ID: 1196639923

View in Genome Browser
Species Human (GRCh38)
Location X:118047014-118047036
Sequence GTGAGGAATGCAAATACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196639923 Original CRISPR GTGAGGAATGCAAATACAGC AGG Intronic
900521041 1:3105693-3105715 GTTAGGAATGTAATTACTGCGGG - Intronic
901226276 1:7614597-7614619 GTGAGGAATGTTAATAACGCGGG - Intronic
901519583 1:9772947-9772969 CTGAGGAATGTAGAGACAGCGGG - Intronic
902065536 1:13682674-13682696 GTCATGCGTGCAAATACAGCTGG + Intergenic
902277553 1:15350484-15350506 GTGAGGAATGAAACCAAAGCTGG + Intronic
904781865 1:32955931-32955953 GTGAAGAATACAGACACAGCTGG + Intronic
907081791 1:51630145-51630167 CTGAGAAATGCAACTACACCTGG - Intronic
907495421 1:54841043-54841065 GTGAGGAATGGAGAGACAGGAGG + Intronic
909151651 1:72013244-72013266 GTGAGGAATGTAACCACATCTGG - Intronic
909898057 1:81098771-81098793 GTGAGGAAGGCAAGAAAAGCTGG - Intergenic
912243547 1:107937547-107937569 GTGATGAATGCAAAATGAGCAGG + Intronic
914423273 1:147549817-147549839 CTGAGGAAAGCAAACACAGAGGG - Intronic
915926177 1:160021395-160021417 GTGAGGAATGGAACTAAAGTTGG - Intergenic
916074934 1:161195141-161195163 GTGAGGTATGCAAGAATAGCAGG - Intronic
916597280 1:166256825-166256847 GTGAGGAAGACAAAAACAGGAGG - Intergenic
916651995 1:166841196-166841218 CTCAGGAATGCAAACACACCGGG - Intronic
918626946 1:186666861-186666883 GTCAAGAGTGCAAATACAGTTGG + Intergenic
918714737 1:187771244-187771266 GTGAGGTATGGAAATGCAGAAGG + Intergenic
924849744 1:247815004-247815026 GTGTGGAAGGCAAATAGAGTAGG + Exonic
1063388482 10:5632333-5632355 GAGTGGAATGAAAATACAACCGG - Intergenic
1065296336 10:24278681-24278703 GTGGGGACTGCAAATAAAGTGGG + Intronic
1068391673 10:56405912-56405934 ATGAAGAATTCAAAAACAGCAGG + Intergenic
1068466223 10:57396365-57396387 GAGAGTAATGCAAATAAATCTGG + Intergenic
1068747395 10:60548598-60548620 GTGAGGAATGTTAATAAATCAGG - Intronic
1068821795 10:61385782-61385804 TGGGGGAATGGAAATACAGCAGG - Intergenic
1071137218 10:82466627-82466649 GTGATGAATGGAGATCCAGCAGG + Intronic
1071424256 10:85532506-85532528 GAGAGGAAGGCATAGACAGCAGG - Intergenic
1074828038 10:117228638-117228660 GTGAGGAAGGGAAAGACAGAGGG - Intergenic
1076248498 10:128966342-128966364 CTGAAGAATGCTAACACAGCTGG - Intergenic
1076249886 10:128977444-128977466 CTAAGGAAAGAAAATACAGCAGG - Intergenic
1079688588 11:23394198-23394220 GTCAGGAATAAAAATATAGCAGG + Intergenic
1080504492 11:32898999-32899021 GTGAGGGTTGAAAATACTGCAGG - Intronic
1081218943 11:40436811-40436833 TTGAGGACTTCAACTACAGCTGG + Intronic
1082082631 11:48024071-48024093 GGGAGGAATGTGAATACAGGTGG - Intronic
1087133892 11:94694928-94694950 GTGAGGAGTGCAGAGACAGAAGG + Intergenic
1089122210 11:116145394-116145416 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1090824927 11:130378332-130378354 CTGAGGAATGCAACCACACCTGG + Intergenic
