ID: 1196645802

View in Genome Browser
Species Human (GRCh38)
Location X:118116649-118116671
Sequence CAGGACAGGGTGAAGTGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196645802_1196645811 -4 Left 1196645802 X:118116649-118116671 CCCGACCACTTCACCCTGTCCTG 0: 1
1: 0
2: 2
3: 36
4: 296
Right 1196645811 X:118116668-118116690 CCTGGCGCAGGCGGAGAGCACGG 0: 1
1: 0
2: 0
3: 32
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196645802 Original CRISPR CAGGACAGGGTGAAGTGGTC GGG (reversed) Intronic
900115102 1:1024981-1025003 CAGGACAGGGTGGCGAGGGCCGG - Intronic
900479930 1:2893160-2893182 CAGGGTAGGGTGGAGTGGGCGGG - Intergenic
900649112 1:3722401-3722423 CTGGGCAGGGGCAAGTGGTCTGG + Intronic
902472350 1:16657548-16657570 CACGACAGGGCTAAGTGTTCTGG - Intergenic
902486454 1:16749898-16749920 CACGACAGGGCTAAGTGTTCTGG + Intronic
902504288 1:16929509-16929531 CACGACAGGGCTAAGTGTTCTGG + Intronic
903356978 1:22754434-22754456 CAGGACAGGGTGACCATGTCCGG + Intronic
903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG + Intronic
904428457 1:30446749-30446771 CACGACAGGGTGAAGGGTTCTGG + Intergenic
906027457 1:42685648-42685670 AAGGAGAGGGTGCAGTGTTCGGG + Intronic
906424090 1:45695207-45695229 CAGGCCAGAGTGTAGTGGTGTGG + Intronic
909584228 1:77271024-77271046 CAGGACAGTGTGAAGTATTATGG - Intergenic
910451969 1:87356348-87356370 CTGGACAGGCTGACTTGGTCAGG - Intergenic
912643840 1:111372420-111372442 CACCACAGGCTGAAGTGCTCTGG + Intergenic
913251317 1:116913801-116913823 CAGGACAGGGTAATGTGTTGAGG + Intronic
913451259 1:118994166-118994188 CAGGACAGTGAGAAATGGTGGGG + Intergenic
914754550 1:150555287-150555309 CAGCACAAGCTGAGGTGGTCAGG - Intronic
914942775 1:152037219-152037241 CAGGACGGGGTGGAGGGGGCCGG - Intronic
915429212 1:155852696-155852718 CAGGCCAGGGTGCAGTGGCGTGG - Intronic
915461597 1:156073842-156073864 CAGGGCAGGGGAAAGTGGTGGGG + Exonic
915631247 1:157155303-157155325 CAGGCCTGGGGGAAGTGGGCAGG - Intergenic
915911835 1:159920267-159920289 CAGGACTGGGTCCAGTGGACTGG - Intronic
916212458 1:162369937-162369959 GAGGACAGGGTGACATCGTCGGG - Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916972987 1:170044071-170044093 CAGGAGAGGGTAAAATGGTCTGG + Intronic
917273641 1:173305952-173305974 CAGGGAAGGGTGATGTGGTTTGG - Intergenic
917454446 1:175174050-175174072 CAGGACTGGGTGAAGCAGGCAGG - Intronic
918143420 1:181736493-181736515 CAGGGCAGGGTGAAGGGGAGAGG + Intronic
918829589 1:189376662-189376684 CAGCATAGAGTGAAGTGGTGTGG + Intergenic
919683010 1:200454706-200454728 CAGGACTGGGGGAAATGTTCTGG - Intergenic
920267466 1:204734723-204734745 CTGGTGAGGGTGAAGAGGTCAGG + Intergenic
920311977 1:205053959-205053981 AAGGAGAGGGTGAAGAGGGCAGG + Intronic
921580869 1:216894724-216894746 GAGAACACGGTCAAGTGGTCAGG + Intronic
921965131 1:221079924-221079946 CAGGACAGGTTGAAATAGGCAGG - Intergenic
922822703 1:228494998-228495020 CAGGGCAGGGGGAAGAGGCCAGG - Exonic
922898593 1:229119273-229119295 CAGGAGAAGGTCACGTGGTCAGG + Intergenic
