ID: 1196637277

View in Genome Browser
Species Human (GRCh38)
Location X:118017077-118017099
Sequence TGCTAGAAAGATCACTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196637277 Original CRISPR TGCTAGAAAGATCACTTTGG TGG (reversed) Intronic
901148149 1:7082124-7082146 TTTTAGAAACATCACTCTGGTGG - Intronic
901472564 1:9467856-9467878 TGCTGGTAAGATGAGTTTGGTGG + Intergenic
902614110 1:17614489-17614511 CCCTTGAAAGACCACTTTGGGGG + Intronic
904183992 1:28688365-28688387 TGCTAGAGGTATCACTGTGGAGG + Intronic
904490953 1:30858661-30858683 TTCCAGGAAGATCACTCTGGTGG - Intergenic
905466697 1:38159797-38159819 TTTTAAAAAGATCACCTTGGTGG + Intergenic
907992893 1:59600012-59600034 TATTAGAAAGATCATTGTGGTGG + Intronic
908492421 1:64659418-64659440 TGCTACATAGATTCCTTTGGAGG - Intronic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909572488 1:77132119-77132141 GGATATAAAAATCACTTTGGAGG - Intronic
909819177 1:80038229-80038251 TGCTAGCAAAAATACTTTGGAGG - Intergenic
910164782 1:84314844-84314866 GGCTAGAAAGGTCACTTTTCAGG - Intronic
910644383 1:89497629-89497651 TGCTACAAAGAACAGTTTGGAGG + Intergenic
912359135 1:109080256-109080278 TTTTAAAAAGATCACTTTTGCGG + Intergenic
912984342 1:114411670-114411692 TGCTAGAAAGATAACTCTAAGGG + Intronic
914406515 1:147379492-147379514 TGCTAATAAGATGACTTAGGTGG - Intergenic
915560364 1:156683572-156683594 TCTTAGAAAGATCATCTTGGAGG + Intergenic
915842458 1:159225625-159225647 TCATACATAGATCACTTTGGAGG + Intergenic
916826307 1:168445179-168445201 TTCTAGAAAGATGACCCTGGTGG + Intergenic
918257873 1:182766315-182766337 TGTTTGAAAGATCACAATGGCGG - Intergenic
918743367 1:188165858-188165880 TTTTAGAAACATCACTTAGGTGG - Intergenic
918973706 1:191452936-191452958 TGCTATAAATAATACTTTGGAGG + Intergenic
919774354 1:201184367-201184389 TGCTAGAAAGAGCCCGTGGGTGG - Intergenic
920270187 1:204756938-204756960 TGCTAGCAAGATCGCTTGGAGGG - Intergenic
921683577 1:218063758-218063780 TGCTGGAAAGAACTGTTTGGGGG + Intergenic
923883171 1:238126329-238126351 TGCTAGATATATCACTCTGATGG - Intergenic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
1063089639 10:2850874-2850896 TCCTAAAACCATCACTTTGGGGG + Intergenic
1063462186 10:6221882-6221904 TGTTAGAAGGTTCAGTTTGGGGG - Intronic
1066237180 10:33496970-33496992 TGGTAGAAAGATGACTGTGCAGG - Intergenic
1066465850 10:35649585-35649607 TGCTGGAAAGGTCACGTGGGTGG - Intergenic
1067171734 10:43912460-43912482 TGCTGGAATAATGACTTTGGTGG + Intergenic
1067363549 10:45603810-45603832 TTATAAAAAGTTCACTTTGGAGG - Intergenic
1067676770 10:48387219-48387241 TGCTAGAAAGAACAGTTAAGTGG + Intronic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1070265153 10:74894968-74894990 TGCTATAAAGAACAGTTTGGCGG - Intronic
1070693076 10:78542152-78542174 TTCTAGAAAGATCACTCTGTGGG - Intergenic
1072931436 10:99666520-99666542 TTAAAGAAAGCTCACTTTGGTGG + Intronic
1074116898 10:110462992-110463014 GCCTAGAAAGATCACTCTGGCGG + Intergenic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1074970104 10:118529113-118529135 TGCAAGAAAGATCACAATTGAGG + Intergenic
