ID: 1196645714

View in Genome Browser
Species Human (GRCh38)
Location X:118116241-118116263
Sequence TCTTCTAGGACCCCAGAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196645714_1196645721 4 Left 1196645714 X:118116241-118116263 CCGGGTTCTGGGGTCCTAGAAGA 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1196645721 X:118116268-118116290 AGGCGTCCGACGGAGCCAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 36
1196645714_1196645724 17 Left 1196645714 X:118116241-118116263 CCGGGTTCTGGGGTCCTAGAAGA 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1196645724 X:118116281-118116303 AGCCAGAGGGACCGGCAGAAAGG 0: 1
1: 0
2: 1
3: 23
4: 236
1196645714_1196645722 9 Left 1196645714 X:118116241-118116263 CCGGGTTCTGGGGTCCTAGAAGA 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1196645722 X:118116273-118116295 TCCGACGGAGCCAGAGGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 90
1196645714_1196645727 27 Left 1196645714 X:118116241-118116263 CCGGGTTCTGGGGTCCTAGAAGA 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1196645727 X:118116291-118116313 ACCGGCAGAAAGGGATGCGAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1196645714_1196645725 18 Left 1196645714 X:118116241-118116263 CCGGGTTCTGGGGTCCTAGAAGA 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1196645725 X:118116282-118116304 GCCAGAGGGACCGGCAGAAAGGG 0: 1
1: 0
2: 0
3: 21
4: 240
1196645714_1196645717 -6 Left 1196645714 X:118116241-118116263 CCGGGTTCTGGGGTCCTAGAAGA 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1196645717 X:118116258-118116280 AGAAGAACCCAGGCGTCCGACGG 0: 1
1: 0
2: 0
3: 6
4: 77
1196645714_1196645720 3 Left 1196645714 X:118116241-118116263 CCGGGTTCTGGGGTCCTAGAAGA 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1196645720 X:118116267-118116289 CAGGCGTCCGACGGAGCCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196645714 Original CRISPR TCTTCTAGGACCCCAGAACC CGG (reversed) Intronic
901164340 1:7207079-7207101 TCCTCTAGGAGGCCAGTACCAGG - Intronic
902533027 1:17102710-17102732 TCTTTTAGGGCCACAGAGCCTGG + Intronic
906214167 1:44029709-44029731 TCTTCTGTGTCCCCAGAGCCGGG + Intronic
907144256 1:52218509-52218531 TCTTCCAGCACCCCACAGCCTGG - Intronic
907908345 1:58805570-58805592 TCTGCTGTGTCCCCAGAACCTGG + Intergenic
910144622 1:84065077-84065099 TGTTCAGGAACCCCAGAACCAGG - Intergenic
914261065 1:145999604-145999626 TCTTCTTAGACCCAAGAACTGGG - Intergenic
916023474 1:160814404-160814426 TCATCTGTGACCCCAGATCCAGG + Exonic
916915051 1:169397449-169397471 TCTTGTAGGATCCCATAAGCAGG - Intronic
917674449 1:177305589-177305611 TCTTCTTCGACCCCAGAAAGTGG - Intergenic