922975416 1:229779728-229779750 AAGGAGAAGGTGAAGTGGTGGGG + Intergenic
924481558 1:244439776-244439798 CAGCACAGGCTAAAGTGCTCTGG - Intronic
1062923364 10:1296598-1296620 GAGGGCAGGGGGAAGGGGTCAGG + Intronic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1066119954 10:32276465-32276487 CAGGCCAGAGTGCAGTGGTGCGG - Intronic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1066682205 10:37945226-37945248 CAGGGCAGGGTGAAGAGTTTGGG - Intergenic
1066977345 10:42381296-42381318 AAGGACAGGGTGAAGCTGTCAGG + Intergenic
1069071952 10:63998438-63998460 CAGGACAGACTGAGGTGCTCTGG + Intergenic
1070301503 10:75207271-75207293 CAGGACAACTTAAAGTGGTCAGG + Intergenic
1070311401 10:75276288-75276310 GAGGGCAGGGTGAAGCGGTGGGG + Intergenic
1070639706 10:78158838-78158860 CAGGCTAGAGTGAAGTGGTGTGG + Intergenic
1070998770 10:80810986-80811008 CAGGAAAGGGTAAAGTAGTAAGG - Intergenic
1072233988 10:93437795-93437817 CAGGAGAGGGAGAAGTGCTGGGG - Intronic
1072323606 10:94274606-94274628 CAGGACAGCTGGAAGTGGTGAGG + Intronic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1075154201 10:119960663-119960685 AAGCACAGGGTGCACTGGTCAGG - Intergenic
1075227275 10:120640889-120640911 GAGGACTGGGTGAACTGGTAAGG + Intergenic
1077171726 11:1169287-1169309 CTGCACAGGGTGGAGTGGTGGGG + Intronic
1077404376 11:2376649-2376671 CAGAACAGTGTGAAGTGTCCAGG - Intronic
1078844756 11:15111018-15111040 CAGGAGAGGGTGGAGTGGCCTGG + Intergenic
1079792781 11:24760023-24760045 CAGGACAACTTGAAGTGGTGGGG + Intronic
1081577500 11:44328339-44328361 CAGGCCAGGGTGAAGGGGCAGGG - Intergenic
1081645937 11:44790864-44790886 CAGGACAGGGTGACGTGGTGAGG + Intronic
1082937691 11:58671483-58671505 CATGACAGGGACAAGAGGTCAGG + Intronic
1082987428 11:59180628-59180650 CAGGGCAGGGTGGGGAGGTCGGG - Intronic
1083064058 11:59905296-59905318 CAGGCTAGGGTGCAGTGGTGCGG + Intergenic
1083538953 11:63498302-63498324 CACCACAGGGTGAAGTGCTCTGG - Intergenic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1085023922 11:73225593-73225615 CAGGGCAGGAGGTAGTGGTCAGG + Intronic
1086847893 11:91774238-91774260 CACCACAGGCTGAAGTGCTCTGG - Intergenic
1088960933 11:114663535-114663557 CAGGAGATGGTGAAGGGGCCTGG - Intergenic
1090280412 11:125451515-125451537 CAGAACAGGCTGCAGTGGGCGGG + Intronic
1090998235 11:131886166-131886188 CAGGACAGAGTGAACTGGACAGG - Intronic
1093655392 12:21688252-21688274 CAGGACGGGCTGAAGTGCTCTGG - Intronic
1096227438 12:49875418-49875440 CAGGAGAGGGTGAGGGGGTGAGG + Intronic
1097714930 12:62955750-62955772 CATCACAGGCTGAAGTGCTCTGG - Intergenic
1100848982 12:98689528-98689550 CAGGCCGGAGTGCAGTGGTCTGG + Intronic
1101745751 12:107540193-107540215 CAGGTCAAGGTCAGGTGGTCTGG + Intronic
1102217294 12:111170474-111170496 CAGGATAGGGTGATGTGCCCAGG + Intronic
1103011504 12:117461746-117461768 CAGGTGAGGGTGAGGTGGTACGG + Exonic
1105534181 13:21248592-21248614 AAGGGCAGGGGGAAGTGGTGTGG - Intergenic
1106248053 13:27965350-27965372 GGGGGCAGGGTGAAGTGGCCGGG + Intronic