1079015275 11:16863445-16863467 GGCATGCAAGATCACTTTGGAGG - Intronic
1079151982 11:17908117-17908139 TTTTAGAAAGATCACTGTGATGG - Intronic
1079351200 11:19693501-19693523 TCCTCAAAAGATGACTTTGGTGG - Intronic
1080001826 11:27359137-27359159 TGATAGAAAGATAACATTTGAGG - Intronic
1080068504 11:28049024-28049046 TATTAGGAAGATCACTTTGTTGG + Intronic
1080743352 11:35085711-35085733 TGCTAAAAATATACCTTTGGGGG - Intergenic
1081037040 11:38161558-38161580 TTCTAGAAAGATGACCATGGAGG - Intergenic
1081394820 11:42574359-42574381 TGTTAGAAAGAACACTTTCCTGG + Intergenic
1083597462 11:63925151-63925173 TTTTAGAAAGATCACCCTGGAGG - Intergenic
1085439509 11:76545829-76545851 TGTTACAAAGATAACTTTTGAGG + Exonic
1086584414 11:88434332-88434354 GGGTAGAAAGAGCACTTAGGGGG + Intergenic
1087676210 11:101164963-101164985 TATTAGAAAGATAACTTTGCTGG + Intergenic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1090163624 11:124522358-124522380 TGCTAGAAAGTACAATATGGTGG + Intergenic
1090260992 11:125320032-125320054 AGCTAGAAAGATCTTTTTGAAGG - Intronic
1091114366 11:132999485-132999507 TGTCAGAAAAATCACTTTAGAGG + Intronic
1092764630 12:11841569-11841591 TGCTATATAGATCAGTTAGGAGG + Intronic
1094256303 12:28431670-28431692 TGGCAGAGAGGTCACTTTGGGGG - Intronic
1097694375 12:62762514-62762536 TGCTATAAGGATCATTTTCGGGG - Intronic
1098598648 12:72303020-72303042 TGCTTGAATAATGACTTTGGTGG + Intronic
1099501109 12:83415258-83415280 TGCAAGATAGATCACCTTGGGGG + Intergenic
1100908693 12:99333048-99333070 TTTTAGAAACATCACTCTGGAGG + Intronic
1100951943 12:99860539-99860561 TTTTAGAAAGATCCCTCTGGAGG + Intronic
1102226923 12:111235351-111235373 TTCCAGAAAGATCTCTCTGGAGG + Intronic
1102549577 12:113681949-113681971 TGATGTAAACATCACTTTGGTGG + Intergenic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1103222144 12:119254844-119254866 TGCTAATAACATCACCTTGGGGG + Intergenic
1104287091 12:127433184-127433206 TCCTAGAATGATCACTATTGGGG + Intergenic
1104502322 12:129297904-129297926 AGACAGAAAGATCACTCTGGAGG + Intronic
1107809724 13:44188723-44188745 TTCCAGAAAGATCACTCAGGTGG - Intergenic
1107967367 13:45609397-45609419 TGCTGGAGAGATGACATTGGAGG - Intronic
1109857522 13:68152159-68152181 AGCTAGAAGGATCAGTTTGAGGG - Intergenic
1110029763 13:70594535-70594557 TGCTAGATAGAACATTTTAGAGG - Intergenic
1110523981 13:76514372-76514394 TGCTTGAAAGACCTTTTTGGAGG + Intergenic
1110766288 13:79283120-79283142 TGCTAGCAAGATCACTGGTGAGG + Intergenic
1110954662 13:81539192-81539214 AGCTACAAAGATGACTTTGGAGG - Intergenic
1111807226 13:93052847-93052869 TGCTAGAAACATCATTGTGCAGG - Intergenic
1112240392 13:97675781-97675803 TTCAAGAGAGATCACTTTGCTGG - Intergenic
1112778182 13:102867870-102867892 GGCTAGATAGCTAACTTTGGGGG + Intronic
1114358636 14:21944011-21944033 TGCCACAAATATCCCTTTGGAGG + Intergenic
1114520488 14:23331406-23331428 TGCTAATATCATCACTTTGGGGG - Intergenic
1115051111 14:29064653-29064675 TCCTAGCAACATCACCTTGGGGG + Intergenic
1116425474 14:44784992-44785014 TCCTAAAACCATCACTTTGGGGG - Intergenic
1117802776 14:59462997-59463019 TCCAAGGAAGATCATTTTGGAGG + Exonic