917685752 1:177414150-177414172 TATGCTAGGACCCCAGACTCTGG - Intergenic
918450142 1:184650007-184650029 TCTCCCAGGACCCTAGAGCCAGG + Intergenic
923633746 1:235674023-235674045 TCTTCCAAGACCCCACAGCCCGG + Intronic
924876890 1:248115783-248115805 TCTTCCAAGACCCCACAGCCTGG - Intergenic
1063545871 10:6980928-6980950 TTTTCTCGGACACCAGACCCAGG - Intergenic
1064682296 10:17822885-17822907 TCTTCGAGGATCCCTGAAGCTGG - Intronic
1065254205 10:23848999-23849021 TTTTCTATTTCCCCAGAACCTGG + Intronic
1065457769 10:25925568-25925590 ACTTCTGAGACCCAAGAACCAGG - Intergenic
1066439170 10:35421459-35421481 TATTCTAGAACCCCCGACCCAGG + Intronic
1067026921 10:42850671-42850693 TCTTCAAGGACGCCTGAACTTGG - Intergenic
1069593725 10:69657124-69657146 GCTTCTGGGCCCCCAGACCCAGG + Intergenic
1069624238 10:69857641-69857663 TCTTCTAGGAAACCAGTCCCTGG + Intronic
1072391598 10:94993031-94993053 TCTTCCAGAACCCCACAGCCTGG - Intergenic
1072448325 10:95518728-95518750 TCTACTAGGCCCCCTGAAACTGG + Intronic
1073638884 10:105229719-105229741 TACCCTAGGACCCCAGACCCTGG - Intronic
1074411813 10:113235230-113235252 TCTTCTCTGGCCCCAGCACCGGG - Intergenic
1074979502 10:118608416-118608438 CCTTCTGGGAGCCCAGAACTCGG - Intergenic
1076177371 10:128378404-128378426 TCATTTAGGACCCCAGACCCAGG - Intergenic
1078366017 11:10707089-10707111 TCTTTGAGGACCTCACAACCAGG - Intergenic
1079656703 11:22994226-22994248 TCTTCCAGAACCCCACAGCCTGG - Intergenic
1081268672 11:41058159-41058181 TCTTCAGGGACCCCAGACCTGGG + Intronic
1081989496 11:47330189-47330211 TGCTCTAGGAGCCCAGAACAGGG - Intergenic
1084371327 11:68746343-68746365 TTTTCTAGGACCCTAAAAGCAGG - Intronic
1085152101 11:74260421-74260443 GATTCTAGAACCCCAGAATCTGG + Intronic
1085644352 11:78213535-78213557 TCCTCTAGGTCCCCAGGGCCTGG - Intronic
1086364679 11:86096766-86096788 TATTCTGGGATCTCAGAACCAGG - Intergenic
1088582409 11:111328753-111328775 TCTTCTTAGAACCAAGAACCAGG + Intergenic
1091030502 11:132183230-132183252 TCTTCAAGGACCCAGAAACCTGG + Intronic
1091039748 11:132265934-132265956 TCTTCTAGGAACCCTGAACCTGG - Intronic
1091670668 12:2449951-2449973 TTTTCTGGGGCCACAGAACCAGG - Intronic
1099493757 12:83318997-83319019 TCTTCTGGGACCCCTGTACTTGG - Intergenic
1100328723 12:93566390-93566412 ACTTCTGGGACCCAAGAACATGG - Intergenic
1100459033 12:94780372-94780394 CCTCCCAGGACCCCACAACCTGG + Intergenic
1104889087 12:132131372-132131394 ACTTCAAGGACCCCAGTGCCAGG - Intronic
1105584931 13:21735182-21735204 TCATCTTTGACCCCAGAACCAGG + Intergenic
1108720023 13:53121517-53121539 TCTTATAGGACTCCTGAGCCAGG + Intergenic
1118316382 14:64728613-64728635 ACTGCCAGGACCCCAGAAGCTGG - Intronic
1118679816 14:68228940-68228962 TCATCTGGGACCCTAGAAACTGG + Intronic
