ID: 1196635279

View in Genome Browser
Species Human (GRCh38)
Location X:117994629-117994651
Sequence GCCCAGTGAGACTGGAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196635279_1196635283 29 Left 1196635279 X:117994629-117994651 CCTCTGTTCCAGTCTCACTGGGC No data
Right 1196635283 X:117994681-117994703 AGATTTGGCTTATCACCTTTAGG No data
1196635279_1196635282 14 Left 1196635279 X:117994629-117994651 CCTCTGTTCCAGTCTCACTGGGC No data
Right 1196635282 X:117994666-117994688 CCTTGAATTATTTATAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196635279 Original CRISPR GCCCAGTGAGACTGGAACAG AGG (reversed) Intronic