1117825582 14:59699083-59699105 TGCTGGAAACATAATTTTGGTGG + Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126351439 15:47748832-47748854 TTTTAGAAAGATCATTCTGGTGG + Intronic
1126778343 15:52118428-52118450 TGGGAGAAAGATCACCTTGATGG + Exonic
1128835065 15:70802895-70802917 TGCTGGAAAGAGCACTGTTGTGG - Intergenic
1129545517 15:76390894-76390916 AGCCAGAAAGATCATTTAGGAGG - Intronic
1130441018 15:83954722-83954744 TCATAGAGATATCACTTTGGTGG + Intronic
1131464752 15:92646098-92646120 TGCTGGAAGGACCACTTGGGAGG - Intronic
1133675608 16:8068670-8068692 TGCTATGAAGAACAGTTTGGAGG - Intergenic
1134085887 16:11357210-11357232 TGCTTCAAAGTTCACTTTAGTGG + Intergenic
1135636479 16:24080088-24080110 CTTTTGAAAGATCACTTTGGTGG + Intronic
1135711180 16:24718699-24718721 AGTTAGAAAGACCTCTTTGGTGG + Intergenic
1138308453 16:56001748-56001770 ATCTAGAAAGAACAGTTTGGTGG + Intergenic
1139657902 16:68400055-68400077 TGCTACCAAGATCACAGTGGAGG + Intronic
1139800155 16:69515865-69515887 GGGGAGAAATATCACTTTGGGGG - Intergenic
1141118256 16:81330223-81330245 TTCTAGAAACATCACTCTGGCGG - Intronic
1143287684 17:5802376-5802398 TTTTAGAAAGATCCCTTGGGGGG - Intronic
1143360862 17:6369626-6369648 TGATTGATAGATCACTTTGGGGG - Intergenic
1143374637 17:6459996-6460018 TTATAGAAAGATCCCATTGGTGG - Intronic
1145113736 17:20188859-20188881 TTCTATTAATATCACTTTGGGGG - Intronic
1146783562 17:35698137-35698159 TATTAGAAAGTTTACTTTGGTGG + Intronic
1148350791 17:46940569-46940591 TGCCAGACAGCACACTTTGGAGG + Exonic
1148972146 17:51492808-51492830 TCCTAGACACATCAGTTTGGGGG + Intergenic
1149104554 17:52946307-52946329 TGCTAGAAACATCAATTTTATGG + Intergenic
1149462032 17:56836605-56836627 TTTTAGAAAGATCATTTGGGTGG - Intronic
1154504133 18:15018275-15018297 TGCTAGAAGTATAAATTTGGGGG - Intergenic
1155187983 18:23404289-23404311 TCCTAGTACCATCACTTTGGAGG - Intronic
1155469252 18:26173375-26173397 TGCTAGAAAGGCCAGTTAGGAGG - Intronic
1156064477 18:33123123-33123145 TAGTAGAAAGCTCACTTTTGAGG + Intronic
1156269888 18:35520939-35520961 TGGTAGAGAGCTCACTTAGGGGG - Intergenic
1156320212 18:36013868-36013890 TTCTAGATAGATCATTTTGTTGG - Intronic
1156547470 18:37979131-37979153 AGCTAGAAAGATCATTTTTAAGG + Intergenic
1158040879 18:53091719-53091741 TCCTAATATGATCACTTTGGAGG + Intronic
1159881742 18:73864831-73864853 TTTTAGAAAAATTACTTTGGTGG - Intergenic
1159981557 18:74787298-74787320 TCCCAGCAAGATAACTTTGGTGG - Intronic
1165262716 19:34634634-34634656 TGCCAGAAAGTTCACCCTGGAGG - Intronic
1167033848 19:46981449-46981471 TGCTAGAAAGGAAACTTTGGAGG + Intronic
926733216 2:16053067-16053089 TTTTGGAAAGATCACTTTGGTGG + Intergenic
926858651 2:17284581-17284603 TGCTAAAATGATCATTTTGTAGG - Intergenic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
928269323 2:29842119-29842141 AGCTAGAAAGTTGACTTTGAAGG + Intronic
933242702 2:79940984-79941006 TGCTATAAAGATCACTCTTTTGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933781685 2:85807017-85807039 TTTTGGAAAGATCACTTTGGTGG + Intergenic
934056699 2:88257300-88257322 TCCTAGTACGATCACATTGGGGG - Intergenic
