTAGGATGTGTGCATCTTTGGG - Intergenic
1134457229 16:14403652-14403674 ATTAGGATGTGGACCTCTTTGGG + Intergenic
1134905813 16:17978573-17978595 ATTAGGATGTGGACGTCTTTGGG - Intergenic
1135141575 16:19926577-19926599 ATTAGGATGTAGACATCTTTGGG + Intergenic
1135353070 16:21746340-21746362 GTTCAGACATGGACATCTTTCGG - Intronic
1135405832 16:22197120-22197142 GTTCAAGTGTGGGCATCTTTAGG - Intergenic
1135451556 16:22562463-22562485 GTTCAGACATGGACATCTTTGGG - Intergenic
1136054045 16:27674726-27674748 GCTAGGATATGGACATCTTTGGG + Intronic
1136054259 16:27676482-27676504 ATTAGGATGTGGACATCTTTGGG + Intronic
1136288691 16:29258952-29258974 ATTAGGATGTGGGCATCTTTGGG + Intergenic
1137583256 16:49647390-49647412 GTTAAGACTTGGACATCTTTGGG - Intronic
1137952355 16:52795795-52795817 ATTAGGATGTGGATATCTCTGGG - Intergenic
1138717059 16:59035703-59035725 ATTAGGATATAGACATCTTTGGG + Intergenic
1138818512 16:60230086-60230108 ATTAAGATGTGTATATCTTGGGG + Intergenic
1138823067 16:60285265-60285287 ATTAGGATGTAGACATCTTTGGG - Intergenic
1139021585 16:62756412-62756434 ATTAGGATGTGGATGTCTTTGGG + Intergenic
1139038124 16:62972577-62972599 GTTAAGTTGTGGAAATCTCAAGG - Intergenic
1139287321 16:65827201-65827223 TTTAAGACGTGGACATCTTTGGG + Intergenic
1139711798 16:68781839-68781861 GTTAAGATATGGGCACCTGTGGG - Intronic
1139984494 16:70887178-70887200 ATTAGGATGTGGACATCTTTCGG - Intronic
1140008795 16:71109130-71109152 GTCAGGACCTGGACATCTTTGGG + Intronic
1140587014 16:76304827-76304849 ATTAAGATATGGACATCCTCGGG - Intronic
1140657078 16:77151922-77151944 ATTAGGAGGTAGACATCTTTGGG - Intergenic
1140735607 16:77895319-77895341 ATTAGGATGTGGACATCTTTAGG - Intronic
1140793020 16:78410392-78410414 GTTAGGATGTGGACTTCTTTGGG + Intronic
1140934186 16:79655589-79655611 CAAAGGATGTGGACATCTTTGGG - Intergenic
1140959967 16:79902368-79902390 ATTAGGATGTGGACATCTTTGGG + Intergenic
1141018751 16:80475063-80475085 ATTAAGATGGGAACATCTTTGGG + Intergenic
1141235626 16:82213346-82213368 ATTAGGATGTGGACAACTTTGGG - Intergenic
1141260916 16:82453239-82453261 ATTAGGATGTGGACATTTTGGGG - Intergenic
1141263370 16:82473953-82473975 ATTCATATGTGAACATCTTTAGG + Intergenic
1141396366 16:83708600-83708622 ACTAGGATGTGGACAGCTTTGGG - Intronic
1141416256 16:83877671-83877693 ATTCAGATGTAGACATCGTTAGG + Intergenic
1141463022 16:84189127-84189149 ATTAGGCTGTAGACATCTTTGGG + Intergenic
1141476061 16:84274286-84274308 ATAAGGATGGGGACATCTTTGGG + Intergenic
1141487359 16:84349657-84349679 ATTAGGACATGGACATCTTTTGG - Intergenic
1141597491 16:85106330-85106352 ATTAGGATGCAGACATCTTTGGG - Intronic
1141646270 16:85369700-85369722 GATTAGATGTGGACGTCTTTTGG + Intergenic
1141726392 16:85791931-85791953 ATTAGGATGTGGACATATTTGGG + Intronic
1141862784 16:86729377-86729399 ATTAGGATGTGGACATCGTTTGG + Intergenic
1141910396 16:87054619-87054641 TTTAGGATGTGGACATCTCTTGG - Intergenic
1141978694 16:87535719-87535741 GTTAAGATATGGACATCTTTGGG + Intergenic
1142094412 16:88231857-88231879 ATTAGGATGTGGGCATCTTTGGG + Intergenic
1142833396 17:2566129-2566151 GTTGGGACATGGACATCTTTGGG - Intergenic
1143269223 17:5663557-5663579 GTGAGGATGTGGACATCTTTGGG - Intergenic
1143674392 17:8421267-8421289 ATTAGGATGTGAACATTTTTGGG - Intronic
1144005567 17:11096164-11096186 ATTAGGATGGGGACATCTTTGGG - Intergenic
1144047776 17:11469139-11469161 ATTAGGAAGTGGACATCTTTGGG - Intronic
1144089375 17:11840562-11840584 ATTAGGATGTGGAACTCTTTGGG - Intronic
1144749040 17:17635484-17635506 ATTAGGATATGAACATCTTTTGG - Intergenic
1144993517 17:19250468-19250490 GTTAAGATGTGGTTATCTTTGGG + Intronic
1145112593 17:20176894-20176916 ATTAGGATGTGGACATATTTGGG + Intronic
1145689539 17:26724035-26724057 ATTAAGATGTGAAGATATTTGGG + Intergenic
1145876351 17:28321022-28321044 ATTAGGATGTGGTTATCTTTGGG + Intronic
1146433486 17:32821783-32821805 ATTAGGTTGTGGACATCCTTTGG + Intronic
1146466265 17:33089109-33089131 GTGGGGATGTGGACACCTTTGGG - Intronic
1146631181 17:34470660-34470682 GTTAAGCTGTGGAATTCTTGAGG - Intergenic
1146959934 17:36965533-36965555 TTTAGGATGTAGATATCTTTGGG + Intronic
1147583813 17:41641202-41641224 ATTCAGATATGGACATATTTGGG - Intergenic
1148666125 17:49376294-49376316 ATTAGGATATGGACATCCTTGGG - Intronic
1149039202 17:52167564-52167586 ATTAGGATGTTAACATCTTTAGG + Intergenic
1149456103 17:56789776-56789798 ATTAGGACCTGGACATCTTTGGG - Intergenic
1150050075 17:61953322-61953344 ATTAGGATGTGGACATCTTTGGG - Intronic
1150170897 17:62993227-62993249 GTTAGAATGTGGTCACCTTTGGG + Intergenic
1150248452 17:63692863-63692885 ATTAGGCAGTGGACATCTTTGGG - Intronic
1150612500 17:66745114-66745136 ATAAGGATGTGGACATCTGTTGG + Intronic
1150655235 17:67034844-67034866 ATTAGGATGTGGACATCTCAGGG - Intergenic
1151120440 17:71787068-71787090 GGGAAGATGTGGTCCTCTTTTGG + Intergenic
1151285005 17:73104514-73104536 ATTAGGACATGGACATCTTTAGG - Intergenic
1151411638 17:73934296-73934318 GTGAGGATGTGGATGTCTTTGGG + Intergenic
1151874772 17:76861284-76861306 ATTAAGAGGTGGACATCTTTGGG + Intergenic
1152066304 17:78114451-78114473 CTTAGGACGGGGACATCTTTGGG + Intronic
1152323673 17:79623352-79623374 GTTAGGACGTGGACATTTTGGGG - Intergenic
1152943956 17:83188709-83188731 AGTGAGATGTGGACATCTTTGGG - Intergenic
1153939691 18:9967528-9967550 GTTAGGATGTGAACATGTTCCGG + Intergenic
1153940502 18:9972722-9972744 ATTAGGGTGTGGATATCTTTGGG - Intergenic
1155102923 18:22630966-22630988 ATTAGGATGTGGACATCTTGGGG + Intergenic
1155254125 18:23979769-23979791 GTTAGGATGTGGACATCTTTGGG - Intergenic
1155359980 18:24990205-24990227 ATAAAGATGTGAACATCTTTGGG + Intergenic
1155364841 18:25039518-25039540 ATTAGGACGTGGACACCTTTGGG + Intergenic
1155549459 18:26949666-26949688 ATTAGGATGTGGACATGTTGGGG - Intronic
1155561285 18:27080024-27080046 GTTAGATTGTGGATATCTTTGGG + Intronic
1155575277 18:27238869-27238891 ATTAGGATGTGGACATCCTGGGG + Intergenic
1155831906 18:30526500-30526522 ATTAGGACATGGACATCTTTAGG + Intergenic
1156014693 18:32534326-32534348 ATTAGGGTGTGGACATCTTTGGG + Intergenic
1156153905 18:34279098-34279120 ATTAAAATGTGGACATTCTTGGG - Intergenic
1156307038 18:35886864-35886886 ATTAGAATGTGGACATCTTTGGG + Intergenic
1156310436 18:35917510-35917532 ATTCATATGTGGACATTTTTGGG + Intergenic
1156417492 18:36912546-36912568 ATTAGGATGTGGACATCTGTGGG + Intronic
1156929535 18:42625213-42625235 ATGAGGATATGGACATCTTTGGG - Intergenic
1157245233 18:46047986-46048008 ACCAGGATGTGGACATCTTTAGG - Intronic
1157245933 18:46055298-46055320 ATTAGGATTTGGACATCTTTGGG - Intronic
1157433841 18:47652244-47652266 GTTAAGACTTCAACATCTTTTGG + Intergenic
1157502153 18:48198808-48198830 ATTAGGATGTGGACATCTTTGGG + Intronic
1157973708 18:52300541-52300563 GTTTTGATGGGGACATCTGTGGG - Intergenic
1158301141 18:56054751-56054773 ATTAAAATGTGGATATCTTTTGG - Intergenic
1158808180 18:61000123-61000145 ATCAGGATGTGGACATCTTCAGG + Intergenic
1158870794 18:61685731-61685753 ATTAACATGTGGATATCTTGGGG + Intergenic
1158984189 18:62797206-62797228 TTTAAGATGTGAACATCTTTCGG - Intronic
1159421373 18:68225062-68225084 ATTAGGATGTGGACCTCTTTGGG - Intergenic
1159434206 18:68394962-68394984 GTTAAGATGCTGACATCCTTGGG + Intergenic
1159491958 18:69148173-69148195 ATTAGGATGTAGACATCTTTGGG + Intergenic
1159591532 18:70340317-70340339 ATTAAGATGTGGATATGTTTGGG + Intronic
1159638705 18:70837881-70837903 ATTAAGATGTGGACATTGTTGGG + Intergenic
1159711931 18:71771564-71771586 CTTAAGATGTGGTTATCATTTGG + Intronic
1159942252 18:74417291-74417313 ATGAAGATGTGGGCATCTTTGGG - Intergenic
1159972718 18:74673582-74673604 ACTGTGATGTGGACATCTTTGGG + Intronic
1160015963 18:75141000-75141022 ACTAAGATGTGGACATCTTTGGG - Intergenic
1160053684 18:75459985-75460007 ACTAGGATGTGGACATCTTTGGG - Intergenic
1160269261 18:77369165-77369187 TTTAGGATGTGGACATCTTTGGG + Intergenic
1160286060 18:77544590-77544612 ATTATGATGTGGACATCTTTTGG + Intergenic
1160336010 18:78040236-78040258 ATTAGGATGTGGACATATTTAGG + Intergenic
1161066786 19:2242565-2242587 ATTAGGATGTGGACATCTTTTGG + Intronic
1161567961 19:5013801-5013823 GTTAGGATGGGGACATCTTTGGG + Intronic
1161569527 19:5022967-5022989 ATTAAGATGTGGACATCCATGGG - Intronic
1161649492 19:5475613-5475635 ATTAGGATGTGGACATCTTTGGG - Intergenic
1161655429 19:5511478-5511500 ATTAGGATGTGGACATCTTTGGG + Intergenic
1161692239 19:5742925-5742947 ATTAGGATGTGGACACCTTTGGG - Intronic
1161761973 19:6180252-6180274 GTTAGAACGTGGACATCTTTAGG + Intronic
1161836348 19:6649764-6649786 AGTAGGATGTGGACATCTTGAGG - Intergenic
1161914335 19:7217435-7217457 ATTACGATGTGGGCATCTCTGGG + Intronic
1161995625 19:7709668-7709690 ATTAGAATGTGGACATCTTTGGG + Intergenic
1165036166 19:33035447-33035469 CTTAAGATGTAGACCTCTTTAGG + Intronic
1165579447 19:36849839-36849861 GTCAAGATGTGTGCAGCTTTGGG - Intronic
1165661572 19:37585235-37585257 ATTAGGTTGTGGACATGTTTGGG - Intronic
1166031708 19:40136089-40136111 GTTAGGATGTGAACATCTTTGGG - Intergenic
1166189316 19:41165262-41165284 ATTAGGGTGTGGACATCTTCGGG - Intergenic
1166264803 19:41673034-41673056 ATTAGGATGTGGACATTTTTAGG - Intronic
1166273331 19:41732624-41732646 ATTAGGATGTGGACATTTTTAGG + Intronic
1166278397 19:41772448-41772470 ATTAGGATGTGGACATTTTTAGG + Intergenic
1166425905 19:42677406-42677428 GTCAGGATGTGGACATTTTTAGG + Intronic
1166530294 19:43538685-43538707 ATTCAAATGTGGATATCTTTGGG - Intergenic
1166530592 19:43540903-43540925 GCTGGGATGTGAACATCTTTGGG - Intergenic
1166625591 19:44351327-44351349 ATTAGGATATGGACATCTTTAGG + Intronic
1166820577 19:45576901-45576923 ATAAGGATGTGGACATCTTTGGG + Intronic
1166932851 19:46311958-46311980 ATTAGGATGTGGACATCTTTGGG + Intronic
1166986748 19:46664871-46664893 ATAAAGATGTAGACATCTTAGGG - Intergenic
1167016025 19:46841697-46841719 ATTAGGATGTGGATGTCTTTGGG - Intronic
1167085485 19:47306962-47306984 ATTAAGATGTGGACATCATTGGG - Intronic
1167090894 19:47342966-47342988 ATTAAGATGTGGACATCACCGGG - Exonic
1167554554 19:50185982-50186004 ATTAGGATGCAGACATCTTTGGG + Intergenic
1167610428 19:50505297-50505319 GCCAGGGTGTGGACATCTTTGGG + Intergenic
1167758434 19:51427709-51427731 ATTAGCAAGTGGACATCTTTGGG - Intergenic
1168225800 19:54994087-54994109 GTTGGGACTTGGACATCTTTAGG + Intronic
1168660504 19:58162122-58162144 ATGAGGATGTGGACATCTTTTGG + Intergenic
1202702231 1_KI270712v1_random:173129-173151 GTTAGGACGTGGACATCTTTGGG - Intergenic