1106304269 13:28495659-28495681 CGGGACAGTCTGAAGGGGTCAGG - Intergenic
1107945737 13:45416361-45416383 CAGGCCGGGGTGCAGTGGTGCGG - Intronic
1108108569 13:47041644-47041666 AAGGACAGGGTGAAGAGGTGTGG - Intergenic
1110173466 13:72530205-72530227 AAGGACATCGTGAAGTGGTCAGG - Intergenic
1110641935 13:77835238-77835260 AAGGACAGTTTTAAGTGGTCAGG - Intergenic
1111018613 13:82415584-82415606 GAGGAAAGGCTGAAGTGGTGTGG + Intergenic
1113014929 13:105818041-105818063 AAGGCCAGGGAGAAGTGGGCAGG + Intergenic
1114388616 14:22281809-22281831 AAGGTCAGGGGGAAGTGTTCAGG + Intergenic
1114702509 14:24693496-24693518 CAAGCCAGGGTGAAGTTTTCAGG - Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1116888399 14:50242668-50242690 AAGGACAGGGTGAAATGGTTGGG - Exonic
1117518147 14:56523183-56523205 CAGGATAGGATGATGTGGTTTGG - Intronic
1118029597 14:61807532-61807554 GAGGACAGGCTCAGGTGGTCTGG - Intergenic
1118439372 14:65798910-65798932 CAGGACACGGTGAAATGGATGGG + Intergenic
1118441256 14:65813784-65813806 CAGGATAACGTGAAGTGGTGGGG + Intergenic
1118612933 14:67555500-67555522 CAGGACAGGGTGGGATGCTCAGG + Intronic
1121975152 14:98396629-98396651 CAGGACAGCATGATGTGGTATGG - Intergenic
1122884313 14:104703823-104703845 CAGGGCAGGGTCAGGTGCTCTGG + Intronic
1123049647 14:105534789-105534811 CAAGACAGGGGGAGGTGGGCAGG + Intergenic
1123117436 14:105900999-105901021 CAGGACAGGGTGGGGTGCCCTGG + Intergenic
1126942329 15:53780501-53780523 CAGGACAGAATGATGTGGTTTGG - Intergenic
1127322841 15:57864187-57864209 CAGAACAGGATGAAATGATCTGG + Intergenic
1127768524 15:62211201-62211223 CCAGAGAGGGTGAAATGGTCTGG + Intergenic
1129116349 15:73367519-73367541 CAGGAGAGGGTCAAGTCGGCCGG - Exonic
1129464345 15:75715608-75715630 CAAGACAGTGGGAGGTGGTCAGG - Intergenic
1129720903 15:77877404-77877426 CAAGACAGTGGGAGGTGGTCAGG + Intergenic
1129804426 15:78443351-78443373 AAGGAAAGGGAGAAGTGGTTGGG + Intronic
1131873036 15:96780051-96780073 CAGGACAGGGGCCAGTTGTCAGG + Intergenic
1132204107 15:99974775-99974797 CATGACAGAGTGTGGTGGTCTGG + Intronic
1132404378 15:101533485-101533507 CAGGGCAGGGAGCAGTGGTGGGG - Intergenic
1133255218 16:4512425-4512447 TAGGGCAGGGTGAAGAGGACAGG + Exonic
1134056520 16:11173711-11173733 CAGGACAGTGTGAGGAGGGCAGG - Intronic
1135770759 16:25216798-25216820 CAGGGCAGGGTGAGGGAGTCAGG - Intronic
1136023884 16:27457461-27457483 GAGGACAGGGTGAACTGGCAGGG + Intergenic
1136117553 16:28104482-28104504 CAGGACTCGCTGCAGTGGTCAGG + Intronic
1136369988 16:29830386-29830408 CAGGGAAGGGTGCAGTGGCCTGG + Intronic
1136624073 16:31451016-31451038 CCGGAGAGGGTGAAGAGGTGGGG - Intergenic
1138273763 16:55716001-55716023 CATGAGTGGGTGAAATGGTCAGG + Intergenic
1138528952 16:57624729-57624751 CAGGACAGGGATAAGGGGTTAGG - Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1139405222 16:66712635-66712657 CAGGGCAGGGTCATGTGGTAAGG - Intergenic
1139429427 16:66903314-66903336 GATGACAGGGTCCAGTGGTCAGG - Intergenic
1139853263 16:69962950-69962972 CAGGCCATGGTGTGGTGGTCAGG - Intronic