1091635036 12:2190637-2190659 GTGGAAAATGGAAATACAGCCGG + Intronic
1092569626 12:9708374-9708396 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1098454932 12:70661450-70661472 GTCAGGAATGCTCATAGAGCAGG - Intronic
1098809344 12:75066337-75066359 TTAAGGATTTCAAATACAGCAGG + Intronic
1098813094 12:75121070-75121092 GTTAGGAATGGAAACACAGAGGG - Intronic
1100231745 12:92615873-92615895 TAGAAGAATGCAAATACAGTTGG - Intergenic
1101455367 12:104825619-104825641 CTGAGAACTGCAAATTCAGCAGG + Intronic
1104337458 12:127912948-127912970 GAAAATAATGCAAATACAGCAGG + Intergenic
1104672145 12:130688281-130688303 GTGAGGAGTTCAGAAACAGCAGG - Intronic
1105915037 13:24906606-24906628 GTCAGGATTGAAAATACAGACGG - Exonic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107245086 13:38284200-38284222 GTCAGAAATGCAAATACTGTTGG - Intergenic
1109152244 13:58859738-58859760 CTGAGAAATGCAAATTCGGCAGG - Intergenic
1111292359 13:86186091-86186113 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1112864532 13:103876862-103876884 GAGAAGAATGCAAATAAAGTGGG + Intergenic
1117682358 14:58217369-58217391 ATCAGAAATGCAAATACGGCTGG + Intronic
1122894468 14:104749506-104749528 GAGAGGAATGCCAGCACAGCTGG + Intergenic
1125122296 15:36176469-36176491 GTGAGGAAGGAAACTACAGAAGG - Intergenic
1127020128 15:54737174-54737196 TTGAGGAGTGAAAAGACAGCAGG + Intergenic
1128735171 15:70049546-70049568 GAGTGGATTACAAATACAGCAGG + Exonic
1130854419 15:87828878-87828900 GTAAGCCATGGAAATACAGCTGG + Intergenic
1132363910 15:101242127-101242149 GGGGAGAATGTAAATACAGCTGG - Intronic
1134389733 16:13808333-13808355 TTGGGGAATGCAAAGCCAGCAGG - Intergenic
1137042985 16:35630622-35630644 CTAAGGAATGCAAAAATAGCAGG - Intergenic
1139392888 16:66616619-66616641 GTGAGGAAGGCAAATACTCAGGG - Exonic
1143462587 17:7113820-7113842 ATGAGGAATGCAGATTCAGCTGG - Intronic
1144878484 17:18417047-18417069 GTTAGGAATGTAAATACTGAAGG + Intergenic
1144878630 17:18418809-18418831 GTTAGGAATGTAAATACTGAAGG - Intergenic
1144885267 17:18454192-18454214 GTTAGGAATGTAAATACTGAAGG - Intergenic
1145127484 17:20314244-20314266 GTCTGAAATGCAAATGCAGCTGG + Exonic
1145146950 17:20490184-20490206 GTTAGGAATGTAAATACTGAAGG + Intergenic
1145153750 17:20527340-20527362 GTTAGGAATGTAAATACTGAAGG - Intergenic
1146819948 17:35976969-35976991 GTGAGGAATTGAAAGAGAGCAGG + Exonic
1148023002 17:44566023-44566045 CTGAGAACTGCAAATTCAGCAGG - Intergenic
1149868754 17:60164846-60164868 GAGAGGAATGCAGAAACATCCGG + Intronic
1150064785 17:62099885-62099907 GTCAGAAATTCAAATTCAGCCGG - Intergenic
1152288142 17:79424206-79424228 GTGAGGAATGAACACACAGTAGG + Intronic
1154390679 18:13933877-13933899 GAGAGGACTGGAAATACAGATGG + Intergenic
1156436855 18:37140379-37140401 TTAAGGAATGCAAATACATATGG + Intronic
1156710683 18:39941234-39941256 GTGAGCAATAGAAAGACAGCTGG + Intergenic