925515921 2:4681665-4681687 GTTAGGAGGGGGACATCTTGGGG + Intergenic
925643045 2:6005726-6005748 GTTAAGATGAGGTCATGCTTGGG - Intergenic
925871287 2:8273118-8273140 ATTAAGGTGTGTACATTTTTAGG - Intergenic
925920071 2:8632330-8632352 CTTAGGATGTGGCCATCTCTGGG + Intergenic
926124764 2:10265305-10265327 ATTAGGACGCGGACATCTTTGGG + Intergenic
926273137 2:11382772-11382794 ATCTGGATGTGGACATCTTTGGG + Intergenic
926339682 2:11894772-11894794 ATGAGGATGTGGGCATCTTTGGG + Intergenic
926448197 2:12970293-12970315 ATTAGGATGTGAACATCTTTGGG - Intergenic
926463081 2:13157813-13157835 ATAAAGATGTGGACATCTTTGGG + Intergenic
926543804 2:14213112-14213134 ATTAGGATGTAGATATCTTTAGG - Intergenic
926591038 2:14740632-14740654 ATTAGGACATGGACATCTTTAGG - Intergenic
926665040 2:15512435-15512457 ATTAGGATGTGGACATCTTTTGG - Intronic
927042459 2:19243451-19243473 ATTAGGGTGTGGATATCTTTGGG - Intergenic
927059417 2:19401476-19401498 ATTAGGATGTGATCATCTTTGGG + Intergenic
927231993 2:20833467-20833489 ATTAGGACATGGACATCTTTGGG - Intergenic
927479622 2:23441947-23441969 ATTAGGACATGGACATCTTTGGG - Intronic
928100269 2:28432966-28432988 ATTAGGATGTGTACATATTTGGG - Intergenic
928350807 2:30552020-30552042 ATTAAGATGTGGACATCTTTTGG + Intronic
928395136 2:30937810-30937832 ATTAGGGTGTGGACATCTTTGGG + Intronic
928416453 2:31096299-31096321 ATTAGGATGTGCACAACTTTGGG + Intronic
928700695 2:33895822-33895844 ATTAGTATCTGGACATCTTTGGG - Intergenic
929037734 2:37710955-37710977 TTTAGGATGCGAACATCTTTGGG - Intronic
929055031 2:37869258-37869280 ATTGGGACGTGGACATCTTTGGG + Intergenic
929338756 2:40786044-40786066 ATTAGAATGTGGATATCTTTGGG - Intergenic
929366294 2:41160366-41160388 GAGAGGATGTGGGCATCTTTAGG + Intergenic
929571565 2:43026350-43026372 ATTAGGATGTGGACATCTTCAGG + Intergenic
929605160 2:43228703-43228725 GATAACATGTGGACATGTTACGG + Intergenic
929719338 2:44351460-44351482 GTTCAGATTCGGACATTTTTTGG - Intronic
929783294 2:44971703-44971725 GGTTAGATGAGGGCATCTTTGGG - Intergenic
930185678 2:48410321-48410343 TTTAAGATGTGGGAATCCTTGGG - Intergenic
930231935 2:48852008-48852030 GTTAAGATGTAGACATTTTGGGG + Intergenic
930419428 2:51132471-51132493 GTTAATATGTCGACACTTTTAGG + Intergenic
930571030 2:53087674-53087696 ATTAGGATATGGATATCTTTGGG - Intergenic
930726001 2:54681920-54681942 ATTAGGATGTGGACATCTTTGGG + Intergenic
930800334 2:55437296-55437318 ATTAGGAGGTGTACATCTTTGGG - Intergenic
930968177 2:57358297-57358319 ATTAGGATATGGATATCTTTGGG - Intergenic
931191920 2:60009953-60009975 ATTAAGATGTGGGCATCTTGGGG - Intergenic
931466007 2:62487479-62487501 ATTAGGATGTAGACATCTCTAGG + Intergenic
931782285 2:65589040-65589062 GTTAGGGTTTGGGCATCTTTGGG + Intergenic
932129581 2:69175709-69175731 GTGAATATGTGGACATCTATAGG + Intronic
932253660 2:70266084-70266106 ATTAAGACATGGACATCTTGTGG - Intronic
932269294 2:70395441-70395463 ATTAGCATGTGGACATATTTAGG + Intergenic
932512762 2:72311673-72311695 ATTAAGATGTTGACACCTTGTGG + Intronic
932558672 2:72848174-72848196 ATTAGGATGTGGACATCTTTTGG + Intergenic
932751997 2:74377110-74377132 CTTTAGATGTTGGCATCTTTGGG + Intronic
932872159 2:75412803-75412825 CTTAGGATGTGAACATCATTGGG + Intergenic
932879152 2:75484118-75484140 GTTAGGATGTGGACAGATGTCGG + Intronic
932938265 2:76132037-76132059 ATTAGGATGGGGACATCTTTAGG + Intergenic
933266719 2:80188852-80188874 ATTAGGATGTGGATATCTTTGGG + Intronic
933527110 2:83455750-83455772 ATTAAGACATGGACATCTTTGGG - Intergenic
933840080 2:86279497-86279519 ATTAGGACATGGACATCTTTGGG - Intronic
933856103 2:86416010-86416032 ATTAGGATATAGACATCTTTAGG + Intergenic
934066221 2:88344580-88344602 ATTAGGATGTGAACATCTTTTGG - Intergenic
934173145 2:89556576-89556598 GTTAGGACGTGGACATCTTTGGG - Intergenic
934283461 2:91630933-91630955 GTTAGGACGTGGACATCTTTGGG - Intergenic
934719360 2:96562596-96562618 ATTAGGATGTGGACATCTTTAGG - Intergenic
934843962 2:97649757-97649779 TTTATGACGCGGACATCTTTGGG - Intergenic
935109245 2:100076872-100076894 ATTAGGAGGTGGGCATCTTTGGG - Intronic
935141568 2:100357742-100357764 ATTAGGGTGTGGACATCTTTGGG + Intergenic
935261662 2:101361282-101361304 ATTCGGATGTGGACATCTTTGGG - Intronic
935270104 2:101427185-101427207 ATTAGGACGTGGACATTTTTGGG - Intronic
935403052 2:102680675-102680697 ATTAGGATGTGGACATCTTTGGG - Intronic
935621850 2:105136808-105136830 ATTAGGTTGTGGACATCTTTGGG + Intergenic
935725900 2:106023817-106023839 ATTAGGATGTGGACATCTTTGGG + Intergenic
935786089 2:106550080-106550102 GTTAGGATGTGAACATCTTTGGG + Intergenic
935897748 2:107755901-107755923 ATTAAGATGTGAATATCTTTTGG + Intergenic
935946542 2:108291439-108291461 ATTAGGACGTGGACATCTTTAGG + Intronic
936091456 2:109504227-109504249 GCTAAGATGTGTACATCATGGGG - Intronic
936428554 2:112438546-112438568 ATTAGGATCTGGACATATTTGGG + Intergenic
936502275 2:113075449-113075471 ATTAGGATGTGGACATATTTCGG - Exonic
936924357 2:117721570-117721592 TTTAGGAGGTGGATATCTTTGGG - Intergenic
937008491 2:118540279-118540301 GTTAAGACAAGGACATATTTTGG + Intergenic
937157475 2:119731260-119731282 ATTAGAAAGTGGACATCTTTAGG - Intergenic
937500237 2:122470531-122470553 ATTAGGGTGTGAACATCTTTGGG + Intergenic
937565293 2:123278424-123278446 GTTATGAAGTGTACATTTTTAGG + Intergenic
937600117 2:123721399-123721421 GTTAGGATGTCGACATCTTTGGG + Intergenic
937927638 2:127179456-127179478 ACTAGGATGTGGGCATCTTTGGG + Intergenic
938121640 2:128638258-128638280 ACTAGGATGTGGATATCTTTGGG - Intergenic
938681831 2:133699964-133699986 ACTAGGAAGTGGACATCTTTGGG + Intergenic
938710709 2:133974070-133974092 ATTAGGATATGGACATCCTTGGG + Intergenic
938790764 2:134673469-134673491 ATTAGGTTGTGAACATCTTTGGG - Intronic
939042099 2:137202234-137202256 GATTTGATGTGGATATCTTTTGG - Intronic
939073263 2:137568908-137568930 ATTAGGATGTGGACATCTTTGGG - Intronic
939121844 2:138126707-138126729 ATTAGGGTATGGACATCTTTGGG - Intergenic
939374358 2:141344872-141344894 ACTAAGATGTGGGCATCTTGAGG - Intronic
940068395 2:149655338-149655360 ATTAGGATATGAACATCTTTAGG - Intergenic
940180122 2:150922811-150922833 ATTAGGATGTAGACATCTTTGGG - Intergenic
940208818 2:151235455-151235477 GTTAGGATGTGGACATCTTTGGG - Intergenic
940274270 2:151922561-151922583 ATTAGTATGTGGACATCTTTGGG + Intronic
940909560 2:159198297-159198319 ATTGGGATGTAGACATCTTTGGG + Intronic
941050842 2:160731908-160731930 ATTAGGGTGTGAACATCTTTAGG + Intergenic
941063844 2:160878575-160878597 ATTAGCATGTGGACATCTTTTGG + Intergenic
941122755 2:161550121-161550143 CCAAAGATGTGAACATCTTTAGG + Intronic
941356889 2:164504723-164504745 ATGAGGATGTGGACATCTTTGGG - Intronic
941360461 2:164545269-164545291 ATTAAGATGTGGTTATCTTTCGG - Intronic
941573701 2:167203183-167203205 ATTAGGATGTGAACATCTTTGGG + Intronic
941704530 2:168643905-168643927 TTTAAGATGTGGATATCTTTGGG + Intronic
941811257 2:169757932-169757954 ATCAAGATGTAGACATCTTTAGG + Intronic
941985867 2:171511185-171511207 ATTAGGAAGTGGCCATCTTTGGG - Intergenic
942076203 2:172359174-172359196 GGCAGGATGTGGACATCGTTGGG - Intergenic
942413966 2:175739002-175739024 ATTAGGATGTGGACATCCTTGGG - Intergenic
943120728 2:183731960-183731982 ATTAGGATGTGAACATCTTTTGG + Intergenic
943179136 2:184521147-184521169 ATTAGGAAATGGACATCTTTGGG - Intergenic
943187733 2:184634338-184634360 ATTAATATGTGGACATCTGAGGG - Intronic
943280353 2:185924263-185924285 GTTAGAAGGTGAACATCTTTGGG + Intergenic
943375879 2:187076145-187076167 ATTAAGACATGGACATCTCTGGG - Intergenic
943388572 2:187232718-187232740 ATTAGGATGTGGACATCTTCAGG + Intergenic
943426330 2:187740003-187740025 ATTAGAATGTGGACATTTTTAGG + Intergenic
943779802 2:191810577-191810599 ATAAGGACGTGGACATCTTTGGG + Intergenic
943851052 2:192723491-192723513 ATTAAGGTGTGTACATTTTTAGG - Intergenic
944157508 2:196622720-196622742 ATTAGGATATGGATATCTTTGGG + Intergenic
944248419 2:197556855-197556877 ATTAGGATGTGGACATTTTAGGG + Intergenic
944314318 2:198269022-198269044 GTTAAAATGTGGACATCTTTAGG - Intronic
944372604 2:199002767-199002789 ATTAGGATATGGACATCTTCGGG + Intergenic
944382441 2:199127195-199127217 ATTAGGATGTGAACATCTTGGGG - Intergenic
944482563 2:200172665-200172687 ATTAGGAAGTGGACATCTTTGGG + Intergenic
944618175 2:201483844-201483866 CTTAGGATGTAGGCATCTTTGGG + Intergenic
944630879 2:201622772-201622794 ATTAGGACATGGACATCTTTAGG + Exonic
945121614 2:206463121-206463143 ATTAGGATGTGGACATCTTTAGG - Intronic
945396625 2:209326275-209326297 GTTAATATAAGGACATCTTCTGG - Intergenic
945810924 2:214549291-214549313 ATTAGGATGTGGGCATCCTTAGG + Intronic
945824706 2:214707361-214707383 GTACAGATGTAGACAACTTTTGG + Intergenic
946033110 2:216720742-216720764 ATTAGGACATGGACATCTTTGGG + Intergenic
946055022 2:216893499-216893521 ATTAAGCTGTGGACATCTTTGGG - Intergenic
946447678 2:219753734-219753756 ATTAGGTGGTGGACATCTTTGGG + Intergenic
946502566 2:220265370-220265392 GTCAGGACATGGACATCTTTAGG - Intergenic
946566531 2:220971795-220971817 ATTGGGATGTGGACATCTTTGGG - Intergenic
946698788 2:222388808-222388830 ACTAGGATGTGGACATCTTAGGG - Intergenic
946911215 2:224463360-224463382 ATTAAGATATAGACATCTTGGGG - Intergenic
947000844 2:225454507-225454529 AATTGGATGTGGACATCTTTGGG - Intronic
947337415 2:229101821-229101843 AATAGGATATGGACATCTTTTGG - Intronic
947425937 2:229982871-229982893 ATTAGGACATGGACATCTTTGGG + Intronic
947435688 2:230069991-230070013 ATTAGGATGTGGACATCTTTGGG + Intergenic
947504956 2:230701039-230701061 ATTAGGATGTGGACATCTTGGGG + Intergenic
947954815 2:234179522-234179544 ATTAGGATGTGGACATCCTTTGG + Intergenic
947982579 2:234423175-234423197 ATTAGGACATGGACATCTTTTGG - Intergenic
948026549 2:234782593-234782615 ATTAGGATGTGGACATCTTTGGG - Intergenic
948115207 2:235490355-235490377 ATTAGGATGTGGGCATCTTAGGG + Intergenic
948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG + Intronic
948254523 2:236556324-236556346 CTCAAGATGTGGACCTCTCTGGG - Intergenic
948743577 2:240067570-240067592 ATTAAAATGTGGACATCATTAGG - Intergenic
1169314062 20:4573404-4573426 ATTAGGATGTGCACATCTTTGGG + Intergenic
1169409579 20:5356227-5356249 ATTAGGATGTAGACATCTTTGGG - Intergenic
1169780173 20:9301248-9301270 GTTAGGAGGTGGGTATCTTTTGG + Intronic
1169844480 20:9974786-9974808 ATTAAGATGTGGCTATCTTTGGG + Intergenic
1169882701 20:10364873-10364895 GTTCAGATGGGGCCACCTTTGGG + Intergenic
1170037921 20:12009573-12009595 ATTAAGGTGTGGATATCTTTTGG + Intergenic