1139882234 16:70185859-70185881 CAGGCCATGGTGTGGTGGTCAGG - Intronic
1139953364 16:70682269-70682291 CAGCTCAGGGTGAAGGGGCCTGG + Intronic
1140215467 16:73003798-73003820 CAGAACAGAGTGAGGGGGTCAGG + Intronic
1140370276 16:74409645-74409667 CAGGCCAGGGTGTGGTGGTCAGG + Intronic
1141009049 16:80380332-80380354 CAGGTCAGGGTGACGTGGAAAGG - Intergenic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1144950007 17:18988983-18989005 AAGGACAGGATGAGGTGGTATGG + Intronic
1148360777 17:47010431-47010453 CAGGACAGGGTGGAGAGCACGGG - Intronic
1148661986 17:49341617-49341639 CAGGCCAGAGTGTAGTGGTGTGG - Intronic
1148699333 17:49578496-49578518 CAGGTCAGAGTGAAGTGGCAGGG + Intronic
1150204280 17:63389974-63389996 AAGGACAGGATGAAGGTGTCTGG - Intronic
1150323900 17:64240350-64240372 CAGGACAGGGTGTCGTGGGCTGG - Intronic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151384293 17:73745706-73745728 CAGGACAGTTTGCAGAGGTCTGG + Intergenic
1151705069 17:75763153-75763175 CAGTACAGGGTGAGGTGGGGAGG + Intronic
1151729044 17:75900203-75900225 CAGGCCAGGGGGCAGAGGTCAGG - Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1155655164 18:28184023-28184045 CAGTACAGGGTGAACTGGCCTGG - Intergenic
1156333826 18:36150929-36150951 CAAGAAAGGGTAAAATGGTCTGG - Intronic
1157076181 18:44470289-44470311 AAGGACAGGATGAAGAGGGCAGG + Intergenic
1158171220 18:54602933-54602955 CAGCAAAGGGTGAAGCTGTCTGG + Intergenic
1158272627 18:55733332-55733354 CATGACTGTGTGAACTGGTCTGG + Intergenic
1158493390 18:57930694-57930716 CAGAACAGTGTTAAGTGGTTTGG + Intergenic
1159017167 18:63110636-63110658 CAGGCCTGGGTGATATGGTCTGG + Intergenic
1159222700 18:65485857-65485879 CAGGACAGGGTGCTTTAGTCAGG + Intergenic
1161014746 19:1978128-1978150 CAGGCCATGGTGCAGTGCTCTGG + Intronic
1161106028 19:2444552-2444574 CAGGACAGGGTGAAGCGAGAGGG + Intronic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1162210192 19:9085157-9085179 CAGGGTAGAGTGCAGTGGTCTGG - Intergenic
1162367209 19:10256830-10256852 CAGGACAGGGTGGAGGGGGCGGG + Intronic
1163491115 19:17617669-17617691 CGGGAAAGGGTGATGCGGTCTGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165775087 19:38399481-38399503 CAGTGCAGGCTGAAGTGGTGGGG + Intergenic
1167478372 19:49713670-49713692 CAGGACAGGGGCAACTGGTTTGG + Exonic
1167490618 19:49790872-49790894 CTGGACAGGCCGAAGGGGTCCGG + Intronic
1167837580 19:52086723-52086745 GAGGAAAGTGTGAAATGGTCAGG + Intronic
1168604198 19:57745116-57745138 CAAGAAAGGGTAAAATGGTCTGG + Intronic
1202704744 1_KI270713v1_random:14342-14364 CACGACAGGGCTAAGTGTTCTGG - Intergenic
926984371 2:18605911-18605933 CCGGACTGGGTGAAGAGGACTGG + Intergenic
927123361 2:19989892-19989914 CAGGACCGGGTGAAGGAGCCTGG + Intronic
927150362 2:20192051-20192073 CAGGCCAGGGTGACCAGGTCTGG - Intergenic
928024783 2:27730469-27730491 CGGGACAGGGGACAGTGGTCAGG + Intergenic
928115167 2:28540873-28540895 CAAGAGAGGGTGAAGGGGTTGGG + Intronic
929127216 2:38532932-38532954 AAGGAGAGGGTGAGGTGGACTGG - Intergenic