1119705729 14:76781541-76781563 CCTCCTAAGACTCCAGAACCAGG - Exonic
1120968674 14:90189969-90189991 TTTTCTAGAACCCAAGAAGCAGG + Intergenic
1122382891 14:101322364-101322386 TCTTCCAGAACCCCACAGCCTGG + Intergenic
1122773021 14:104105576-104105598 TCCTCCTGGGCCCCAGAACCCGG - Intronic
1202887988 14_KI270722v1_random:126717-126739 TCATATAGGACTCCAGAACATGG - Intergenic
1126765683 15:52008819-52008841 TCTTCCAGGACACCAGACCTAGG + Intronic
1128575475 15:68771557-68771579 TCTTCCTGGGCCCCAGAGCCTGG + Intergenic
1129335666 15:74850837-74850859 TTTTCTGGGACCTCAAAACCAGG + Intronic
1129877574 15:78986160-78986182 TCTTCAAGGACTCCATCACCTGG + Intronic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1130903755 15:88225938-88225960 TCTGCTCAGACCCCAGACCCTGG + Intronic
1131220423 15:90579377-90579399 TCTTCCTTGACCCAAGAACCAGG - Intronic
1132246901 15:100304276-100304298 TCTTCTGGGACCCCGTAACATGG + Intronic
1132918592 16:2369463-2369485 TCTTAGAGGACCCCAGAACCAGG + Intergenic
1133743365 16:8668444-8668466 TCTTCTAGGAGCCTAGCACGAGG + Intergenic
1133955861 16:10443385-10443407 TCTTCTAGCACCCCACAGCCTGG - Intronic
1134040810 16:11066830-11066852 TTTTCCAGGCCCCCAGACCCTGG - Intronic
1134257194 16:12622126-12622148 TCTGGTAGGACCACAGACCCTGG - Intergenic
1135091678 16:19522704-19522726 TCTTCCAGTCCCCCAGAATCTGG - Intergenic
1140039795 16:71398678-71398700 TCTTCTAGAACCCCAGCCCAGGG + Intergenic
1140121052 16:72083237-72083259 TCTTCCAGCACCCCACAGCCTGG + Intronic
1141019915 16:80485436-80485458 TCTTCTGGGACACCAGGCCCAGG + Intergenic
1141127081 16:81408493-81408515 ACTTCCAGAACCCGAGAACCTGG + Intergenic
1144621266 17:16820020-16820042 TCGTCCAGCACCCCAGCACCTGG + Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145312156 17:21706647-21706669 CCTCCTAGGACCCCAGTAGCAGG + Intergenic
1145722248 17:27083891-27083913 TCTTCTTGGCCCCCACAGCCAGG + Intergenic
1147988829 17:44321305-44321327 TGTTCTAGGTCCCCAGACCTGGG - Intronic
1151442085 17:74136009-74136031 TCTTGTAGGAAACCTGAACCCGG - Intergenic
1155784177 18:29876741-29876763 TCTTCTAAGGCCCCAGAGCCTGG + Intergenic
1155839917 18:30631702-30631724 TCATCTAGGACCCCTGACGCAGG - Intergenic
1155958611 18:31975050-31975072 TCTTCCAAGACCCCACAGCCTGG - Intergenic
1156898824 18:42276970-42276992 TCATCTAGGAACCTGGAACCTGG - Intergenic
1157437680 18:47684551-47684573 TCTTCTAGGTCTCCAGCACATGG + Intergenic
1157783194 18:50458242-50458264 TCTTCTTGGGCCCCAGACCAGGG - Intergenic
1159280860 18:66283505-66283527 CTTTCTAGGACCTCATAACCTGG + Intergenic
1162047984 19:8013992-8014014 ACTTCCAGTACCCCAGATCCTGG - Intronic
1163074871 19:14880905-14880927 TCATCCAGGATGCCAGAACCAGG + Exonic