1170402374 20:16002306-16002328 ATTAGGATGAGGACACCTTTGGG - Intronic
1170517655 20:17148636-17148658 ATTAAGGCATGGACATCTTTGGG + Intergenic
1170750988 20:19144855-19144877 ATTAGGTTGTGAACATCTTTAGG - Intergenic
1171060051 20:21947736-21947758 TTGAAGATTTGTACATCTTTAGG + Intergenic
1171395372 20:24829588-24829610 ATTAGGAGGTGGACATCTTTGGG - Intergenic
1171539371 20:25934034-25934056 ATGAGGATGTGGACATCTTTGGG + Intergenic
1171801666 20:29626250-29626272 ATGAGGATGTGGACATCTTTGGG - Intergenic
1171842300 20:30229246-30229268 ATGAGGATGTGGACATCTTTGGG + Intergenic
1172641948 20:36445770-36445792 CCAAAGATGTGGACATCTTGGGG - Intronic
1172933746 20:38604057-38604079 ATTAGGATGTGGACATCTTGGGG + Intronic
1173052303 20:39575303-39575325 TATAAGACATGGACATCTTTGGG - Intergenic
1173127759 20:40355732-40355754 ATTAGGATGTGGACATCTTTGGG - Intergenic
1173281956 20:41636582-41636604 ATTAAGATATGAACATCTTTGGG - Intergenic
1173376389 20:42487424-42487446 ATTAGGATGTGAACCTCTTTGGG - Intronic
1173409539 20:42797595-42797617 ATTAGGATATGGACATCTTTGGG - Intronic
1173565373 20:44034801-44034823 ATTAGGATGTAGACATCTTTTGG - Intronic
1173783985 20:45779171-45779193 GTTTGGATGTGGCCTTCTTTGGG - Intronic
1173888191 20:46480254-46480276 GTTAGGATGTGGACATGTTTGGG + Intergenic
1173968416 20:47131481-47131503 ACTAGGATGTGGACGTCTTTGGG - Intronic
1174089259 20:48034015-48034037 ATTAGGATGTGAACAGCTTTGGG + Intergenic
1175039619 20:56035897-56035919 ATTAGGATGTGAACATCTTTAGG + Intergenic
1175102432 20:56588947-56588969 ATTTGGATGTGGACAGCTTTTGG + Intergenic
1175231158 20:57474249-57474271 ATTAGGACATGGACATCTTTGGG - Intergenic
1175478731 20:59296325-59296347 ATTAGGACATGGACATCTTTGGG + Intergenic
1175496007 20:59414717-59414739 TTTAAGACATGGACATCTTTGGG + Intergenic
1175667627 20:60873602-60873624 ATTAGGACATGGACATCTTTAGG + Intergenic
1175690938 20:61065619-61065641 ATCAGGATGTGGACATCTTTGGG + Intergenic
1175691530 20:61068922-61068944 ATCAGGATGCGGACATCTTTGGG + Intergenic
1175717376 20:61264096-61264118 ATTAGGATGGGGACATCTCTGGG + Intronic
1176720607 21:10389784-10389806 ATTAGGATGTGGACATTTTTGGG - Intergenic
1176720623 21:10389885-10389907 ATTAGGATATGGACATCTCTGGG - Intergenic
1176720632 21:10389934-10389956 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720641 21:10389982-10390004 ATTAGGACATGGACATCTTTGGG - Intergenic
1176720648 21:10390030-10390052 ATTAGGATGTGAAGATCTTTGGG - Intergenic
1176720664 21:10390127-10390149 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720679 21:10390224-10390246 ATTAGGACGTGGACATCTTTGGG - Intergenic
1176720686 21:10390273-10390295 ATTAGGATGTGTACATCTTTGGG - Intergenic
1176720695 21:10390322-10390344 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720704 21:10390371-10390393 ATTAGGATGTGTACATCTTTGGG - Intergenic
1176720713 21:10390420-10390442 ATTAGGACGTGGACATCTTTGGG - Intergenic
1176720722 21:10390469-10390491 ATTAGTATGTGGACATCTTTGGG - Intergenic
1176720738 21:10390567-10390589 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720764 21:10390713-10390735 ATTAGGATGTAGACATCCTTGGG - Intergenic
1177036754 21:16054210-16054232 ATTAAGACATGGACATCTTTGGG - Intergenic
1177141532 21:17363021-17363043 ATTAGGATGTGGACATCTTTGGG - Intergenic
1177237601 21:18413093-18413115 GTTTAGATGTGGTCATGTGTAGG + Intronic
1177420729 21:20853288-20853310 ATTCTGATGTGGGCATCTTTGGG + Intergenic
1177582914 21:23050951-23050973 ATTAAGAGATGGACATCTTTGGG - Intergenic
1178182538 21:30179429-30179451 ATTAAGATGTGAACATCTTTGGG - Intergenic
1178183001 21:30186118-30186140 ATTCGGATGTGGACATCATTGGG - Intergenic
1178517185 21:33257932-33257954 ATTAGGATGTAGACATCTTTGGG - Intronic
1178533305 21:33392875-33392897 GTTAGGTTGTGGACATCTCTGGG - Intergenic
1178738802 21:35177269-35177291 ATTAGGGTGTGGACATCTTGGGG + Intronic
1178795880 21:35743904-35743926 ATGAGGACGTGGACATCTTTGGG - Intronic
1178863392 21:36307878-36307900 ATTAGGATGTGGCTATCTTTGGG + Intergenic
1179038556 21:37781918-37781940 ATTGGGATGTGGACGTCTTTGGG - Intronic
1179041020 21:37802290-37802312 GTTAGGAAGTGGACATCTTTGGG - Intronic
1179167091 21:38943829-38943851 ATTAGGACGTGGACATCTTTGGG - Intergenic
1179252972 21:39688889-39688911 GTGAAGATTTGGACATTTTAGGG + Intergenic
1180007426 21:45029318-45029340 GTTACGGTGTGGACATCTTGAGG + Intergenic
1180152315 21:45956342-45956364 TTTAGGATTTGCACATCTTTTGG - Intergenic
1180301781 22:11042477-11042499 ATTAAGACATGGATATCTTTGGG - Intergenic
1180301808 22:11042627-11042649 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301824 22:11042728-11042750 ATTAGGATATGGACATCTCTGGG - Intergenic
1180301833 22:11042777-11042799 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301842 22:11042825-11042847 ATTAGGACATGGACATCTTTGGG - Intergenic
1180301849 22:11042873-11042895 ATTAGGATGTGAAGATCTTTGGG - Intergenic
1180301863 22:11042970-11042992 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301878 22:11043067-11043089 ATTAGGATGTGTACATCTTTGGG - Intergenic
1180301887 22:11043116-11043138 ATTAGGACGTGGACATCTTTGGG - Intergenic
1180301896 22:11043165-11043187 ATTAGGATGTGTACATCTTTGGG - Intergenic
1180301905 22:11043214-11043236 ATTAGGACGTGGACATCTTTGGG - Intergenic
1180301914 22:11043263-11043285 ATTAGTATGTGGACATCTTTGGG - Intergenic
1180301930 22:11043361-11043383 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301947 22:11043459-11043481 ATTAGGACATGGACATCTTTGGG - Intergenic
1180301956 22:11043507-11043529 ATTAGGATGTAGACATCCTTGGG - Intergenic
1180606450 22:17062420-17062442 ATTAGGATGTGAACATCTTTGGG + Intergenic
1181883720 22:26002055-26002077 GTTAGAATGTGAACATCTTTGGG + Intronic
1181916255 22:26282883-26282905 TTTAAAATGTGTAAATCTTTTGG + Intronic
1182517286 22:30866112-30866134 ATTAGGACATGGACATCTTTGGG - Intronic
1182883329 22:33752788-33752810 ATTAGGATGTGGACATCTTTTGG - Intronic
1182961976 22:34483737-34483759 ATGAGGGTGTGGACATCTTTGGG - Intergenic
1183125139 22:35771095-35771117 ATTAGGATGTGGACAACTTTGGG - Intronic
1183245136 22:36687587-36687609 ATTGGGATGTGGACATCTTTGGG - Intronic
1183514869 22:38259305-38259327 GTTAGGATGTCAACATCTTTGGG - Intronic
1183523306 22:38309131-38309153 GTCAAGATCTGGAGACCTTTTGG - Intronic
1183610428 22:38899265-38899287 GTTAATATGTGAAAATATTTAGG + Intergenic
1184413158 22:44337426-44337448 ATTAGGATGCGGATATCTTTGGG + Intergenic
1184745601 22:46453939-46453961 ATGAAGATGTGGACGCCTTTTGG - Intronic
1184869205 22:47223766-47223788 GTCAAAATGTGCACATTTTTTGG + Intergenic
1185245362 22:49770249-49770271 GTAATGCTGTGGACATTTTTGGG - Intergenic
949092280 3:42338-42360 GATTAGCTATGGACATCTTTGGG + Intergenic
949156837 3:837922-837944 GTTAAGACTTCGACATATTTTGG - Intergenic
949238629 3:1842251-1842273 ATTAGGACTTGGACATCTTTGGG - Intergenic
949357547 3:3197913-3197935 ATTTAAATGTGGGCATCTTTAGG + Intergenic
949438599 3:4056176-4056198 ATTGGGATGTAGACATCTTTAGG + Intronic
949644544 3:6077871-6077893 ATTAGGATGTAGACATCTTTTGG - Intergenic
949724274 3:7025306-7025328 ATTAGGATGTGGACATCTCTGGG + Intronic
950741546 3:15056381-15056403 GTTAGGATGTGGACATCTCTGGG - Intronic
950882505 3:16334722-16334744 ATTAGGCTGTAGACATCTTTGGG - Intronic
951282355 3:20767641-20767663 GTAAATATGTGGATATATTTCGG + Intergenic
951394837 3:22152795-22152817 ATTAGGATGTATACATCTTTTGG + Intronic
951421984 3:22497457-22497479 ATTAAAGTATGGACATCTTTGGG + Intergenic
951429797 3:22593184-22593206 ATTAGGATATGGACATATTTTGG + Intergenic
951512989 3:23525296-23525318 ATTAGGATGTGGACATCTTTGGG + Intronic
951737321 3:25882253-25882275 GTTAGGACATGGGCATCTTTGGG + Intergenic
952025675 3:29078380-29078402 GTTAAGAAGTGGAGATATATGGG - Intergenic
952518435 3:34129508-34129530 ATTATGATGTGGGCATATTTGGG + Intergenic
953035904 3:39210794-39210816 GTTTGGATGTAGACAGCTTTGGG - Intergenic
953274714 3:41483664-41483686 ATTAGGATGTGGATGTCTTTGGG - Intronic
953852315 3:46473847-46473869 ATTAGGACATGGACATCTTTGGG + Intronic
954623694 3:52010526-52010548 ATTAGGATGGAGACATCTTTTGG - Intergenic
954850590 3:53596439-53596461 ATTAGGATGTGGAAATCTTTTGG - Intronic
954924334 3:54219023-54219045 ATTAGGACATGGACATCTTTGGG + Intronic
955218346 3:57003561-57003583 ATTAGGATGGGGACATCTTTTGG - Intronic
955325447 3:58006688-58006710 GTTAGGATGTGAACGTCTTTGGG - Intergenic
955466215 3:59239519-59239541 GACAGGATATGGACATCTTTGGG + Intergenic
955598528 3:60618626-60618648 ATTAAAACGTTGACATCTTTAGG - Intronic
955679986 3:61490138-61490160 ATTAGGATGTCGATATCTTTGGG - Intergenic
955876587 3:63496527-63496549 TTTAAGGTGTGTACACCTTTTGG - Intronic
955888406 3:63624651-63624673 GTTAGAATGTGAACATCTTTGGG + Intergenic
955977977 3:64496618-64496640 GTTAGGATGTGGATGTATTTGGG - Intergenic
956277499 3:67518635-67518657 GTTAATTTTTTGACATCTTTTGG + Intronic
956315753 3:67934533-67934555 ATTAGAATCTGGACATCTTTGGG - Intergenic
956411716 3:68986315-68986337 ATTTGGATGTGGACATCCTTTGG + Intronic
956468952 3:69544810-69544832 GTTAATATGTGGAAAGCATTTGG + Intergenic
956722743 3:72132989-72133011 TATAGGATGTGAACATCTTTGGG + Intergenic
956974619 3:74565553-74565575 ATGAAGATGTGGACACATTTCGG + Intergenic
957032543 3:75258293-75258315 GATTAGCTATGGACATCTTTGGG + Intergenic
957180919 3:76876098-76876120 ATTAGGCTATGGACATCTTTTGG + Intronic
957694060 3:83610767-83610789 GTTGTGATGTAGACATATTTGGG + Intergenic
957912728 3:86642596-86642618 TTTAAGATGTAGACATCTTTGGG + Intergenic
957940440 3:86996491-86996513 ATTAGAATGTGGACATCTTTGGG - Intergenic
957969187 3:87361350-87361372 ATTTGGCTGTGGACATCTTTGGG - Intergenic
957978430 3:87476235-87476257 ATTAGAATATGGACATCTTTGGG + Intergenic
958218830 3:90633142-90633164 GTGAATATTTGGACATTTTTAGG - Intergenic
958219278 3:90642154-90642176 GTAAATATTTGGACATTTTTGGG - Intergenic
958860720 3:99442336-99442358 ATTAAGATGTGAACATATTTGGG + Intergenic
958876436 3:99622924-99622946 GTTAGGATGTGGCCACCCTTAGG + Intergenic
959010823 3:101074102-101074124 ATTAGAATGTGGACATCTTGGGG - Intergenic
959029494 3:101281611-101281633 ATTAAGATATGGCCCTCTTTGGG - Intronic
959099780 3:101997218-101997240 ATTAGGACCTGGACATCTTTTGG - Intergenic
959112898 3:102143179-102143201 ATTAAGATGTGGACATTTTGTGG + Intronic
959163299 3:102744491-102744513 ATTAAGATGTGGACATCTTACGG + Intergenic
959412411 3:106041071-106041093 ATTAGGGAGTGGACATCTTTGGG + Intergenic
959585769 3:108023736-108023758 ATTAAGATGTGGAGGTCTTTAGG - Intergenic