1157743612 18:50115416-50115438 GTGAGGAATGCAAGTTCTGCAGG - Intronic
1157812292 18:50705840-50705862 GCAAGGAATGGAAATAAAGCAGG - Intronic
1157965126 18:52200402-52200424 GTGCTGAATGAAAATACAACTGG - Intergenic
1159577516 18:70197952-70197974 GTGGGGAATGCAAAATCAACAGG - Intronic
1160302589 18:77698555-77698577 GTGAGGAATACAAAAAAAGATGG - Intergenic
1161325058 19:3659581-3659603 GTGGGGAGTGAAAACACAGCTGG - Intronic
1167077021 19:47256491-47256513 GTGAGGAAGGGAAATAAAGAGGG - Exonic
1167688826 19:50972925-50972947 ATGAGTAATCCAACTACAGCAGG - Intergenic
926131951 2:10308708-10308730 GTGAGGAACACAACTTCAGCTGG - Intronic
926360408 2:12081442-12081464 TTGAGGCAGGCAAATACAGCAGG + Intergenic
926425247 2:12733953-12733975 GTGAGGAAGCCAAAAGCAGCAGG - Intronic
927902519 2:26831027-26831049 GTCAGGAATGGACAAACAGCTGG - Intergenic
928422035 2:31144874-31144896 GTGAGGAATACAAATAAATAAGG + Intronic
929236317 2:39608902-39608924 ATTTGGAATGCAAATACTGCTGG - Intergenic
930021676 2:47005400-47005422 GTGAGAATTGCAAACACACCAGG + Intronic
932820541 2:74895900-74895922 CTGAGGAATGCAACCACAGCTGG + Intergenic
932821067 2:74901119-74901141 CTGAGGAATGCAACCACACCTGG + Intergenic
933422401 2:82066382-82066404 GTGAGGAGTGAAAATGCAGGGGG - Intergenic
933782874 2:85814016-85814038 GGGAGGGATGCATATACAGGTGG + Intergenic
934094626 2:88588866-88588888 CTGATGACTGCAGATACAGCTGG + Exonic
936831403 2:116652829-116652851 GTGAAGAATACAAATATAGGAGG + Intergenic
938203542 2:129397871-129397893 GTTTGGAATGCAAATAGAGAAGG - Intergenic
939601096 2:144191031-144191053 TTGAGGAATATAAATGCAGCAGG - Intronic
943058095 2:183008540-183008562 TTGGTGAATGCAAACACAGCAGG - Intronic
943829597 2:192443310-192443332 GGGAGGAGTCCAAATACAGTAGG - Intergenic
945660855 2:212683519-212683541 GTGAGTCATGCAGATACAGGGGG - Intergenic
1168751534 20:285308-285330 GTGAGGACTGAGAGTACAGCTGG - Intronic
1170617296 20:17964243-17964265 GTGAGGAATACAAATCCAGATGG - Intronic
1171309260 20:24133182-24133204 GGGAGGAGTGCAAAAAAAGCAGG + Intergenic
1175252435 20:57617447-57617469 GTGAGCCATGCAAGCACAGCAGG - Intronic
1177189199 21:17831040-17831062 GTCAGCTATGCAAATACTGCAGG + Intergenic
1179315444 21:40240077-40240099 GTGAGAAATGCAAATTCCCCTGG - Intronic
1183573094 22:38668972-38668994 GTGAGAGATGCAGATACACCTGG + Intronic
1183971418 22:41480371-41480393 GTTAGGCATTCAAATACAGAAGG + Intronic
1184699133 22:46157981-46158003 GTTAGGAAGGCAAATACAGAAGG + Intronic
1184871142 22:47239226-47239248 GTGTGGAGTGCAATTACAGCAGG + Intergenic
1185228301 22:49666230-49666252 GTGAAGAATGATAGTACAGCTGG + Intergenic
950722102 3:14890789-14890811 GAGAGTGTTGCAAATACAGCCGG + Intronic
954143024 3:48620143-48620165 GTGAGGAAGGGAAATCCAGGTGG - Intergenic
957990785 3:87625178-87625200 GTGAAGGAAGCAGATACAGCAGG + Intergenic
958872799 3:99580791-99580813 ATGAGGAAAGAAAATAAAGCTGG - Intergenic