930543164 2:52733061-52733083 CAGGGCAGGGTGAACAGGTTAGG + Intergenic
932614709 2:73224550-73224572 CAGAACTGAGTTAAGTGGTCTGG + Intronic
934016447 2:87890690-87890712 CAGGACAGTGTGCTGAGGTCTGG + Intergenic
934736991 2:96694495-96694517 CAGGACAGGCGGGGGTGGTCTGG + Intergenic
935339704 2:102048776-102048798 AACGACAAGGTGAAGTGGCCGGG - Intergenic
935496385 2:103787225-103787247 CAGCACAGAGTCAAGTGGTAAGG - Intergenic
935585287 2:104795457-104795479 CAGGCCAGTGTGAACTGGACAGG + Intergenic
937641553 2:124217595-124217617 CAGGATAAGGTGAAGTGGAGGGG - Intronic
938003815 2:127770644-127770666 CAGGCCAGAGTGCAGTGGTGTGG - Intronic
938943181 2:136187190-136187212 GAGGACAGGGTGAATTGATTAGG - Intergenic
939610024 2:144298706-144298728 CAGGAAAGGGAGGAGAGGTCAGG + Intronic
939683425 2:145167956-145167978 GAGGACAGGGTGAAGTTGTCCGG - Intergenic
940275909 2:151940401-151940423 CAGGAAAGGGTTAAGTGTTGAGG + Intronic
940476401 2:154168119-154168141 CTGGCCAACGTGAAGTGGTCTGG + Intronic
941678102 2:168365871-168365893 CAGGACAGAGTGTAATGGGCTGG + Intergenic
942999739 2:182311260-182311282 TGGGACATGCTGAAGTGGTCAGG - Intronic
944975285 2:205042820-205042842 CAGGACAGGGAGAAGGGATGAGG - Intronic
945937213 2:215915001-215915023 CAGGCTAGAGTGAAGTGGTGTGG + Intergenic
946184652 2:217973319-217973341 CAGGGCAGAGTGCAGTGGTGTGG - Intronic
947451484 2:230212801-230212823 CAGGACAGGGTCAGATGGGCTGG + Exonic
947861956 2:233366753-233366775 GAGGACAGTGTGACGGGGTCAGG + Intronic
948514845 2:238497547-238497569 CAGGACAGGCTGAAGTCAGCAGG - Intergenic
948550258 2:238766142-238766164 CTGGGCAGGGGGAGGTGGTCAGG - Intergenic
948699507 2:239751191-239751213 GAGGTCATGGTGAAGTGGCCTGG - Intergenic
948753374 2:240144956-240144978 CAGGACAGGGTGACAGGGGCTGG - Intergenic
948841124 2:240649562-240649584 CAGGACAGGCTGAAGAGGGGCGG + Intergenic
949009801 2:241671975-241671997 CAGGGCAGGGTGAGGAGGGCAGG - Intronic
949047430 2:241878147-241878169 CAGGACAGCGCGGAGTGGGCCGG - Intergenic
1170031398 20:11947863-11947885 CAGGACTGGATGAAGCGGTGTGG + Intergenic
1172241013 20:33412481-33412503 CAGGGCAGGGTGAGGTGGCCAGG + Intronic
1172663205 20:36581517-36581539 CAGGACAGGGTGAGGTGCACTGG - Intronic
1172704390 20:36872408-36872430 CAGGAAAGGGTGAGGTTGTGGGG - Intergenic
1172785593 20:37466314-37466336 CAGGAAAGGGAGAGGAGGTCCGG - Intergenic
1173249829 20:41358573-41358595 CAGGGCAGGGGGACGTGGTAGGG - Intronic
1173861233 20:46285004-46285026 CAGCACTGGGTACAGTGGTCAGG - Intronic
1174848504 20:53967886-53967908 CAGGACAGAGTGAATTGGCCAGG + Intronic
1175031255 20:55956549-55956571 CAGGTGAGGGTGCTGTGGTCAGG - Intergenic
1175777010 20:61659818-61659840 AAGGCCTGGGTGAAGTGGGCGGG + Intronic
1179345370 21:40551258-40551280 CAGGACATCTTGAAGTGGTTGGG + Intronic
1180672488 22:17564231-17564253 CAGGGCAGGCTGAGGTGGTGGGG - Intronic
1184258200 22:43299004-43299026 CAGGCCAGAGTGCAGTGGTGCGG - Intronic
1184309122 22:43629782-43629804 CAGGAAAGGGTGAGGGGGTGAGG + Intronic
1184419559 22:44371768-44371790 CAGGACAGGGTGCAGGTGTCTGG - Intergenic