959687106 3:109159379-109159401 ATTAGGATGTGGACATCTTTGGG + Intergenic
959908022 3:111731818-111731840 ATTAGGATGTGGACATTTTTGGG + Intronic
959980278 3:112508234-112508256 ATTAGGCTGTGGACATCTTTGGG + Intergenic
960027105 3:113021838-113021860 ATTAGCATGTGAACATCTTTGGG + Intergenic
960173033 3:114485353-114485375 GTTAAGGTGCAGACATCTCTTGG + Intronic
960237048 3:115295707-115295729 ATTAGGATGTGGACATCTTCTGG - Intergenic
960247486 3:115415260-115415282 ATTAGGACGTGGACATCTTTGGG + Intergenic
960300948 3:116001928-116001950 GTTCAAATATAGACATCTTTGGG + Intronic
960584888 3:119311538-119311560 ATAAGGATGTGGACCTCTTTGGG + Intronic
960875101 3:122287982-122288004 ATGAGGATGTGGGCATCTTTGGG - Intergenic
961170633 3:124795532-124795554 ATTAGGATGTGGACATCTCTGGG - Intronic
961760494 3:129163832-129163854 ATTAGGATGTGGACATTTTGGGG - Intergenic
962444905 3:135455534-135455556 ATTAAGATGTGGATGTCTTTGGG + Intergenic
962979296 3:140473336-140473358 GTTCAGAGGTAGACATCTTTGGG - Intronic
963033878 3:141007839-141007861 ATAAAGATGCAGACATCTTTGGG - Intergenic
963075753 3:141344902-141344924 ATTAGGACCTGGACATCTTTGGG + Intronic
963204541 3:142618933-142618955 ATTAGGATGCAGACATCTTTGGG + Intronic
963223505 3:142836909-142836931 ATTAGGATGTGGACATTGTTGGG - Intronic
963266418 3:143244496-143244518 ATTTAGATGTGGCTATCTTTGGG - Intergenic
963372550 3:144419674-144419696 ATTAGGATGTGGATATCCTTGGG + Intergenic
963455214 3:145537914-145537936 ATTAAGATTTAGACATCTTGGGG + Intergenic
963815300 3:149824257-149824279 ATTATGATATGGACATCTTTGGG - Intronic
963861769 3:150318120-150318142 GTTAATATGTGTATTTCTTTAGG - Intergenic
964143796 3:153434146-153434168 ATTAGGATGTGGAAATCTTTGGG + Intergenic
964191443 3:154006452-154006474 ATTAGGATCTGCACATCTTTGGG + Intergenic
964295498 3:155228532-155228554 ATTAGAATGTGGACATCTTCAGG - Intergenic
964562821 3:158016975-158016997 ATTAAGATGTGAACATCTTTGGG + Intergenic
964817363 3:160731098-160731120 ATTAGGATGTGGACATCTTTGGG + Intergenic
964863583 3:161229355-161229377 GGTAAGAAGTGGACAGATTTTGG + Intronic
965188120 3:165491385-165491407 GCTAAGAGGTAGAGATCTTTAGG - Intergenic
965348037 3:167576438-167576460 ATTAGGACATGGACATCTTTGGG - Intronic
965373299 3:167891239-167891261 ATTAAGATGTGGACATCTTTGGG + Intergenic
965781363 3:172289440-172289462 ACTAGGATGTGGACCTCTTTGGG + Intronic
965883490 3:173414901-173414923 ATTCATATGTGGACATCTTAGGG - Intronic
966122976 3:176544212-176544234 ATTAAGATGTGAACGTTTTTGGG - Intergenic
966163550 3:176992121-176992143 GTTAAGATATGGATACTTTTGGG + Intergenic
966164105 3:176997865-176997887 ATTAGGATGTGGACATATTTAGG - Intergenic
966335912 3:178868061-178868083 ATTAAAATGTGAACATCTTTGGG - Intergenic
966374772 3:179285101-179285123 GCTAAGATTTGGATATCTTTGGG - Intergenic
966562615 3:181340557-181340579 ATTAGAATGTAGACATCTTTGGG - Intergenic
966627996 3:182039476-182039498 TTTAAGATCTGGATATCTTTTGG + Intergenic
966644328 3:182226405-182226427 ATTAGGATGAAGACATCTTTGGG + Intergenic
966990460 3:185224982-185225004 ATTAGGACGTGGACATCTTTGGG + Intronic
968359507 3:198137485-198137507 ATTAGGATGTGCACACCTTTGGG + Intergenic
968937765 4:3621632-3621654 GTTAAGATGAGGTCATATTGGGG + Intergenic
969050550 4:4369909-4369931 ATTAAGATGTGGACAGATTTTGG - Intronic
969118988 4:4893182-4893204 ATCAGGAAGTGGACATCTTTGGG - Intergenic
969222671 4:5771530-5771552 ATTGGGACGTGGACATCTTTAGG + Intronic
969342771 4:6552741-6552763 ATTAGAATGTGGACATCTTTGGG + Intronic
969359849 4:6656638-6656660 ATTAGGATGTGGACTTCTATGGG + Intergenic
969472173 4:7395355-7395377 GGTAAGATGGGAACAGCTTTGGG - Intronic
969474788 4:7415619-7415641 ATTAGGATGTGGACCTGTTTTGG + Intronic
969827001 4:9765438-9765460 GTTAGGACATGGACATCTTTGGG - Intergenic
969863068 4:10052854-10052876 ATTCAGATGTGGATATTTTTGGG - Intronic
969917596 4:10505845-10505867 ATTAGAATGTGAACATCTTTGGG + Intronic
970224113 4:13839316-13839338 ATGAAGACATGGACATCTTTAGG + Intergenic
970398060 4:15690948-15690970 AGTAGGATGTAGACATCTTTGGG + Intronic
970680669 4:18503946-18503968 GTTAGGATGTGGACACCTTTGGG + Intergenic
970695315 4:18670057-18670079 ATTAAGATATGGATATCTTTTGG - Intergenic
970815399 4:20150372-20150394 ATTAGAATGTGGATATCTTTGGG + Intergenic
970886670 4:20994192-20994214 TTTAGGATATGGCCATCTTTGGG + Intronic
970906522 4:21223004-21223026 ATTAGGATGTGGACATCTTTGGG - Intronic
970938820 4:21607077-21607099 ATTAAGATGTGGCCACCTTGGGG + Intronic
971443243 4:26712982-26713004 ATTAGGATGTGGACATCTTCGGG + Intronic
971506066 4:27367703-27367725 ATTAGGACATGGACATCTTTGGG + Intergenic
971652283 4:29293593-29293615 ATTAGGGTGTGGACATCATTAGG + Intergenic
971759567 4:30747769-30747791 ATTAGGATGTGGACATCTTAGGG + Intronic
971766083 4:30833614-30833636 GTAAGGATGTGGGCATCTTTGGG + Intronic
971797025 4:31241597-31241619 ATTAGGATGTGGACATCCTTGGG - Intergenic
971973420 4:33651354-33651376 ATTAAAATGTGGGCCTCTTTGGG - Intergenic
971984632 4:33806175-33806197 ATTAAGATGTGGATATGTTAGGG + Intergenic
972279350 4:37587356-37587378 ATTAGGATGTGGATATCTTTGGG + Intronic
972297776 4:37756727-37756749 ATTGAGAGGTGGCCATCTTTGGG - Intergenic
972299198 4:37769177-37769199 ATTAAGATGTCGACATCTTTGGG - Intergenic
972416434 4:38845316-38845338 GATTAGAAGTAGACATCTTTGGG - Intronic
972464654 4:39343425-39343447 ATTAGGCTGTGGATATCTTTTGG + Intronic
972924990 4:43993077-43993099 GTACATATGTGGACATCTCTTGG + Intergenic
972967046 4:44523632-44523654 ATTAAGATGCAGACATCTTTGGG - Intergenic
973219420 4:47708542-47708564 TTTAGGACATGGACATCTTTGGG + Intronic
973334052 4:48938202-48938224 ATTAGGAGGTGGATATCTTTGGG - Intergenic
973567344 4:52201629-52201651 ATTAGGATGTAGATATCTTTGGG - Intergenic
973572395 4:52253670-52253692 TTAAAGATGTGACCATCTTTGGG - Intergenic
973809047 4:54552375-54552397 ATCAGGATATGGACATCTTTAGG - Intergenic
974028722 4:56756871-56756893 GGTTTGATGTGGATATCTTTTGG + Intergenic
974276463 4:59726625-59726647 GTTGAGAGTTTGACATCTTTAGG + Intergenic
974304532 4:60116418-60116440 ATTAGGATTTGGATATCTTTGGG + Intergenic
974313513 4:60245620-60245642 CTTATAATGTGAACATCTTTGGG - Intergenic
974449196 4:62029515-62029537 GTTAACATTTAGACATTTTTCGG + Intronic
974477640 4:62404797-62404819 ATTAGGGTGTGGATATCTTTTGG - Intergenic
974521281 4:62984070-62984092 GTCAAGATATGGAAATTTTTAGG - Intergenic
974854021 4:67437993-67438015 ATTAGTATGTGGACATCTTTCGG - Intergenic
975196199 4:71527096-71527118 ATTAGGACGTGGGCATCTTTAGG + Intronic
975211398 4:71704227-71704249 ATTAGAATGTGGACATCTTTGGG + Intergenic
975454996 4:74579570-74579592 ATTAGGACATGGACATCTTTAGG + Intergenic
975786707 4:77897617-77897639 GCTCATATGTGGATATCTTTTGG - Intronic
975960636 4:79899945-79899967 ATTAGGATGTGGACATCTTGAGG - Intergenic
976179412 4:82384974-82384996 ATTTGGATGTGGACATCTTTGGG - Intergenic
976567313 4:86566062-86566084 GTTAATATGTGCAAATCTTTTGG - Intronic
976817283 4:89163740-89163762 ATTAAGATATGGACATATTTGGG + Intergenic
978107021 4:104915786-104915808 GTTAAACTGTAGAGATCTTTAGG + Intergenic
978352361 4:107833364-107833386 ATTAGGATGTGAACATCTTTGGG - Intronic
978490392 4:109305539-109305561 ATTAGGACATGGACATCTTTGGG - Intergenic
978630131 4:110734507-110734529 ATTGGGATGTGGACATCTTTGGG + Intergenic
978719364 4:111889392-111889414 ATTAGGGTGTGGACATATTTAGG - Intergenic
978842337 4:113229526-113229548 ATTAGGATGTGGACATATGTGGG + Intronic
979006209 4:115300455-115300477 ATTAGGATGTGGATATCTTTGGG + Intergenic
979079314 4:116313519-116313541 GTTAGGACATGGACATATTTGGG - Intergenic
979124544 4:116951216-116951238 ATTGACATGTGAACATCTTTGGG + Intergenic
979155379 4:117381223-117381245 ATTAGGATGTGGACATCTTTGGG + Intergenic
979158740 4:117430712-117430734 ATTAGAATGTGGACTTCTTTGGG + Intergenic
979308987 4:119179924-119179946 ATTAAGAGGTGGAGACCTTTGGG - Intronic
979337685 4:119482410-119482432 ACTAGGATGTGGTCATCTTTAGG - Intergenic
979503738 4:121469188-121469210 ATTAGGATGTGAACATCGTTGGG + Intergenic
979761030 4:124405235-124405257 ATTAGGACATGGACATCTTTGGG - Intergenic
979845873 4:125510864-125510886 ATTTGGATATGGACATCTTTGGG + Intergenic
979937216 4:126713011-126713033 ATTAGGATGTGAACATCTTTGGG + Intergenic
980100942 4:128540648-128540670 ATTGGGATGTGGGCATCTTTAGG + Intergenic
980102063 4:128551692-128551714 AGTAAGAAGTAGACATCTTTGGG + Intergenic
980599225 4:134997837-134997859 ATTAGGATGTAGACATCTCTGGG - Intergenic
980841532 4:138266930-138266952 ATTAGGATATGGACATCTTTAGG + Intergenic
980889077 4:138794866-138794888 GATAGGATGGGGACATCTTAGGG + Intergenic
981339797 4:143608193-143608215 GTTAGAATGTGGATATCTTTGGG + Intronic
981346437 4:143682825-143682847 ATGAAGATGTGGATGTCTTTTGG - Intronic
981402415 4:144328952-144328974 GTTAAGATGTAGACATGTCTAGG - Intergenic
981403433 4:144340203-144340225 ATTAAGGTGTGGACATATTTTGG - Intergenic
981498574 4:145421194-145421216 GTTGGGGTGTAGACATCTTTGGG + Intergenic
981605483 4:146536020-146536042 ATTAGAATGTGGAGATCTTTGGG + Intergenic
981723199 4:147822116-147822138 ATTAAGATGAGGACCTCTGTAGG + Intronic
981871838 4:149496309-149496331 ATTGAGATGTGGATATCTTTGGG - Intergenic
981912426 4:149997031-149997053 ATTAAGATGTGGACAACTTTGGG - Intergenic
981962752 4:150561332-150561354 AATAGAATGTGGACATCTTTGGG - Intronic
982223499 4:153144479-153144501 GTTAAAATATAGACATATTTAGG + Intergenic
982276963 4:153645623-153645645 ATTAGGATGTGGACCCCTTTGGG + Intergenic
982637618 4:157916674-157916696 ATTAGGATGTGGATGTCTTTTGG + Intergenic
982650370 4:158080841-158080863 ATTCAGATGTGAATATCTTTAGG + Intergenic
982889956 4:160835007-160835029 ATTAGGATGTGGACATCTTTGGG - Intergenic
982942364 4:161574236-161574258 ATTAGGATGTGGAAATCTTTTGG + Intronic
982965728 4:161904658-161904680 GTAAAGATGTTTACATATTTTGG - Intronic
983223712 4:165066898-165066920 ATTAAGACATGAACATCTTTGGG + Intergenic
983756680 4:171347177-171347199 ATTAACATGTGGATCTCTTTGGG + Intergenic
983855303 4:172636348-172636370 ATTAGGACATGGACATCTTTGGG - Intronic
983862351 4:172723257-172723279 ATGAGAATGTGGACATCTTTTGG + Intronic
984013359 4:174398611-174398633 ATTAGGATGTAGACATCCTTAGG + Intergenic
984203317 4:176754731-176754753 AGTAGGTTGTGGACATCTTTGGG + Intronic
984218896 4:176948948-176948970 ATTACAATGTGGATATCTTTGGG - Intergenic
984552945 4:181182492-181182514 ATTAGGATGGGGACATCTTGGGG - Intergenic
985235471 4:187868719-187868741 GTTAAGATTTGTAATTCTTTGGG - Intergenic