934667708 2:96184578-96184600 TTAAAAAAAGATCACTTTGGAGG - Intergenic
935201477 2:100860527-100860549 TGCTTGAAACATTACTATGGTGG + Intronic
935545069 2:104392273-104392295 TGCTCAAAATATCATTTTGGGGG - Intergenic
937478930 2:122239552-122239574 AAGTAGAAAGATCACTTTGGTGG + Intergenic
938066151 2:128283025-128283047 TGCTGGAGAGGTGACTTTGGAGG - Intronic
940307223 2:152239565-152239587 TCCTAATACGATCACTTTGGGGG - Intergenic
940762003 2:157749146-157749168 TGCTATAAAAACCACTTTGTGGG + Intronic
942146559 2:173032691-173032713 TGCCAGAAAAATGAGTTTGGAGG + Intronic
945166378 2:206951293-206951315 TGCTATTAAGATAAGTTTGGTGG + Intronic
946740612 2:222797443-222797465 TGCAGGAAAGATTATTTTGGGGG - Intergenic
947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG + Intergenic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
1169935514 20:10879377-10879399 TGCTAAAAGGATAATTTTGGTGG + Intergenic
1170282870 20:14670798-14670820 TGGTAGAAAGAACAGTTGGGAGG - Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1174163851 20:48570824-48570846 TGTAATAAAGATCACTTGGGGGG - Intergenic
1174464555 20:50707234-50707256 TTTTAGAAGGATCACTGTGGAGG + Intergenic
1177336931 21:19741195-19741217 TACTAGAAAGATAACTTGGCTGG - Intergenic
1177763482 21:25429993-25430015 TTTTAGAAATATCACTTTGGAGG - Intergenic
1177993100 21:28061656-28061678 TGCTAGAAGTATAAATTTGGGGG + Intergenic
1178024679 21:28452596-28452618 AGCAAGAAAGACCACTGTGGAGG + Intergenic
1178110767 21:29367843-29367865 TGCAAGAAAGAAGAGTTTGGAGG - Intronic
1178136302 21:29631270-29631292 TGCTAGTACCATCACATTGGGGG - Intronic
1178538407 21:33429239-33429261 TGGAACAAAGATCACATTGGTGG - Intronic
1180253879 21:46609015-46609037 TGCTAGAAACTTCACTGAGGTGG - Intergenic
1180726189 22:17948323-17948345 TCCCAGAACGGTCACTTTGGTGG + Intronic
1183593657 22:38796592-38796614 TTGTGGAAAGATCACTCTGGTGG + Intergenic
1183733436 22:39630789-39630811 TGCTGGAAAGCCCACTTTCGGGG - Intronic
949286936 3:2417672-2417694 TGCTAGAAACATCAGTGTGCAGG - Intronic
949449693 3:4171991-4172013 TTTTAGAAAGATCACATTGAAGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
950848903 3:16043562-16043584 TGCTAGAAAAAGCACTTTGTTGG + Intergenic
952046353 3:29326133-29326155 TTGTAGAAAGATAAATTTGGTGG - Intronic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
956616083 3:71174221-71174243 TTGTAGAAAGATTACTGTGGAGG + Intronic
957907137 3:86571634-86571656 TGCTATGAAGAACAGTTTGGAGG - Intergenic
959022499 3:101203586-101203608 TGCTAGAAATATGACTTGGCGGG + Intergenic
959143401 3:102513988-102514010 TTGTAGAAAGCTCATTTTGGAGG - Intergenic
962943381 3:140145819-140145841 TGTTGGAAAGATCACTCTGCTGG - Intronic
963721663 3:148868432-148868454 TGCTAGAAAAATGACTTTGCTGG + Intronic
964541968 3:157789665-157789687 TTTTAGAAAGATGACCTTGGCGG - Intergenic
966566256 3:181384806-181384828 TTTTAGAAAGATCACTTAAGCGG - Intergenic
969066752 4:4489152-4489174 TAGTTGAAAGATGACTTTGGAGG - Intronic
971565938 4:28141720-28141742 TGAGAGAAAGGTCAATTTGGGGG - Intergenic
971798886 4:31262523-31262545 TTTTAGAAAGACCACTTTTGGGG + Intergenic