1184770519 22:46594335-46594357 AAGGACAGGTGGAAGTGGGCGGG + Intronic
1184964965 22:47965011-47965033 AAGCACAGGATGAAGTGGTCAGG - Intergenic
950137591 3:10592646-10592668 CAGGAGAGGTGGAAGTGGTGTGG - Intronic
950219858 3:11186159-11186181 CAGGAAAAGGTGGAGTTGTCCGG - Intronic
950722259 3:14891701-14891723 CAGGACAGGATGAGTTGTTCAGG + Intronic
953374037 3:42413604-42413626 CAGGGCAGGGTGGAGTGTGCTGG + Intergenic
954879228 3:53822646-53822668 CAGGATGGAGTGAGGTGGTCAGG + Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
957907686 3:86578771-86578793 CACTACAGGCTGAAGTGCTCTGG - Intergenic
958712491 3:97734498-97734520 CCTGACAGGCTAAAGTGGTCTGG + Intronic
959681256 3:109099168-109099190 CAGGAAAGGGTCAAGAGGACAGG + Intronic
961010254 3:123430723-123430745 CAGGACAGGGAGATGTCCTCAGG - Intronic
961121255 3:124373096-124373118 CAGGACAGGGGGAGGAGGTTAGG - Intronic
961823519 3:129587160-129587182 CAGGCCAGGCTGATGGGGTCAGG + Intronic
963048614 3:141123609-141123631 CAGGGCAGGGTGAAGTCCTCAGG - Intronic
964559766 3:157981103-157981125 CAGGATATGGTGAAGTGCCCAGG - Intergenic
965518699 3:169650729-169650751 CAGTTCAGGGTGAAGTGTGCTGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967148556 3:186627197-186627219 CTGGGAAGGGTGAAGTGGTCAGG - Intergenic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
971111008 4:23586067-23586089 TAAGGCAGGGTGAATTGGTCAGG + Intergenic
972207717 4:36798220-36798242 CATCACAGGCTGAAGTGCTCTGG + Intergenic
973348463 4:49082412-49082434 CAGGGCAGGCTAAAGTGCTCTGG + Intergenic
976694848 4:87908370-87908392 AAGTACAGGGTGGAGTGGTTCGG - Intergenic
981193165 4:141887049-141887071 CAGGATAGGGTGAATGGGACTGG + Intergenic
982308138 4:153955022-153955044 CAGGTCAGGCTGCAGTGGCCAGG + Intergenic
984099200 4:175465929-175465951 CGAGACAGGGAGAAGTGGTGGGG + Intergenic
986116728 5:4782511-4782533 CAGGAGAGGGGGAAGTGGTGAGG + Intergenic
986871428 5:12051510-12051532 CAGGGAAAGGTGATGTGGTCTGG - Intergenic
988547765 5:32174192-32174214 CAGGTCAGGGCGAAGCGGGCTGG + Exonic
988780860 5:34520831-34520853 GAGGACAGGATAAAGTAGTCAGG - Intergenic
989671763 5:43925377-43925399 GAGGAGAGGGAGAAGTGGTGAGG - Intergenic
991377607 5:65982883-65982905 CAGGACAGGCTGTCTTGGTCAGG + Intronic
994310163 5:98259939-98259961 CACCACAGGCTGAAGTGCTCTGG - Intergenic
995395937 5:111686976-111686998 CAGGACAGGGTGAGCTGCTGTGG - Intronic
995681642 5:114727123-114727145 AAGGTCAGGGTGAAGTGGTGAGG - Intergenic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996760831 5:126984347-126984369 CAGGACAGGGGGATGTGGAAGGG + Intronic
998715582 5:144880371-144880393 CAGGGCAGGGTGAAGAAGTGTGG - Intergenic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002847227 6:957670-957692 CAGGATAGGCTGAAGGGGGCAGG - Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1005449485 6:25958957-25958979 TAGGACAGGGTGGAGTTGTCAGG + Intergenic
1005821941 6:29605879-29605901 CAGGAAAAAGTGATGTGGTCTGG - Intronic
1005987378 6:30883567-30883589 CAGGACAAAGTTGAGTGGTCGGG - Intronic