985968963 5:3360433-3360455 GTTACGATGTGGACATATTTGGG - Intergenic
986460573 5:7966925-7966947 ATTAAGACGTGGACATCTTTGGG - Intergenic
986628370 5:9744679-9744701 ATTAGGATGTGGATGTCTTTGGG - Intergenic
986788524 5:11138374-11138396 ATTAGGATGTAGACATCTTTGGG + Intronic
987017576 5:13836084-13836106 GTTCGGACATGGACATCTTTTGG + Intronic
987022815 5:13892299-13892321 ATTAGGATGTGGACATCCTTGGG - Intronic
987150905 5:15038686-15038708 ATTAGAATGTGAACATCTTTAGG + Intergenic
987428198 5:17797343-17797365 GTTAAAATGTAGACACGTTTAGG - Intergenic
987431394 5:17838445-17838467 ATTAGGATGTGGACATATTTGGG - Intergenic
987588434 5:19890403-19890425 ATTAGGATGTGGAAATCTTTGGG + Intronic
987651137 5:20741507-20741529 ATTAAGAGCTGGATATCTTTGGG - Intergenic
987683915 5:21171958-21171980 GTCAAGATGTGGACAACTAAGGG - Intergenic
987950522 5:24669333-24669355 ATTAGGATGTGGATATCTTTGGG - Intergenic
988054616 5:26078018-26078040 AATAGGATGTGGATATCTTTTGG - Intergenic
988081900 5:26425828-26425850 GTTAGGATGTGATCATCTTTGGG + Intergenic
988445585 5:31282617-31282639 ATTAGGACATGGACATCTTTGGG + Intronic
988468310 5:31512555-31512577 ATTAGGACATGGACATCTTTGGG - Intronic
988600178 5:32632384-32632406 ATTAGGGTGTGGACATCTTTTGG + Intergenic
988744424 5:34119944-34119966 ATTAAGAGCTGGATATCTTTGGG + Intronic
988875299 5:35438633-35438655 ATTAAGACATGGACATCTTTGGG + Intergenic
988995008 5:36706350-36706372 GTTAGGATGTGGATATGTTTGGG - Intergenic
988999086 5:36742612-36742634 ATCAGGATGTGGACATCTTTGGG - Intergenic
989328622 5:40228967-40228989 ATTAGGATATGGACATCTTTGGG + Intergenic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
989729646 5:44633393-44633415 GTTTAAATGTGGACATCTTTGGG - Intergenic
989906016 5:47256386-47256408 GTGGATATTTGGACATCTTTGGG + Intergenic
990157946 5:52900979-52901001 ATTAGGACATGGACATCTTTGGG - Intronic
990276459 5:54202232-54202254 GTTAGGATATGGATATCTTTTGG - Intronic
990300815 5:54447668-54447690 ATTAAGATGTAGATATCTTTTGG + Intergenic
990312919 5:54556640-54556662 ATTAGAATATGGACATCTTTGGG + Intergenic
990624623 5:57597563-57597585 ATTAGGATGTGGACATCTTGAGG + Intergenic
991025219 5:62021851-62021873 ATTAGGATGTGGATATCTTTAGG + Intergenic
991094060 5:62720620-62720642 TTGAGGATGTGGACATCTTTGGG + Intergenic
991221387 5:64223399-64223421 ATTAGGACCTGGACATCTTTGGG + Intronic
991379530 5:66005320-66005342 GTTGAGATGTGGAAATCTGTGGG + Intronic
991562701 5:67971288-67971310 GTCAAGATGGTGACATCTCTGGG + Intergenic
992276441 5:75125607-75125629 GTTAAGATGAGGCCTTCTCTAGG + Intronic
992318773 5:75588963-75588985 ATTAGGATGTGGACATCTTTAGG + Intronic
992339170 5:75804866-75804888 ATTAAGATCTGGATATCTTTGGG - Intergenic
992385654 5:76281952-76281974 ATTAGGATGAGGACATCTTTAGG + Intronic
993083991 5:83340302-83340324 ATTAAGACGTAGACATCTCTGGG - Intronic
993878439 5:93336315-93336337 GTTAGGACATGGACATCTTTGGG + Intergenic
994023097 5:95050825-95050847 GTTAAGATGAGGTCATCCTAGGG + Intronic
994549471 5:101212380-101212402 GTTTTGATGTAGACTTCTTTTGG - Intergenic
994667813 5:102728031-102728053 ATTGGAATGTGGACATCTTTGGG - Intergenic
994675156 5:102811608-102811630 ATTAAGACATGGATATCTTTGGG + Intronic
995262150 5:110116671-110116693 GTTAGGATGTGGATATATTTAGG + Intergenic
995272350 5:110236006-110236028 ATTAGAATGTGGACAACTTTGGG + Intergenic
995281112 5:110336889-110336911 ACTGGGATGTGGACATCTTTGGG - Intronic
995387161 5:111600696-111600718 ATTAACACGTGGACATCTTTGGG + Intergenic
995436319 5:112140001-112140023 GTTAGGATATGAACATATTTTGG + Intergenic
995610386 5:113903403-113903425 GATTAGATATGGACATCTTTAGG + Intergenic
995924136 5:117349253-117349275 GGTAAGATGTTAACATATTTTGG - Intergenic
995958483 5:117810249-117810271 ATAAGGATGTGGACATCTTTGGG - Intergenic
996442193 5:123504186-123504208 ATTAGGATGCGGACATCTTTGGG - Intergenic
996541363 5:124632761-124632783 ATTAGGACATGGACATCTTTGGG - Intergenic
996624061 5:125548414-125548436 ATTAGGATGTGGATATCTCTAGG + Intergenic
996945755 5:129065713-129065735 ATTAAGACGTAGACATCTTTTGG - Intergenic
996976063 5:129436066-129436088 GTTAAAATATAGACATCATTGGG + Intergenic
997348910 5:133216033-133216055 ATTAGGATGTAGACATCTTGGGG + Intronic
997460161 5:134046557-134046579 ATTAGGATGTGGACATCTTGGGG + Intergenic
997588403 5:135058133-135058155 GTTAAGATGAGGTCATCCTGGGG - Intronic
997604149 5:135162059-135162081 ATTAGGACATGGACATCTTTGGG + Intronic
997624232 5:135320702-135320724 ATTAGGATGTGGACATCTTTAGG - Intronic
997715322 5:136038270-136038292 ATTAGGATGTGGACATTTTTGGG - Intronic
997927832 5:138047205-138047227 GTCTGAATGTGGACATCTTTGGG - Intronic
998694255 5:144620870-144620892 ATCAGGATATGGACATCTTTAGG + Intergenic
998942714 5:147302099-147302121 ATTATAATGTGGACAGCTTTGGG + Intronic
998977966 5:147669020-147669042 GTTAAAAAGTGGAAACCTTTGGG - Intronic
999403466 5:151285578-151285600 ATTAGGATGTGAACATCTTTGGG - Intronic
999840904 5:155425501-155425523 ATTAGGATATGAACATCTTTGGG - Intergenic
999857220 5:155607987-155608009 ATTAGGATGCAGACATCTTTGGG - Intergenic
999889154 5:155957829-155957851 GTTAGGACATGGACATCTTTGGG + Intronic
1000276871 5:159745631-159745653 GTTAGGATATGGACATCTTTGGG - Intergenic
1000287394 5:159838409-159838431 TTTAGGATGTGGACATCTCTGGG - Intergenic
1000305170 5:159987944-159987966 ATTAGGATGTGAACATATTTTGG - Intergenic
1000514000 5:162217926-162217948 ATTAAGAAATGGACATCTTTGGG + Intergenic
1000718528 5:164677936-164677958 ATCAGGATGTGGACATCTCTTGG + Intergenic
1000837684 5:166176902-166176924 GTTAAGATGTAGAGAATTTTAGG + Intergenic
1000991334 5:167915078-167915100 ATGAGGTTGTGGACATCTTTAGG + Intronic
1001134427 5:169090566-169090588 ATTAAGAAGTGAACATTTTTGGG - Intronic
1001226348 5:169947653-169947675 GTTAAGATTTTTACATTTTTGGG - Intronic
1001233883 5:170013313-170013335 ATTAGGACATGGACATCTTTGGG - Intronic
1001234013 5:170014263-170014285 ATTAGGACATGGACATCTTTGGG - Intronic
1001270410 5:170307039-170307061 ATGAAGATGTGGACATCTCTGGG - Intergenic
1001359859 5:171072083-171072105 ATTAGGATGTAGGCATCTTTGGG - Intronic
1001698138 5:173687858-173687880 ATTAAGACATGGACATCTTTGGG + Intergenic
1001770724 5:174293907-174293929 ATTAGAATGTGGAAATCTTTAGG - Intergenic
1001784248 5:174398298-174398320 ATTGGGATGTGGACATCTTGGGG - Intergenic
1001933360 5:175688272-175688294 ATTAGGATGTGGACACATTTGGG + Intergenic
1003331140 6:5129686-5129708 ATTAGGATGTGGACGCCTTTGGG + Intronic
1003487651 6:6593444-6593466 GTTAAGAGGTAGACATCTTTGGG + Intronic
1003728035 6:8789056-8789078 GTTAAGTTGTTGACATTTCTAGG - Intergenic
1003878367 6:10458224-10458246 GTTAAGATGTGGATATCTTTTGG + Intergenic
1003981281 6:11392530-11392552 ATTAGGATGTGGACATGTTTAGG + Intergenic
1004003533 6:11618557-11618579 ATTAGGATGTAGACATCTTTAGG + Intergenic
1004080227 6:12385389-12385411 ATTAGGATGTAGACATCTTTTGG - Intergenic
1004167338 6:13268404-13268426 ATGAGGATGTGGACATCTTGTGG - Intronic
1004222376 6:13757956-13757978 ATTCGGATGTGGACATCTTTGGG - Intergenic
1004576455 6:16900384-16900406 TTTAGGATGTGGACATCTTTGGG - Intergenic
1004805624 6:19201138-19201160 GTTAAGATTTGGAGAACTGTTGG - Intergenic
1004999229 6:21224132-21224154 ATTAGGATATGGACATCTTTGGG - Intronic
1005275376 6:24211417-24211439 ATCAGGATGTGGACATCTTGGGG - Intronic
1005347463 6:24904575-24904597 ATTAGGACATGGACATCTTTGGG + Intronic
1005604817 6:27465925-27465947 GTTGGGACATGGACATCTTTGGG - Intronic
1006732012 6:36243372-36243394 GGAAAGATTTGGACATGTTTGGG + Intronic
1007291670 6:40791922-40791944 ATCAGGATGTGGGCATCTTTGGG - Intergenic
1007646013 6:43381804-43381826 ATTAAGATGTGGATATCTTTGGG - Intergenic
1007743686 6:44029214-44029236 ATTAGGGTGTGGACATCTTTGGG - Intergenic
1007977731 6:46118793-46118815 ATTAGGATGTAGACATCTTTGGG - Intergenic
1007984673 6:46196306-46196328 ATTAGGATGTGGATATCTTTTGG - Intergenic
1008506275 6:52233834-52233856 TTTAATATGTAGACAGCTTTTGG - Intergenic
1008550891 6:52629502-52629524 GTTATGAAATGGACATCTCTCGG + Intergenic
1008873493 6:56301110-56301132 ATTAGGATGTGGACATCTTTGGG - Intronic
1008918553 6:56817801-56817823 ATTAGGATGTGCACATCTTTGGG - Intronic
1008957881 6:57235601-57235623 GATAAGATGTGGACAACTTTGGG - Intergenic
1008997471 6:57675469-57675491 ATTATAATGTGGACATTTTTAGG - Intergenic
1009185974 6:60574802-60574824 ATTATAATGTGGACATTTTTAGG - Intergenic
1009596064 6:65738626-65738648 ATTAAAATGTGGACGTCTTTGGG - Intergenic
1010276590 6:73974763-73974785 CTAATGATGTGAACATCTTTTGG + Intergenic
1010321684 6:74517912-74517934 ATTAGGATTTGGACATCGTTGGG - Intergenic
1010401800 6:75454525-75454547 ATTAAGGTGTGGACATCTTCAGG + Intronic
1010450550 6:75997423-75997445 GTTAGGAAGTGTACATTTTTGGG + Intronic
1010504641 6:76642217-76642239 ATTAGGATATGGACGTCTTTGGG - Intergenic
1010572724 6:77497125-77497147 ATTAAGATGTGGATATTTTGAGG + Intergenic
1011010796 6:82701789-82701811 ATTAGGGTATGGACATCTTTGGG + Intergenic
1011135154 6:84092282-84092304 ATTAGGATGTGGACATGCTTGGG + Intergenic
1011598531 6:89039041-89039063 GTTAAGATGAAGGTATCTTTTGG - Intergenic
1011834453 6:91413850-91413872 GTTAGGATGTGAATATCTTTGGG - Intergenic
1012128799 6:95465440-95465462 GTAAAACTGTGTACATCTTTCGG - Intergenic
1012209721 6:96504901-96504923 ATTAGGATATGGACATCCTTGGG + Intergenic
1012575859 6:100796924-100796946 ATTAGGATGTGGAGATTTTTGGG - Intronic
1012630570 6:101461686-101461708 ATTAAGACGTGAACATATTTGGG + Intronic
1012670271 6:102036318-102036340 ATTAAGACATGGACATCTCTGGG - Intronic
1012725216 6:102802023-102802045 ATTAAGACATGAACATCTTTTGG + Intergenic
1012773265 6:103469246-103469268 GTTAAAGTGTGAACATCTTATGG + Intergenic
1012823251 6:104115875-104115897 ATTAGGATATGGGCATCTTTGGG + Intergenic
1013055357 6:106577597-106577619 ATCAGGATGTGAACATCTTTGGG - Intronic
1013204299 6:107932926-107932948 ATTAAGATGTGGACATCTTGGGG - Intronic
1013938191 6:115625915-115625937 AGTTAGATGTGGACATCTTTGGG - Intergenic
1014129589 6:117815677-117815699 ATTAAGACATGAACATCTTTGGG - Intergenic
1014145580 6:117994438-117994460 ATTAGGATATGGACAGCTTTGGG + Intronic
1014173354 6:118304031-118304053 ATTAAGATGTGGATGTCTTTTGG + Intronic
1014187868 6:118456457-118456479 ATTAGGATGTGAACATCTTTGGG - Intergenic
1014512545 6:122341975-122341997 GTTAGGACGTAGACATCTTTGGG - Intergenic
1014901618 6:126972628-126972650 GTTAATATGTGTACATTGTTAGG - Intergenic
1015028515 6:128566838-128566860 ATTCAGATGTGGATATTTTTTGG + Intergenic