960071900 3:113440563-113440585 GTGAGGACTGGAACTACAGAGGG - Intronic
961960336 3:130848078-130848100 GAGAGAAATACAAATACAGATGG - Intergenic
962451418 3:135520500-135520522 TTGAGGAATGCAGATAGGGCAGG - Intergenic
962930288 3:140029672-140029694 ATGAGAAATGCTTATACAGCAGG + Intronic
967452869 3:189646762-189646784 GTGAGAAAAGCAAATAAATCTGG + Intronic
970254654 4:14154859-14154881 GTGAGGAAGGGGAATACAGTAGG - Intergenic
971173793 4:24261510-24261532 GTGAAAAATGGAAATAAAGCAGG - Intergenic
973643725 4:52929208-52929230 GTGAGGAAGGCAGATTCATCTGG + Intronic
977224279 4:94375850-94375872 GTCAGGAATGCAAAGGCAGTGGG - Intergenic
977729049 4:100330388-100330410 GTGAGGAAAGCATATACAAAAGG + Intergenic
978979390 4:114923198-114923220 TTGAGGAAAGCAAATACTTCTGG - Intronic
979154005 4:117359094-117359116 CTGAGGAATGCAACCACATCTGG + Intergenic
981916191 4:150035850-150035872 GTGAGGAATTCAAGACCAGCTGG - Intergenic
983402497 4:167282689-167282711 CTGAGTAATGCACATACACCAGG - Intergenic
984305667 4:177986384-177986406 GTGAGGCCTGCAAATAGAGCTGG - Intronic
986369622 5:7067141-7067163 GTGAGCTCTGAAAATACAGCTGG - Intergenic
989059898 5:37400142-37400164 GTTAGGAATGCAAGACCAGCTGG - Intronic
990269257 5:54117141-54117163 ATGAGGCCTGCAAATATAGCAGG + Intronic
991125410 5:63064271-63064293 GTGAGGAAAGCAAGTACGGATGG - Intergenic
991657999 5:68922386-68922408 CTGAGGAATGCAACCACACCTGG + Intergenic
996581258 5:125034711-125034733 GTGGGGAATACCAATAAAGCTGG + Intergenic
997410606 5:133687940-133687962 GTCAGGAATGCAAACATAGTGGG - Intergenic
998514781 5:142743069-142743091 GTTATAAATGCAAATAAAGCTGG + Intergenic
999483819 5:151972947-151972969 GTGAGGAATGAAGATAGATCAGG + Intergenic
1000215896 5:159155747-159155769 GTGAGGATTAAAAATACAGATGG + Intergenic
1001784199 5:174397596-174397618 GTTAGGAAAGCAAATGTAGCAGG + Intergenic
1002842954 6:921947-921969 CTGAGAACTGCAAATTCAGCAGG + Intergenic
1004587024 6:17012574-17012596 GTAAGGAATGCTAAGAGAGCTGG - Intergenic
1005270369 6:24157279-24157301 GTCAGAAATGCAAATGCAGAAGG + Intergenic
1006702095 6:35983763-35983785 GTCAGGAATTCAAGAACAGCCGG - Intronic
1007889967 6:45280009-45280031 GTGGGGATTGAAAATAAAGCTGG - Intronic
1009602214 6:65816310-65816332 GTGTAAAATGCAAATACAGCTGG - Intergenic
1009791750 6:68410983-68411005 GATTGGAATGCAAATAGAGCAGG + Intergenic
1010051819 6:71513442-71513464 GTGTGGAATGTGAATAAAGCTGG + Intergenic
1010124621 6:72417706-72417728 GGGAGGAAAGGAAATTCAGCTGG - Intergenic
1010648921 6:78427586-78427608 CTGAGGAATGCAAAGACAGCTGG + Intergenic
1011224307 6:85090129-85090151 GTGAGGCAAGCAGAGACAGCTGG - Intergenic
1011991837 6:93530529-93530551 ATGCTGAATGCAAATACAGTTGG + Intergenic
1012020718 6:93915532-93915554 CTGAGGAATGCAACCACACCTGG + Intergenic
1015435839 6:133186684-133186706 ATGAGGAATGGTAATACAGTTGG + Intergenic
1015489239 6:133806686-133806708 ATGAGGAAAGCAAGTACACCAGG + Intergenic