973793201 4:54396974-54396996 ATCGAGAAAGATCACTCTGGTGG + Intergenic
976407972 4:84680929-84680951 TGCTAAGAAAATAACTTTGGTGG - Intronic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
977627428 4:99202752-99202774 TGTTAGTAAGGTCAATTTGGGGG + Exonic
978147918 4:105398653-105398675 TGGTAGAATGAACACTTAGGAGG + Intronic
978779075 4:112531058-112531080 TGTTAGAAAAATCATTCTGGTGG + Intergenic
979483679 4:121247074-121247096 AGCTAGAAAGATTCCTTTGGGGG - Intergenic
979800863 4:124907044-124907066 TGCTTGAAACATCACCTTGCAGG - Intergenic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
981467347 4:145088516-145088538 TGCCAGAAAGGTCACTCTGAAGG + Intronic
981555836 4:145992544-145992566 TGCTATAAATATCAGTTTGCAGG + Intergenic
982611315 4:157576968-157576990 TGCTTGAAAGGCCACTTTAGAGG + Intergenic
985144932 4:186886703-186886725 TGCCAGAGAGATGACTGTGGTGG + Intergenic
986457662 5:7936135-7936157 TGCTAAGAAGATCACATTGCTGG + Intergenic
988736938 5:34031987-34032009 TGCCTGAAAGATCAATTAGGGGG - Intronic
988868375 5:35360617-35360639 TGTTTGATAGTTCACTTTGGAGG - Intergenic
989719500 5:44507909-44507931 TCCTGGAAAGATGACTTTTGTGG + Intergenic
990982138 5:61611462-61611484 TGCTTGAAATCTCACTCTGGCGG - Intergenic
991244794 5:64499009-64499031 TTCCAGAAAGATTATTTTGGGGG + Intergenic
996264575 5:121522547-121522569 TTCCAGAATGATCACTTGGGTGG + Intergenic
996931169 5:128890115-128890137 TGCTACAGAGAACAGTTTGGAGG - Intronic
998065839 5:139157789-139157811 TGGGAGAAAAATCAGTTTGGTGG + Intronic
999503036 5:152165731-152165753 TGCTAGATATCTCCCTTTGGTGG - Intergenic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
1000005582 5:157180828-157180850 TGATAGAAAGATAACGTTGAAGG + Exonic
1004333407 6:14741946-14741968 TGGTAGCAAGATCGCTCTGGGGG - Intergenic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1007840756 6:44714123-44714145 TGCTAACACCATCACTTTGGGGG + Intergenic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1011255156 6:85413463-85413485 TGCTATAGAGATCAATTTTGTGG + Intergenic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1011894837 6:92212658-92212680 TGCTATAAATATCAATTTGCGGG - Intergenic
1013228887 6:108143391-108143413 GGCCAGAAAGATCAGTTTAGGGG - Intronic
1014100940 6:117511017-117511039 TGCTTGTAAGATCACTTAGCGGG + Intronic
1014378467 6:120708004-120708026 TAGTAGAATGATGACTTTGGTGG + Intergenic
1015099421 6:129457977-129457999 TGCTAATACCATCACTTTGGCGG + Intronic
1016012339 6:139150439-139150461 TGATCTAAAGATGACTTTGGGGG + Intronic
1016567225 6:145469594-145469616 TACTATAAAGAACAGTTTGGAGG + Intergenic
1018167798 6:161115964-161115986 TTTTAGAAAGATCACTCTAGAGG + Intronic
1021848250 7:24783612-24783634 TTTTAGAAAAATCACTCTGGTGG + Intergenic
1023156839 7:37259833-37259855 ACCTAGAAAGATCATTTGGGTGG - Intronic
1023356870 7:39375830-39375852 TGGCAGAAAGAGCAATTTGGGGG + Intronic
1024468609 7:49741602-49741624 TGCTTGTCAGATAACTTTGGTGG + Intergenic
1024535319 7:50426196-50426218 TGCTAGAAATATCATTTTACTGG + Intergenic
1026216900 7:68357702-68357724 TTTTAGAAAGATCATTTTGTTGG + Intergenic