1015104574 6:129520921-129520943 CTTAAAATGTGGACAATTTTTGG - Intergenic
1015524744 6:134165349-134165371 GTTAAGATGTGATCACCTTTGGG - Intergenic
1015854766 6:137611655-137611677 ATTAAGAGGTGGGGATCTTTAGG + Intergenic
1015868069 6:137747868-137747890 ATTAGGATGTGGACATAATTGGG - Intergenic
1016363519 6:143292185-143292207 TTTAGGATGTGGATATCTTTGGG - Intronic
1016474829 6:144415851-144415873 GGTAAGAAGTGGTCATGTTTGGG + Intronic
1016509937 6:144831170-144831192 ATTAGGATGTGGACATCTTTGGG - Intronic
1016512458 6:144858966-144858988 GGTAAGATGTTGATATGTTTTGG + Intergenic
1016636000 6:146290984-146291006 ATTATGATGTAGACATTTTTGGG - Intronic
1016639483 6:146332708-146332730 ATTAGGGTGTGGACATCTGTAGG + Intronic
1016692005 6:146948897-146948919 ATTAGGATGTGAACATCTGTAGG + Intergenic
1017219304 6:151947678-151947700 ATTAAGATGTGAAGAGCTTTGGG + Intronic
1017468685 6:154718779-154718801 ATTAGGATGTGGACATCTTGTGG - Intergenic
1017533531 6:155321970-155321992 ATTAGAATGTGAACATCTTTGGG - Intergenic
1018415908 6:163601889-163601911 GTGAGGATGTGGACCTCTCTGGG + Intergenic
1018537562 6:164837726-164837748 ATTCTGATGTGGACATTTTTGGG + Intergenic
1018637674 6:165878619-165878641 ATTAAGACGTGGATGTCTTTGGG - Intronic
1018663325 6:166109549-166109571 GTTAACATCTGTACATCTTGGGG + Intergenic
1018772455 6:166983257-166983279 ATTAGGATGGGGACATCTTTGGG + Intergenic
1018823719 6:167393691-167393713 ATTAGGATGTGGACATCTCTGGG - Intergenic
1019260491 7:79190-79212 ATTAGGATGTGCACACCTTTGGG - Intergenic
1019288100 7:233766-233788 GTTCAGATGCGGACAACTTTGGG + Intronic
1019941674 7:4297121-4297143 GTTAAGTTGTTGGGATCTTTAGG + Intergenic
1020547818 7:9555615-9555637 ATTAAGAAGTGAAAATCTTTGGG - Intergenic
1020571451 7:9868466-9868488 ATTAGGATGTAGACATCTTTAGG + Intergenic
1020911516 7:14137727-14137749 ATTGGGATGTGGACATCTTTTGG + Intergenic
1020931204 7:14397334-14397356 GTTAACATGTGGACTATTTTAGG + Intronic
1021131880 7:16921449-16921471 ATTAGGATGTGGACATCTTCGGG + Intergenic
1021288304 7:18810373-18810395 GTTAGTATGTGGGCACCTTTGGG + Intronic
1021692337 7:23242874-23242896 GTTAGGATGTGGAAGTCTTCGGG - Intronic
1021897705 7:25252854-25252876 ATTAGGATGTGGACATTTTTGGG - Intergenic
1022356306 7:29617801-29617823 ATTAAAATGTAGACATCTTGGGG + Intergenic
1022448044 7:30485989-30486011 GGTAGGATGTGGACATCACTGGG - Intergenic
1022477448 7:30720838-30720860 ATTAGGATGTGGACCTCTTCAGG - Intronic
1022514708 7:30968228-30968250 ATTAGGATGTGGACATCTTTGGG + Intronic
1022831579 7:34072711-34072733 ATTAGGAGGTGGACATGTTTGGG + Intronic
1022874182 7:34511793-34511815 ATTTAGACGTGGACATCTTTTGG - Intergenic
1023019770 7:36001041-36001063 ATAAGGATATGGACATCTTTGGG - Intergenic
1023310488 7:38881476-38881498 ATTAGGATGTAGACATCTTTGGG + Intronic
1023391457 7:39715178-39715200 ATTAGGACATGGACATCTTTGGG - Intergenic
1023572287 7:41584497-41584519 GTTCAGATTTGGCCATCATTTGG - Intergenic
1023617081 7:42030372-42030394 ATTAGGATGTGGACATCTTTGGG + Intronic
1023981279 7:45071935-45071957 ATTAGGATGTGGACGTCTTTGGG + Intronic
1024057730 7:45675253-45675275 GTTAAAATGTTGACATCAGTAGG - Intronic
1024598167 7:50957258-50957280 ATTAAGATGAGATCATCTTTCGG + Intergenic
1024690825 7:51801165-51801187 TTTATAATGTGGACATTTTTAGG + Intergenic
1024747200 7:52421672-52421694 GTTATGTTTTGAACATCTTTTGG - Intergenic
1025067979 7:55874297-55874319 ATTTAGATGTGATCATCTTTGGG - Intergenic
1025290755 7:57719958-57719980 ATGACGATATGGACATCTTTGGG + Intergenic
1025990052 7:66490903-66490925 ATTATGATGTGGGCATCTTGGGG - Intergenic
1026038690 7:66847668-66847690 ATTATGATGTGGGCATCTTGGGG + Intergenic
1026315141 7:69221299-69221321 CTGAGGAGGTGGACATCTTTGGG + Intergenic
1026324166 7:69294574-69294596 ATTAGGATGGGGAGATCTTTTGG - Intergenic
1026539328 7:71266672-71266694 GTTAGAATGTGGATATCTATAGG + Intronic
1026607502 7:71828330-71828352 ATTAGGATGTGGATATCTTTGGG - Intronic
1026823189 7:73563578-73563600 ATTAGGATGTGGATATCTTCAGG + Intergenic
1027549990 7:79579098-79579120 ATTAGGATGTGGACATCTTCGGG - Intergenic
1027724030 7:81780645-81780667 ATTAGGACATGGACATCTTTGGG - Intergenic
1027943605 7:84717448-84717470 ATTAGGATGTGGACATCTTTGGG - Intergenic
1028317753 7:89424787-89424809 ATTAGGCTGTGGATATCTTTGGG - Intergenic
1028460394 7:91085569-91085591 GTTAACAGGTGGACATCTTTGGG + Intronic
1029466143 7:100726055-100726077 GCTAAGAGGTGGACAGCCTTTGG - Intergenic
1030126978 7:106163090-106163112 GTTAAGAGGTGGGAGTCTTTGGG - Intergenic
1030168119 7:106574779-106574801 ATTGGGATGTGGACATCTTTGGG - Intergenic
1030177591 7:106670980-106671002 ATTAAGATATGAACATCTCTGGG + Intergenic
1030284522 7:107811960-107811982 ATTAGGATGTGGGCATCTTTGGG + Intergenic
1030300357 7:107968401-107968423 ATGAGGATGTGGACATCTTTGGG - Intronic
1030306027 7:108019502-108019524 ATTAGGATGTGGACGTCTTTTGG + Intergenic
1030360492 7:108590382-108590404 ATTAGGACATGGACATCTTTGGG - Intergenic
1030386418 7:108872676-108872698 ATTAGGATGTGGATATCTTTGGG + Intergenic
1030405160 7:109101334-109101356 ATTAGGATGTGGATTTCTTTTGG - Intergenic
1030837426 7:114307071-114307093 ATTCAGATGTGAACATCTTTGGG + Intronic
1031132034 7:117843841-117843863 ATTAGGATGTGGACATCTTTGGG - Intronic
1031137514 7:117901059-117901081 ATTAGGACATGGACATCTTTGGG + Intergenic
1031161658 7:118176140-118176162 ATTAGGATGTGGACATCTTTGGG + Intergenic
1031331231 7:120467118-120467140 ATTAAGATGTGAACATCTTTCGG + Intronic
1031440536 7:121789185-121789207 ATCAAGGTGTGGACATCTTTAGG + Intergenic
1031504306 7:122562154-122562176 ATTAGGATCTGGGCATCTTTGGG - Intronic
1031534093 7:122912379-122912401 GTTAGCATGTAGACATCTTTAGG + Intergenic
1031680220 7:124664208-124664230 TTCAGGATGTGGACATCTTTGGG - Intergenic
1032254226 7:130284370-130284392 GTTCAGCTGTGGACATATTGAGG + Intronic
1032297207 7:130650303-130650325 ATTGGGACGTGGACATCTTTGGG + Intronic
1032306840 7:130741990-130742012 ATTAGGATCTGGACATCTGTGGG + Intergenic
1032510756 7:132470514-132470536 ATTAGGATGTGGACATCTTTGGG - Intronic
1032658809 7:133960958-133960980 ATTAGGACGTGGACATCGTTGGG - Intronic
1032726514 7:134594431-134594453 GTTAAGACGGGGAGATCATTGGG + Intergenic
1032946437 7:136858480-136858502 ATTTAAATGTGGACATCTTGGGG + Intergenic
1033126950 7:138714803-138714825 ATTAGGATGTAGACATCTTTGGG - Intronic
1033591930 7:142816164-142816186 ATTAGAATGTGGACATCCTTGGG - Intergenic
1033594643 7:142849544-142849566 ATTAGGATGTAGACATCTTTGGG - Intergenic
1033851028 7:145495114-145495136 ATTAGGATATAGACATCTTTGGG + Intergenic
1033856557 7:145568498-145568520 GTTAGGACGTGGGCATCTTTGGG + Intergenic
1033869377 7:145731969-145731991 ATTAAGAGGTGGATATCTTTTGG - Intergenic
1034479390 7:151308011-151308033 GTTAAGACTTTGGCATCTTTTGG - Intergenic
1034501014 7:151451203-151451225 ATTAAGACGTGGACATCTTTGGG + Intergenic
1035139602 7:156745101-156745123 ATTAGGACTTGGACATCTTTAGG + Intronic
1035555829 8:566406-566428 CTTAGGACGGGGACATCTTTGGG - Intergenic
1037420602 8:18697943-18697965 GTTAGGACATGGACATCTTTGGG - Intronic
1037574107 8:20184724-20184746 ATTAGGAGGTGGACATCTCTGGG + Intergenic
1038127060 8:24686115-24686137 ATTAGGACATGGACATCTTTAGG + Intergenic
1038410518 8:27355099-27355121 ATTAGGATGCGGACATCTTTGGG - Intronic
1038424402 8:27455085-27455107 CTTAGGATGTGGACATCTTTGGG - Intronic
1038747306 8:30265850-30265872 GTTAAAAAGTGGACATTCTTGGG - Intergenic
1038813060 8:30871252-30871274 AGTAGGATGTGGACATCTTTGGG + Intronic
1039077407 8:33704238-33704260 ATTAGGATGTGGACATCTTTGGG - Intergenic
1039134592 8:34306498-34306520 ATTAGGATGTGAACATCTTTGGG + Intergenic
1039350446 8:36758268-36758290 ATTACGGTGTGGATATCTTTTGG + Intergenic
1039741177 8:40384277-40384299 ATCAGGATGTGGACATCTTTGGG - Intergenic
1039817437 8:41106948-41106970 ATTAAGACATGGACATTTTTGGG - Intergenic
1039830387 8:41208891-41208913 GTTGATATGTGGACATAGTTTGG + Intergenic
1039997955 8:42550756-42550778 GTTAAGATGTGGACATCTTTGGG + Intronic
1040360491 8:46659625-46659647 ATTTAGATGTGATCATCTTTGGG + Intergenic
1040398007 8:47018140-47018162 GTAAGCATGTGGACCTCTTTGGG - Intergenic
1040893509 8:52341442-52341464 ATTAGGATGCGGACTTCTTTAGG - Intronic
1041588779 8:59551129-59551151 ATTAAGATGTGGTTCTCTTTAGG + Intergenic
1041936245 8:63335102-63335124 ATTAGGATCTGGATATCTTTGGG + Intergenic
1042207653 8:66345243-66345265 ATTAGGATGTGGACATTTTCTGG - Intergenic
1042227839 8:66528400-66528422 ATTAGGACATGGACATCTTTGGG + Intergenic
1042482454 8:69319467-69319489 ATTAGGATATGGACATCTTTGGG + Intergenic
1042781534 8:72496100-72496122 ATGAGGATGTGGACATCTTTGGG - Intergenic
1042817657 8:72895136-72895158 ATTAGGATATGGACATCTTTAGG - Intronic
1043030366 8:75127137-75127159 ATTAGGATGTAGACAACTTTAGG - Intergenic
1043510716 8:80947626-80947648 ATTAGGATGTGGACATCTTTGGG + Intergenic
1043564252 8:81530620-81530642 ATTAAGACGTGAATATCTTTAGG - Intronic
1043612720 8:82085141-82085163 ATTAGGGTGTGGACAACTTTGGG - Intergenic
1043864785 8:85362361-85362383 ATTAAGATATGGACATTGTTGGG + Intronic
1043967022 8:86490222-86490244 ATTAAGATTGGGGCATCTTTGGG - Intronic
1044347548 8:91122825-91122847 GATTAGGTGTGGGCATCTTTGGG - Intronic
1044355303 8:91215202-91215224 ATTAGGATGTGGACATCTTTGGG + Intronic
1044513533 8:93111935-93111957 ATTAGGATGTTGACATCTTTGGG - Intergenic
1044647905 8:94464104-94464126 ATTAGGGTGTGGAAATCTTTGGG - Intronic
1044966112 8:97575525-97575547 ATTAGGACATGGACATCTTTGGG - Intergenic
1045245152 8:100436136-100436158 ATTAGAATGTGAACATCTTTAGG + Intergenic
1045391205 8:101716654-101716676 ACTTGGATGTGGACATCTTTGGG - Intronic
1045552424 8:103184319-103184341 GCTTAGGAGTGGACATCTTTGGG + Intronic
1045661365 8:104441371-104441393 ATTAAGATGTGGACATCTGCTGG - Intronic
1045664890 8:104473608-104473630 ATTAGGATCTGGATATCTTTGGG + Intergenic
1046070547 8:109247892-109247914 ATTTAGATGTGGACATCTTTGGG - Intronic
1046126367 8:109913917-109913939 TTTAAGCTGGAGACATCTTTTGG - Intergenic
1046248595 8:111600345-111600367 ATTAAGACACGGACATCTTTGGG + Intergenic
1046501556 8:115084583-115084605 ATTAGGTTGTGGACATCTTTGGG - Intergenic
1046612113 8:116437458-116437480 ATTAGGATGTGGATCTCTTTGGG - Intergenic
1046711706 8:117518204-117518226 ATTAGGATGTGGACATCTTCGGG - Intergenic
1047295826 8:123569824-123569846 ATTAGGATGTGAACATTTTTGGG - Intergenic
1047319443 8:123765853-123765875 ATTAGGATGTGAACATCTTTGGG + Intergenic
1047349094 8:124056178-124056200 ATTAGGATATGAACATCTTTGGG + Intronic