1163117651 19:15197954-15197976 CCTTCTATTACCCCTGAACCTGG - Intronic
1165066946 19:33235120-33235142 CCTTTTAGGACCCCAGGACCTGG - Intergenic
1165160669 19:33813814-33813836 TCTTCTAGGTCCCCAGCTCAGGG + Exonic
1165392974 19:35548931-35548953 TCCTCTGGGTCCCCATAACCCGG - Intergenic
1167049946 19:47072107-47072129 TCTTCTAGGTTCCCTGGACCCGG - Exonic
1202663386 1_KI270708v1_random:93512-93534 TCATATAGGACTCCAGAACATGG - Intergenic
927064256 2:19454681-19454703 TCTTGGAGGACCCCAGATACAGG - Intergenic
927637073 2:24824386-24824408 TCTTCTTGGACCCCAGGAAATGG + Exonic
927954326 2:27198074-27198096 TCTACCAGGACACCTGAACCAGG + Intergenic
928087643 2:28355888-28355910 TCTTCTAGGGTTCCAGAGCCGGG + Intergenic
929173894 2:38958334-38958356 TCCTCTGGGACCCAAGAATCGGG - Intronic
930052969 2:47230672-47230694 TCTCCTAGGAACCCAGAAACTGG + Intergenic
930094684 2:47558209-47558231 TCTTCCAGGAACCCAGAATCTGG + Intronic
931259607 2:60605772-60605794 ACTGCTAGAACCCCAGAAGCTGG - Intergenic
931516144 2:63051673-63051695 TCTTCTGGGACCCAAGACCTGGG - Intronic
933720917 2:85397163-85397185 GCTTCTGGGACCCCTGATCCTGG - Intronic
935117273 2:100147281-100147303 TCCTCCAGGACCCCGGAAACAGG + Intergenic
935560963 2:104559459-104559481 TCCTCCAAGACCCCACAACCCGG - Intergenic
935958801 2:108403684-108403706 TCTTCCAGAACCCCACAGCCTGG + Intergenic
937964259 2:127489524-127489546 TCTTCTAGGAACTCGGAAACGGG + Intronic
939002297 2:136750236-136750258 CCTTCCAGTAACCCAGAACCTGG + Intergenic
940144898 2:150535586-150535608 CCTTCTGTGACCCCACAACCTGG - Intronic
946085919 2:217171435-217171457 TCTTGTAGAACCCCACCACCTGG + Intergenic
946182982 2:217960084-217960106 TCTCCTAGGACCCCAGTACAAGG - Intronic
946325184 2:218981400-218981422 TCTTCTAGGTCTCCAGGTCCCGG - Exonic
946671172 2:222105949-222105971 CCTTCTAGGAGCCCTGAAGCTGG - Intergenic
1168822645 20:785949-785971 TCTTCCAGAACCCCACAGCCGGG - Intergenic
1169081924 20:2802562-2802584 TCATCTAAGACATCAGAACCGGG - Intergenic
1170593178 20:17786669-17786691 TGTTCTAGCACCCCAGAGTCTGG - Intergenic
1171180846 20:23089191-23089213 CCTTCCAGGACCCCAGCTCCCGG - Intergenic
1171258824 20:23712837-23712859 TCTTCTAGGACCTCATGGCCTGG - Intergenic
1172799575 20:37566508-37566530 TCTTCTAGGTGGCCAGACCCAGG + Intergenic
1174259413 20:49282899-49282921 TCTTCCAAGACCCCACAACCTGG - Intergenic
1174446228 20:50593127-50593149 TCTTCTGGGAGCCCAGCTCCGGG + Exonic
1176953497 21:15073005-15073027 TCTTCTAGGACCCAGAAACCAGG + Intergenic
1177989244 21:28018500-28018522 CCTTGTAGGATCCCAGACCCGGG - Intergenic
1180723590 22:17927877-17927899 TCTTGTAGGAGCCCAGCACCTGG - Intronic
1180962898 22:19770332-19770354 GGTTCTAGGACCCCAGGGCCTGG + Intronic