1018936398 6:168276531-168276553 GTGAATAATTCAAATACAGCAGG - Intergenic
1019652026 7:2165040-2165062 GTGGGCAATACAAATACGGCTGG + Intronic
1020980178 7:15057111-15057133 GAGAGAAATGTAAAGACAGCGGG - Intergenic
1021112249 7:16708803-16708825 GAGAGGAATGCTCAAACAGCAGG + Intergenic
1022323396 7:29308218-29308240 CTGAGGAATGGAAAGACAGCTGG - Intronic
1022703619 7:32783645-32783667 GAGATGAATGCCAAGACAGCTGG + Intergenic
1023310131 7:38877984-38878006 GTGAGGATTGGAGATACAGTGGG - Intronic
1024751366 7:52469389-52469411 GTGAGGAATGCAACTAGATTAGG + Intergenic
1028545070 7:91988966-91988988 GTGAGGTATGCAAATATATCAGG - Intronic
1031841446 7:126744759-126744781 GTGAGGAATGTAAAGAAATCTGG - Intronic
1034585743 7:152090802-152090824 CTGAGGAAAGAAAATAAAGCAGG - Intronic
1035879732 8:3232710-3232732 GAGAGAAATCCAAATAGAGCAGG - Intronic
1037562414 8:20086968-20086990 ATGAGGAATGCAGATATACCAGG + Intergenic
1040002557 8:42590967-42590989 ATGAAGAAGGCACATACAGCAGG - Intergenic
1040462915 8:47666638-47666660 GAGAAGAATGCAAATAGAACAGG + Intronic
1040644629 8:49383921-49383943 GACAGGAATGCACAGACAGCAGG + Intergenic
1041576713 8:59405688-59405710 GTGTGGCATGCAACTAAAGCAGG - Intergenic
1045329695 8:101144583-101144605 GTGAGGAATGCAAGGACACATGG - Intergenic
1051001231 9:12285321-12285343 CTGAGGAATGCTAACACACCTGG + Intergenic
1051229865 9:14944841-14944863 ATTAGGAATGCAAATACATAAGG + Intergenic
1052298994 9:26932324-26932346 GTTAGGTATACAAATACAGGTGG - Intronic
1052669101 9:31532742-31532764 GTGAGGAAGGCATATAAAGCTGG + Intergenic
1052767780 9:32659409-32659431 GTTAGGAATCCAAATTCAGGAGG + Intergenic
1052819898 9:33130157-33130179 GTAAGGAATGCAGGCACAGCTGG - Intronic
1052960152 9:34288744-34288766 CTGAGGAATGCAAATATACAGGG + Intronic
1057950389 9:99365163-99365185 ATTTGAAATGCAAATACAGCCGG + Intergenic
1058022663 9:100105773-100105795 GTGAGGAAGGAAAAGACAGAAGG - Intronic
1058115068 9:101076119-101076141 GTGAGTAATGCAAATTCTCCAGG + Intronic
1058985792 9:110207588-110207610 GGGAGAAAAGCAAACACAGCTGG + Exonic
1188027079 X:25221046-25221068 TTGAGGGATGCATAGACAGCTGG - Intergenic
1188276311 X:28205926-28205948 GTGAAGGAAGCAAATACGGCAGG + Intergenic
1188448790 X:30286828-30286850 GTGAGTAAAGCAAGAACAGCAGG - Intergenic
1188704497 X:33309174-33309196 GTGAATTATGCAAATGCAGCAGG - Intronic
1189283139 X:39833229-39833251 GTGAATAATTCAAATACAGGAGG - Intergenic
1191714383 X:64184316-64184338 CTCAGGAATGCATCTACAGCAGG + Intergenic
1194726522 X:97404193-97404215 GCCAGGAATACAAGTACAGCTGG - Intronic
1196639923 X:118047014-118047036 GTGAGGAATGCAAATACAGCAGG + Intronic
1202160556 Y:21930856-21930878 GTGTGGAAGGCAGAGACAGCTGG + Intergenic
1202230800 Y:22655519-22655541 GTGTGGAAGGCAGAGACAGCTGG - Intergenic
1202312358 Y:23540646-23540668 GTGTGGAAGGCAGAGACAGCTGG + Intergenic
1202558445 Y:26129948-26129970 GTGTGGAAGGCAGAGACAGCTGG - Intergenic