1047407221 8:124595726-124595748 GTTAGAACGTGGACATCTTTGGG + Intronic
1047560038 8:125977364-125977386 ATTGAGATGTGGACATCTTTGGG - Intergenic
1047613365 8:126542517-126542539 ATTCAAATGTGGATATCTTTTGG + Intergenic
1047700892 8:127448387-127448409 GTTAAGATGTGGACATCTTTGGG - Intergenic
1047850440 8:128851604-128851626 GTTAGGACATGGACATCCTTGGG - Intergenic
1048035176 8:130671185-130671207 ACTAAGACATGGACATCTTTTGG - Intergenic
1048395648 8:134011476-134011498 ATCAAGATGTGGACATCGCTGGG - Intergenic
1048509920 8:135053030-135053052 ATTATGATATGGACAACTTTGGG - Intergenic
1048518976 8:135136601-135136623 GTTTAGATGTGGACATCTTTGGG - Intergenic
1048555842 8:135475206-135475228 GTTAGTATGTGGATGTCTTTAGG + Intronic
1048722820 8:137346200-137346222 AGTAAGACATGGACATCTTTGGG + Intergenic
1048837620 8:138536464-138536486 ATTCATATGTGGATATCTTTGGG - Intergenic
1048903957 8:139068958-139068980 ATTATGACTTGGACATCTTTGGG + Intergenic
1049003617 8:139841345-139841367 GTTGGGTTGTGGACATCTTGGGG + Intronic
1049134565 8:140884175-140884197 ATTAGGATGTAGGCATCTTTAGG + Intronic
1049522376 8:143100173-143100195 CTTAAGATCTGTCCATCTTTGGG - Intergenic
1049647872 8:143744291-143744313 GGCAGGAGGTGGACATCTTTGGG + Intergenic
1050071869 9:1823513-1823535 ATTAGGATGAGGACATCTTTTGG + Intergenic
1050186818 9:2983448-2983470 ATCAGGATGTGGGCATCTTTGGG - Intergenic
1050193118 9:3051002-3051024 GTGAAGATCTGGACAACCTTTGG + Intergenic
1050250624 9:3740188-3740210 TTTAAAATGTGGTGATCTTTAGG - Intergenic
1050344180 9:4669842-4669864 ATTAGGATGTGGATATCTTTGGG + Intergenic
1050429837 9:5551160-5551182 ATTAGAATATGGACATCTTTGGG + Intronic
1050457539 9:5848107-5848129 ATTAGGATGTGGACATCTTGAGG - Intergenic
1050496515 9:6247925-6247947 CTGAAGATGTGGAAGTCTTTAGG - Intronic
1050593087 9:7180091-7180113 ATGAGGCTGTGGACATCTTTAGG - Intergenic
1050638747 9:7642341-7642363 TTTCAAATGTGGACATCATTGGG + Intergenic
1051550256 9:18319773-18319795 ATTAAGATGTGCACATTTTAGGG - Intergenic
1051687172 9:19669887-19669909 ATGAGGATGTGGACATCTTTCGG + Intronic
1051723039 9:20059071-20059093 ATTAGGAAGTGGACATCTTTAGG - Intergenic
1051741625 9:20258113-20258135 GTTAGGACTTGGACATCTTTGGG - Intergenic
1051766380 9:20528828-20528850 ATTAGGATGTGGACATTTTGGGG + Intronic
1051873730 9:21768715-21768737 TTTAGAATTTGGACATCTTTTGG - Intergenic
1051925847 9:22323747-22323769 TTTAGGATGTGAACATCATTAGG + Intergenic
1052161215 9:25262292-25262314 ATTAGGTTGTGGATATCTTTTGG - Intergenic
1052355983 9:27505134-27505156 ATGAGAATGTGGACATCTTTGGG + Intronic
1052525688 9:29616065-29616087 ATTAGGCTGTTGACATCTTTGGG - Intergenic
1052994349 9:34542515-34542537 ATTAGGATGTGGACATCTTGGGG + Intergenic
1053214831 9:36261565-36261587 AAAAAGATGTGGATATCTTTGGG + Intronic
1053290337 9:36875551-36875573 CTTATGATATGGACATTTTTGGG - Intronic
1053405355 9:37870469-37870491 TTAAGGATGTGGACATCTTTAGG + Intronic
1053468990 9:38332155-38332177 ATTCAAATGTAGACATCTTTTGG + Intergenic
1053549549 9:39061809-39061831 GTTTAAATGTGTACATCTATGGG + Intergenic
1053813662 9:41881884-41881906 GTTTAAATGTGTACATCTATGGG + Intergenic
1054165687 9:61725416-61725438 ATGAGTATGTGGACATCTTTGGG - Intergenic
1054616934 9:67305555-67305577 GTTTAAATGTGTACATCTATGGG - Intergenic
1054734506 9:68736873-68736895 ATTAGGATGTGGACATCTTTGGG + Intronic
1054735839 9:68749096-68749118 ATTAGGATGTGGATATCTTTGGG - Intronic
1054736856 9:68761887-68761909 GTAAGGATGTGGACATCTTTTGG + Intronic
1054744502 9:68840872-68840894 GTTAGGATGTGGACATCTTTGGG + Intronic
1054754244 9:68941203-68941225 ATTAGGATGTGGATAGCTTTGGG - Intronic
1054907933 9:70427099-70427121 ATTAAGATGTGGATATCTTTGGG - Intergenic
1054919239 9:70525291-70525313 ATTAGGACATGGACATCTTTGGG + Intergenic
1055058995 9:72049452-72049474 ATTAGATTGTGGACATCTTTGGG + Intergenic
1055086945 9:72324042-72324064 GTTAGGATGTAGACATGTTTGGG + Intergenic
1055501858 9:76909222-76909244 ATTAGGTTGTAGACATCTTTGGG + Intergenic
1055503367 9:76923959-76923981 ATTGATATGTTGACATCTTTTGG - Intergenic
1055567994 9:77588216-77588238 ATTCAGAGGGGGACATCTTTGGG + Intronic
1055722100 9:79186480-79186502 GTTAGGATGTGGACAGCTTTAGG + Intergenic
1055740210 9:79380088-79380110 ATTAGAATGTGGACATATTTGGG + Intergenic
1055955429 9:81768844-81768866 ATTAAGATATGGACATATTTGGG + Intergenic
1056028294 9:82524292-82524314 GTTAAGATATGGAAATCTTTGGG + Intergenic
1056036267 9:82609269-82609291 ATTAAGGTGTGGATATCTTTGGG + Intergenic
1056144647 9:83717601-83717623 ATTAAAATGTGGACATTTCTGGG + Intergenic
1056821732 9:89847045-89847067 ATTAGAATGTGGACATCTTTGGG - Intergenic
1056899972 9:90589053-90589075 ATTAGGATGTGGACATCTTTGGG + Intergenic
1056983826 9:91342427-91342449 ATTAGGACGTGGACAACTTTGGG + Intronic
1057158965 9:92871758-92871780 ATTAGGATGTGAACATCTTTGGG - Intronic
1057492466 9:95532048-95532070 GTGAGGATGTGGACGTCTTTGGG - Intergenic
1057540531 9:95964399-95964421 ATTACAATGTGAACATCTTTGGG - Intronic
1057738612 9:97690975-97690997 ATTAAGGCATGGACATCTTTGGG + Intronic
1057863493 9:98661279-98661301 ATGAGGATGTGGACATCTTGAGG + Intronic
1059087119 9:111316184-111316206 ATTAAGACATGGACATCTTTAGG - Intergenic
1059485533 9:114623844-114623866 ATTAGGGTGTGGACATCTTTGGG + Intronic
1059573005 9:115460453-115460475 ATTAGAATGTGGACATCTTTGGG - Intergenic
1059752632 9:117262640-117262662 ATAAAGACTTGGACATCTTTGGG - Intronic
1059765048 9:117376130-117376152 ATTAGGATATGGACATCTTTGGG + Intronic
1060002112 9:119968340-119968362 ATTAAGACTTGGACATCTCTAGG - Intergenic
1060009430 9:120030523-120030545 ATTAAGACGTGGATGTCTTTGGG + Intergenic
1060315785 9:122509205-122509227 ATTAGGATGTGGACATCTTTGGG + Intergenic
1061548893 9:131321024-131321046 GTAAAAATGTAGACATATTTTGG + Intergenic
1061819751 9:133220542-133220564 ATGAGGATGTGGACATCTTCAGG - Intergenic
1061819764 9:133220611-133220633 ATGAGGATGTGGACATCTTTAGG - Intergenic
1061819780 9:133220676-133220698 ATGAGGATGTGGACATCTTTAGG - Intergenic
1062240877 9:135537271-135537293 ATGAGGATGTGGACATCTTTAGG + Intergenic
1062240890 9:135537340-135537362 ATGAGGATGTGGACATCTTCAGG + Intergenic
1062240903 9:135537409-135537431 CTGAGGATGTGGACATCTTCAGG + Intergenic
1062744195 9:138201199-138201221 ATTAGGATGTGCACACCTTTGGG + Intergenic
1185453689 X:296794-296816 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453700 X:296843-296865 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453710 X:296892-296914 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453719 X:296941-296963 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453727 X:296990-297012 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453736 X:297039-297061 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453746 X:297088-297110 ATCAGGACGTGGACATCTTTGGG + Intronic
1185453754 X:297137-297159 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453763 X:297186-297208 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453771 X:297235-297257 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453779 X:297284-297306 ATCAGGACGTGGACATCTTTGGG + Intronic
1185453788 X:297333-297355 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453799 X:297382-297404 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453810 X:297431-297453 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453820 X:297480-297502 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453830 X:297529-297551 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453838 X:297578-297600 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453848 X:297627-297649 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453856 X:297676-297698 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453866 X:297725-297747 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453874 X:297774-297796 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453883 X:297823-297845 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453891 X:297872-297894 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453899 X:297921-297943 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453907 X:297970-297992 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453917 X:298019-298041 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453925 X:298068-298090 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453933 X:298117-298139 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453941 X:298166-298188 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453951 X:298215-298237 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453959 X:298264-298286 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453969 X:298313-298335 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453978 X:298362-298384 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453986 X:298411-298433 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453994 X:298460-298482 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454004 X:298509-298531 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454012 X:298558-298580 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454020 X:298607-298629 ATTACGACGTGGACATCTTTGGG + Intronic
1185454030 X:298656-298678 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454038 X:298705-298727 ATCAGGACGTGGACATCTTTGGG + Intronic
1185454048 X:298754-298776 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454056 X:298803-298825 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454065 X:298852-298874 ATTAGGATGTGGACATCTTTGGG + Intronic
1185454071 X:298900-298922 GTTACGACGTGAGCATCTTTGGG + Intronic
1185540209 X:897324-897346 ATTAGGATGTAGACATCCTTGGG + Intergenic
1185540246 X:897614-897636 ATAAGGATGTGGGCATCTTTGGG + Intergenic
1185540262 X:897711-897733 ATTAGAATGTGGACATCTTTAGG + Intergenic
1185540271 X:897760-897782 ATTAGGATGTGGACATCTTTAGG + Intergenic
1185540289 X:897861-897883 ATTAGGATGTGGACATCTCTGGG + Intergenic