1027743186 7:82038774-82038796 TTTTAGAAATATCACTTTAGAGG + Intronic
1029882919 7:103835879-103835901 TTTTAGAAAGATCACTCTGGTGG - Intronic
1031063978 7:117084239-117084261 TGTTAGAAAGATGACTCAGGTGG + Intronic
1031192283 7:118568446-118568468 TTATAAAAAGATCACTTTAGGGG + Intergenic
1032331476 7:130984981-130985003 GGCTAGAGAGATCGTTTTGGAGG - Intergenic
1032809746 7:135400314-135400336 TTTTAGAAAGATTAATTTGGTGG + Intronic
1033032128 7:137837520-137837542 TTCTAGAACCATCACATTGGGGG - Intronic
1033258605 7:139822884-139822906 TTCTAGAAATATCACTCAGGAGG - Intronic
1034166898 7:149032197-149032219 TTTTATAAAGATCACTCTGGGGG + Intergenic
1035961147 8:4139686-4139708 TGTTAGAATGATGATTTTGGTGG + Intronic
1036518695 8:9469921-9469943 GGCAAGAAAGAACACTATGGAGG + Intergenic
1037437665 8:18880399-18880421 TGTTAGAAAGCTCGCCTTGGTGG + Intronic
1037515659 8:19628917-19628939 TGCCAGAAAGATCACTTCCCAGG - Intronic
1037620410 8:20558557-20558579 TGCTAGCAAGATCAGATTGTGGG - Intergenic
1039195572 8:35027514-35027536 TGGTAGAAAGATAGCTATGGGGG + Intergenic
1041974871 8:63786377-63786399 TGCTAGAAAAATACTTTTGGTGG + Intergenic
1042604057 8:70528491-70528513 TGTTAGAAAGGTCACTCTGGTGG + Intergenic
1044494887 8:92865303-92865325 TGCTTGAAAGCTCCCTTTGGGGG - Intergenic
1046207721 8:111023393-111023415 TGCTATAAAGATCATTCTAGTGG - Intergenic
1046252300 8:111648176-111648198 GGTTAGACAGATGACTTTGGAGG - Intergenic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1047897809 8:129385959-129385981 TGCAAGAGACATCCCTTTGGCGG + Intergenic
1050274885 9:3986416-3986438 TGCTTGAGAGATCACAGTGGGGG - Intronic
1051222938 9:14869321-14869343 TGGTTGAAAGATCCCTTTGTTGG - Intronic
1053391459 9:37739390-37739412 TTTGAGAAAGATCACTCTGGAGG + Intronic
1058489424 9:105480730-105480752 TGCTAGATAGGTCAGTTTTGTGG + Intronic
1060580638 9:124742968-124742990 TTCTAGAAACTTCCCTTTGGGGG + Intronic
1187367891 X:18679471-18679493 TGCTAGTAAGATTACACTGGGGG - Intronic
1188947246 X:36320949-36320971 TGCTATGGAGATCAGTTTGGAGG + Intronic
1189075188 X:37906935-37906957 TTTTAGAAAAATCATTTTGGTGG + Intronic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1191731310 X:64338657-64338679 TCTTTGAAAGATCACTGTGGTGG + Intronic
1192187694 X:68963293-68963315 TGCTATAAAGATCCATTTGCAGG + Intergenic
1192268618 X:69557583-69557605 TGCAAGAAAGGCCACTTTTGGGG + Intergenic
1193742765 X:85238131-85238153 CACTATAAAGAACACTTTGGAGG + Intergenic
1194281096 X:91955419-91955441 TGCTATAAATTTCCCTTTGGCGG + Intronic
1194985118 X:100481774-100481796 TGTTAGATATATGACTTTGGAGG - Intergenic
1195766493 X:108301598-108301620 TGGTGGAAAGAACACTATGGAGG + Intronic
1195918357 X:109957655-109957677 TACTAGACAGAACACTTTAGTGG + Intergenic
1195973368 X:110498295-110498317 TGCTAATAACATCACCTTGGGGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1197450558 X:126609674-126609696 TGCAAGAAAGTTTATTTTGGTGG + Intergenic
1198661942 X:138978749-138978771 TGCTAGCAGTATGACTTTGGAGG - Intronic
1198729807 X:139717116-139717138 TGCAAAAGAGATGACTTTGGTGG + Intergenic
1200385902 X:155890677-155890699 CTTTAGAAAGATCACTCTGGTGG + Intronic