1183060055 22:35330808-35330830 TTGTCTAAGGCCCCAGAACCAGG - Intronic
1183167995 22:36161961-36161983 ACTTCAAGGAGCCCAGCACCAGG + Intronic
949609816 3:5692664-5692686 TCTTCCAGAACCCCACAGCCTGG - Intergenic
950227612 3:11248819-11248841 TCTTCCAGAACCCCACAGCCTGG - Intronic
951024410 3:17814671-17814693 ACTTCTAGGCCTCCAGAACTGGG - Intronic
957712077 3:83874707-83874729 TCTTTTAAGCCCCCAGAATCAGG + Intergenic
957730392 3:84126135-84126157 TCTTCGGGGACCCCAGACCTAGG + Intergenic
958168315 3:89905938-89905960 ACTTCCCAGACCCCAGAACCAGG - Intergenic
959980092 3:112506529-112506551 TCTTCTGGGACCCTGGAAGCAGG - Intergenic
961597274 3:128028383-128028405 TTTTCTACCACCCCAGCACCTGG - Intergenic
967891070 3:194364988-194365010 GCCTCTAGGAGCCCAGCACCTGG + Intronic
968591113 4:1460100-1460122 TCCTCCAGGACCCCAGCCCCAGG - Intergenic
970858706 4:20677545-20677567 TGTTCTAGTACCCAAGACCCTGG - Intergenic
972347234 4:38202762-38202784 TGTTCTAGGTCCCAAGAATCTGG - Intergenic
973981388 4:56310969-56310991 ACTTCTAGGACCCCAAACACAGG - Intronic
975441766 4:74419458-74419480 TCTTCTGGGACACATGAACCTGG + Intergenic
976129756 4:81871501-81871523 CCTTCTAGGAGCCCAGACCTTGG + Intronic
978209374 4:106117011-106117033 TCTTCTAGGAAACCAGTCCCTGG + Intronic
980702011 4:136443064-136443086 TCTTCAGGGAGCCCAGACCCGGG + Intergenic
981497633 4:145411742-145411764 GCCTCTAGGATCTCAGAACCTGG + Intergenic
983069639 4:163253671-163253693 TCTTCCAGGAGCCCAGACCTAGG - Intergenic
983192857 4:164772949-164772971 GCTTATAGGACTCCAGAATCTGG + Intergenic
985730468 5:1544601-1544623 TCTTGTAAGACCCCAGGGCCAGG + Intergenic
987114830 5:14718003-14718025 TCTTCTACGCTCCCAGAACATGG + Intronic
989722836 5:44550464-44550486 AATTCTAGGACCTCAGAACTGGG - Intergenic
990720168 5:58685736-58685758 TCTTCTAGGAGCTCAGAAAATGG + Intronic
991306121 5:65177881-65177903 TCTTCCAGGATTCCACAACCTGG + Intronic
991677800 5:69105976-69105998 TCTTCCAGGAAACCAGACCCTGG + Intronic
992196035 5:74340059-74340081 TCGTCCATGACCCCAGAGCCAGG + Intergenic
994465526 5:100124413-100124435 TCTTTTAAGAACCCAGAAACTGG - Intergenic
998264734 5:140659427-140659449 TCTTACAAGAACCCAGAACCAGG - Intronic
1002396764 5:178963007-178963029 TCTTTTAGTACAACAGAACCAGG - Intronic
1010660571 6:78566393-78566415 TCTTCTAGGACCCAAAAAAAGGG + Intergenic
1010990625 6:82475771-82475793 TCCTCTAGCAACCCAGAAACAGG - Intergenic
1012593171 6:101007995-101008017 TCTTCATGGAACCCAGAACAGGG + Intergenic
1015712345 6:136155846-136155868 ACTTCTAGGACCCTAAAACAAGG - Intronic
1017285963 6:152676875-152676897 TCTTCTGAGACACCAGACCCTGG - Intergenic
1019698155 7:2459519-2459541 TCTTCTCTGAGCCCAGGACCTGG + Intergenic
1021217995 7:17940625-17940647 ACTTGTAGGACCCCGGGACCGGG + Intergenic