1185572581 X:1146125-1146147 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572589 X:1146174-1146196 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572599 X:1146223-1146245 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572607 X:1146272-1146294 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572615 X:1146321-1146343 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572625 X:1146370-1146392 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572633 X:1146419-1146441 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572642 X:1146468-1146490 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572650 X:1146517-1146539 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572657 X:1146566-1146588 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572664 X:1146615-1146637 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572672 X:1146664-1146686 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572679 X:1146713-1146735 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572689 X:1146762-1146784 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572698 X:1146811-1146833 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572707 X:1146860-1146882 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572715 X:1146909-1146931 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572723 X:1146958-1146980 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572741 X:1147055-1147077 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572752 X:1147104-1147126 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572760 X:1147153-1147175 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572768 X:1147202-1147224 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572779 X:1147251-1147273 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572788 X:1147300-1147322 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572799 X:1147349-1147371 ATCAGGACGTGGACATCTTTGGG + Intergenic
1185572808 X:1147398-1147420 ATCAGGACGTGGACATCTTTGGG + Intergenic
1185596846 X:1312418-1312440 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185596854 X:1312466-1312488 ATTAGGACGTGGACATATTTGGG + Intergenic
1185596861 X:1312514-1312536 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185650972 X:1647912-1647934 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185650992 X:1648009-1648031 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185708976 X:2287295-2287317 ATTAGGATGTGGACATCTTTGGG - Intronic
1185708985 X:2287344-2287366 ATTAGGATGTGGACATTTTTGGG - Intronic
1185708991 X:2287392-2287414 ATTGGGATGTGGACATCTTTGGG - Intronic
1185709000 X:2287441-2287463 ATTAGGATGTGGACATCTTCAGG - Intronic
1185709009 X:2287490-2287512 ATTGGGATGTGGACATCTTTGGG - Intronic
1185709041 X:2287637-2287659 ATTAGGATGTGGACATCTTTGGG - Intronic
1185709052 X:2287685-2287707 ATTAACATATGGACATCTTTGGG - Intronic
1185709059 X:2287734-2287756 ATTAGAATGTGAACATCTTTGGG - Intronic
1185709066 X:2287783-2287805 ATTAGGATGTGGACATCTTTGGG - Intronic
1185743827 X:2555550-2555572 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185743838 X:2555599-2555621 ATTAGGACATGGACATCTTTGGG + Intergenic
1185743857 X:2555699-2555721 ATTAGAATGTGGACCTCTTTGGG + Intergenic
1185743867 X:2555749-2555771 ATTAGAATGTGGACATCTTTGGG + Intergenic
1185743877 X:2555799-2555821 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185752823 X:2627702-2627724 GTTAGGATGTGGGCATCTCTGGG - Intergenic
1185754753 X:2644512-2644534 ATTAGGATGTGGGCATCTCTGGG + Intergenic
1185793523 X:2945599-2945621 ATTAGGATGTGGACATCTTTGGG + Intronic
1185825119 X:3242408-3242430 ATTAGAATGTGGGCATCTTTGGG - Intergenic
1185825129 X:3242457-3242479 ATTAGGATGCAGACATCTTTGGG - Intergenic
1185825137 X:3242502-3242524 ATTAGGATGTGGACATCTCTGGG - Intergenic
1185837669 X:3360460-3360482 ATTAGGATGTGGACATCTCTGGG + Intergenic
1185882558 X:3754590-3754612 ATTCAGATGTGGACATCTTTGGG - Intergenic
1185922346 X:4107697-4107719 ATTAGGATGTGGACATCTTTGGG - Intergenic
1185922363 X:4107838-4107860 ATTAAGATGTGGGCATCTTTGGG - Intergenic
1185922374 X:4107888-4107910 ATTAAGATGTGGGCATCTTTGGG - Intergenic
1185922385 X:4107939-4107961 ATTAAGATGTGGACATCTTTGGG - Intergenic
1186024213 X:5291089-5291111 TTTAGGACGTAGACATCTTTAGG + Intergenic
1186024226 X:5291177-5291199 ATTAGGATGTGGACATCTTTGGG + Intergenic
1186024252 X:5291328-5291350 GTTAGGATGTAAACATCTTTGGG + Intergenic
1186031819 X:5376534-5376556 ATTAAGATGTAGACATCTTTGGG + Intergenic
1186074672 X:5865286-5865308 GTTAGGATATGGATACCTTTTGG - Intronic
1186103616 X:6182526-6182548 ATTAAGATGTGGATAGCTTTGGG - Intronic
1186139347 X:6554699-6554721 ATTAGGATGTGAACAACTTTGGG - Intergenic
1186197064 X:7120166-7120188 ATTAGGACTTGGACATCTTTGGG - Intronic
1186594021 X:10961067-10961089 ATTAAGACGTGGAAACCTTTGGG - Intergenic
1186624951 X:11283488-11283510 ATTTGGATGTGGACATATTTTGG - Intronic
1186730799 X:12407230-12407252 GTTAAAATGCAGACATCTTTGGG + Intronic
1186768589 X:12795287-12795309 ATTAGGATGTAGACATCTTTAGG + Intronic
1186882303 X:13878638-13878660 ATTAGGATGTGGACATCTTGGGG - Intronic
1186916929 X:14233068-14233090 ATTAGGATGTTGACATCTTTGGG - Intergenic
1187333972 X:18365685-18365707 ATTAGGATGTGGACATCTTCGGG + Intergenic
1187410194 X:19044495-19044517 TTTAGGATGTGGACATTTTTGGG + Intronic
1187506222 X:19880638-19880660 ATTAGGATATGGCCATCTTTGGG - Intronic
1187592570 X:20734499-20734521 GTTAAGACATAGACATTTTTGGG + Intergenic
1187959517 X:24555173-24555195 ATTAGGATATGGACATTTTTGGG - Intergenic
1187971037 X:24658798-24658820 ATTACAATGTAGACATCTTTGGG + Intronic
1188090440 X:25957924-25957946 TTTAATATGTGGACATTGTTTGG - Intergenic
1188266902 X:28087992-28088014 ATTCGGATGTGAACATCTTTGGG + Intergenic
1188283278 X:28297282-28297304 ATTAAGATGTGGAGATTCTTTGG - Intergenic
1188369012 X:29346288-29346310 TTTAGCATGTGGACATCTTTGGG + Intronic
1188390986 X:29618776-29618798 ATTAGGATCTGGATATCTTTGGG + Intronic
1188408649 X:29844001-29844023 ATTAGGACGTGGACATGTTTTGG + Intronic
1188410937 X:29871322-29871344 GTTCAGATGTAGACATCCTTGGG + Intronic
1188640580 X:32497580-32497602 GTTTTGATATGGTCATCTTTTGG + Intronic
1188828463 X:34866176-34866198 ATTAGGACGTGGACATCTTTAGG + Intergenic
1189120934 X:38394115-38394137 GTTAGGACATGGACATCTTTGGG + Intronic
1189159794 X:38800475-38800497 GATAATTTGTGGACATTTTTGGG + Intergenic
1189383243 X:40516785-40516807 ATTAGGATGTGGATGTCTTTGGG - Intergenic
1189538925 X:41966163-41966185 ATTAGGATATAGACATCTTTGGG - Intergenic
1189559561 X:42178094-42178116 GTTAGGATTTCAACATCTTTTGG + Intergenic
1190040089 X:47064326-47064348 ATTAGGACATGGACATCTTTGGG - Intergenic
1190250318 X:48718506-48718528 ATTAGGAAGTGCACATCTTTGGG + Intergenic
1190315988 X:49151379-49151401 ATTAGGAGGTGAACATCTTTGGG + Intergenic
1190357072 X:49616087-49616109 ATTAGGATATGGGCATCTTTGGG + Intergenic
1190576446 X:51844208-51844230 ATTAGAATGTGAACATCTTTAGG - Intronic
1190858872 X:54324334-54324356 ATTAGGACATGGACATCTTTGGG + Intronic
1191071419 X:56404575-56404597 ATTAGGGTGTGGACATCTTCAGG + Intergenic
1191102499 X:56747030-56747052 ATTGTGGTGTGGACATCTTTGGG + Intergenic
1191838408 X:65490095-65490117 ATTAAAATGTGGACATCTCTAGG - Intronic
1192093663 X:68187200-68187222 ATTAGTATGTGGACACCTTTGGG - Intronic
1192423738 X:71057316-71057338 GTGAAGATTTAGACTTCTTTTGG + Intronic
1193080020 X:77397632-77397654 ATTAGGATGTGGACATCTATGGG + Intergenic
1193142485 X:78042476-78042498 TTTAAAATGTGGACATCTTGTGG + Intronic
1194081363 X:89469002-89469024 ATTTGGATGTGGAGATCTTTGGG + Intergenic
1194763179 X:97818090-97818112 ATTAGGACATGGACATCTTTGGG - Intergenic
1194860618 X:98994254-98994276 ATTAGGATGTAGACATCTTGTGG - Intergenic
1195026484 X:100882777-100882799 CTTAGGATGTGGACATCTTTAGG - Intergenic
1195246637 X:103001279-103001301 ATTAGTATGTGAACATCTTTGGG + Intergenic
1195634164 X:107094565-107094587 ATTAGGATGTGGACATCTTTGGG - Intronic
1195871028 X:109485961-109485983 GTTAAAATATTGACATCTTGCGG - Intergenic
1196407956 X:115385488-115385510 ATTAAGACCTGGATATCTTTAGG - Intergenic
1196595474 X:117540925-117540947 ATTAGGATGTGGACATGTTTGGG + Intergenic
1196596394 X:117550767-117550789 ATTAATATGTGGGCATATTTGGG - Intergenic
1196632647 X:117961457-117961479 GTTAAGATGTGGACATCTTTAGG - Intronic
1196636170 X:118005431-118005453 ATTAAGATGTGGACATCTTTGGG - Intronic
1196840684 X:119856186-119856208 ATTAGGATGTGTACAACTTTGGG + Intergenic
1197056179 X:122121911-122121933 ATTAGGATGTGGACACTTTTGGG + Intergenic
1197141073 X:123117824-123117846 GGCAGGATGTGGACATCTTTAGG + Intergenic
1197249107 X:124196258-124196280 ATTAAGATGTGAATATCTTTTGG - Intronic
1197339261 X:125245704-125245726 TATAAGAAGTTGACATCTTTTGG + Intergenic
1197562128 X:128036547-128036569 GTTTGGATGTGGACATCCTTGGG + Intergenic
1198083454 X:133261487-133261509 ACTAGGATGTGGGCATCTTTCGG - Intergenic
1198458666 X:136842525-136842547 ATTAAGATGTAGACATCTTTGGG - Intergenic
1198587345 X:138137271-138137293 ATTAAGATGTGAACATCTCTGGG + Intergenic
1198848189 X:140936348-140936370 ATTAGGACGTGAACATCTTTGGG + Intergenic
1199228958 X:145412374-145412396 ATTAGGACATGGACATCTTTGGG + Intergenic
1199396860 X:147348075-147348097 ATTACGGTGTAGACATCTTTGGG + Intergenic
1199611666 X:149621983-149622005 ATTAGGATGTGGACATACTTGGG + Intronic
1199666055 X:150097409-150097431 ATTAGGACGTGGACATCTTTGGG + Intergenic
1199730782 X:150630064-150630086 ATTAGGACATGGACATCTTTGGG + Intronic
1199763550 X:150924278-150924300 CTTAGGACATGGACATCTTTGGG + Intergenic
1199765428 X:150937798-150937820 ATTAGGACATGGACATCTTTGGG + Intergenic
1199785435 X:151101055-151101077 ATTAAGGTGTGGTCATCTTGTGG - Intergenic
1199787620 X:151118937-151118959 ATTAGGATATGGACATCTTGTGG - Intergenic
1199876931 X:151939985-151940007 ATTAGGAGGTGGATATCTTTTGG - Intergenic
1199903738 X:152203919-152203941 AATAGAATGTGGACATCTTTGGG + Intronic
1200041886 X:153376544-153376566 ATGAGGACGTGGACATCTTTTGG - Intergenic
1200084586 X:153597666-153597688 ATTAGGATAGGGACATCTTTGGG + Intronic
1200434037 Y:3125207-3125229 ATTTGGATGTGGAGATCTTTGGG + Intergenic
1200782435 Y:7228724-7228746 ATTCAGATGTGGACATCTTTGGG + Intergenic
1201254033 Y:12089456-12089478 ATTAAGATATGGACATCTCTGGG + Intergenic
1201254045 Y:12089554-12089576 ATTAGAATGTGGACATCTTTGGG + Intergenic
1201254058 Y:12089652-12089674 ATTAGGATATAGACATCTTTGGG + Intergenic
1201594799 Y:15656265-15656287 ATTAAAACATGGACATCTTTAGG - Intergenic
1201613844 Y:15873661-15873683 ATTAGGACCTGGACATCTTTGGG - Intergenic
1201687516 Y:16723184-16723206 GCTGAGCTGTGGACATTTTTTGG + Intergenic
1202012694 Y:20363527-20363549 TTTAGGATTTTGACATCTTTGGG + Intergenic