1022472502 7:30690486-30690508 TCTTCTGGAATCCCAGAATCAGG - Intronic
1023671245 7:42578985-42579007 TCCTGAAGGACCCCAAAACCAGG + Intergenic
1024251818 7:47511568-47511590 TCTTCTAGGACCCTAGCAGTGGG + Intronic
1026641820 7:72133098-72133120 TCTTCCATGACACCAGACCCCGG + Intronic
1027561137 7:79731947-79731969 TTTTCTTGGACCCTAAAACCAGG + Intergenic
1029420440 7:100469265-100469287 TCCTCTGAGACCCCAGACCCAGG - Intronic
1029865927 7:103628880-103628902 TCTTCTAGGCCCAGAGATCCTGG - Intronic
1032435602 7:131897864-131897886 TATTTTAGGACCCCAGCACTAGG + Intergenic
1034855526 7:154542921-154542943 TCTTCTGCCAGCCCAGAACCTGG + Intronic
1035305099 7:157927009-157927031 TCTTCTGGGACCCCAAAGACAGG + Intronic
1035305144 7:157927189-157927211 TCTTCTGGGACCCCAAAGACAGG + Intronic
1035591049 8:813872-813894 TGTTCTGGGGCCCCAGAAGCAGG + Intergenic
1037275383 8:17172857-17172879 TGCTCTAGGAACCCAGAGCCCGG + Intronic
1038619053 8:29122632-29122654 CGTTTTAGGACCCCAGTACCTGG - Exonic
1041357190 8:57013657-57013679 CCTTCAGGGACCCCAGACCCGGG - Intergenic
1043691831 8:83163570-83163592 TCTTCCATGAAACCAGAACCTGG + Intergenic
1045667698 8:104507762-104507784 TCTTCTGGAACCCCAGAGCTTGG - Intronic
1048687414 8:136919544-136919566 TCTTCTGGGGCCCCAGACCTCGG - Intergenic
1049634690 8:143681279-143681301 ACTTCAAGGAGCCCAGAGCCAGG + Intergenic
1051766240 9:20527142-20527164 TGTTCTAGGAACACAGAACAAGG + Intronic
1055502353 9:76913973-76913995 TCTCCTAGGACCCTAAGACCTGG - Intergenic
1055641315 9:78320737-78320759 TCTTCCAGGAGCCTAGAACAAGG - Intronic
1055645523 9:78358221-78358243 TTTTCGAGGAGCCCAGACCCAGG + Intergenic
1056271589 9:84953067-84953089 TCTACTATGACCTCAGCACCAGG - Intronic
1057266974 9:93623881-93623903 TCGTCTAGGGCCCAAGACCCTGG + Intronic
1058181119 9:101800997-101801019 TTCTCTAGGACCCCAAAACTGGG - Intergenic
1059334518 9:113560446-113560468 GCCTCTAGGACCCTAGCACCTGG - Intronic
1060267541 9:122121176-122121198 TCTTCTAGGGCTCCAGAAGTGGG + Intergenic
1060810642 9:126610051-126610073 TCTCCCAGGACCCTAGACCCGGG + Intergenic
1061521266 9:131119682-131119704 TCTTCTAGCACCCCACTTCCAGG + Intronic
1061786757 9:133033640-133033662 TTTTCCAGGACCCCACAGCCTGG - Intronic
1187020234 X:15373864-15373886 GCTACTTGGACCCCAAAACCAGG - Intronic
1187029158 X:15467866-15467888 GCTTCTAGAACCCCAGGACCAGG + Intronic
1191140275 X:57109101-57109123 ACTTCAAGGAGCCCAGCACCAGG - Intergenic
1191642025 X:63436460-63436482 TCTTCTAGGACCAGAGAAGGAGG + Intergenic
1194750728 X:97681330-97681352 TCCTCTAGGGTCCCAGAACATGG - Intergenic
1196645714 X:118116241-118116263 TCTTCTAGGACCCCAGAACCCGG - Intronic
1201911997 Y:19142219-19142241 TCTTCCAGAACCCCACAATCTGG + Intergenic