1006163306 6:32050198-32050220 CAGGACAGGCTGAGGGAGTCGGG + Intronic
1006163930 6:32053588-32053610 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006164557 6:32056786-32056808 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006165556 6:32062357-32062379 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006166507 6:32068590-32068612 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1007361429 6:41359318-41359340 CAGGAGAGGGGGAAGAGGTTGGG + Intergenic
1010089091 6:71958512-71958534 AAGGAATGGGAGAAGTGGTCAGG + Intronic
1011598300 6:89037284-89037306 CACTACAGGCTGAAGTGCTCTGG + Intergenic
1012472452 6:99587675-99587697 CACTTCAGGGTGAAGTTGTCAGG + Intergenic
1013012633 6:106134197-106134219 CAGCACAGGGTGAGCTGCTCTGG + Intergenic
1014097009 6:117471726-117471748 CAAGAGAGGGTAAATTGGTCTGG - Intronic
1014259750 6:119203216-119203238 CGGGACAGGGTGATGTGGAGAGG + Intronic
1015045711 6:128774077-128774099 CAGGAGTGGGTGAAGGGGTCAGG - Intergenic
1016869711 6:148804457-148804479 CATGCAAGGGTGAAGTGGTCTGG + Intronic
1017316751 6:153039841-153039863 CAGGACAGCGTGAAGCAGTGAGG - Intronic
1017598306 6:156053847-156053869 TAGGACAAGGTGAAAGGGTCAGG + Intergenic
1018287651 6:162257931-162257953 AAGGGCAGGGTGGAGAGGTCAGG - Intronic
1019207444 6:170374386-170374408 AAGAACAGGGTGAACTGGTGTGG + Intronic
1019267331 7:125209-125231 CAGCACAGGGTGGAGGGGCCAGG - Intergenic
1019937778 7:4267500-4267522 CCGGAGAGGGCGAAGTGGGCGGG + Exonic
1019999594 7:4747888-4747910 CAGGCCGGAGTGCAGTGGTCCGG + Intronic
1020103267 7:5407395-5407417 CAGGATGGGGTGAAGAGGTTGGG - Intronic
1021202562 7:17742258-17742280 CAGGCCCTGGGGAAGTGGTCAGG - Intergenic
1022726667 7:32987448-32987470 CAGGCTGGAGTGAAGTGGTCTGG - Intronic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1025046918 7:55700185-55700207 CAGGCTGGAGTGAAGTGGTCTGG + Intergenic
1029184745 7:98730482-98730504 CAGGACAGGCTCATGGGGTCAGG + Intergenic
1029248594 7:99220188-99220210 CAGGACAGAGTGGAATGGCCTGG - Intergenic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1031259331 7:119497655-119497677 CAGGCCAGAGTGCAGTGGTGAGG + Intergenic
1032888185 7:136164696-136164718 CAGGCCAGGGAGCAGTGGTGCGG - Intergenic
1033556168 7:142490057-142490079 CAGGACAGGCTGGAGTGGCAGGG + Intergenic
1033558532 7:142509503-142509525 CAGGACAGGCTGGAGTGGCAGGG + Intergenic
1035095895 7:156355148-156355170 CAGGACATGGTGAGATGGCCTGG - Intergenic
1035496228 7:159329180-159329202 CAGGAAAGGGTGAAGTGTGGAGG + Intergenic
1036489585 8:9212534-9212556 GAGGAGAGGGTGAAGTTGACCGG - Intergenic
1039079025 8:33717909-33717931 TGGGCCATGGTGAAGTGGTCGGG + Intergenic
1039897703 8:41727950-41727972 CCGGGCAGGATGAGGTGGTCCGG - Exonic
1040324247 8:46333667-46333689 GAAGGCAGGGTGAAGTGGGCAGG + Intergenic
1042893736 8:73642743-73642765 TAGGACAGGGTGGAGTGGGTTGG + Intronic
1042898292 8:73694980-73695002 CACCACAGGCTGAAGTGCTCCGG + Intronic
1044757553 8:95480760-95480782 CAGCAGGGGGTGAATTGGTCAGG + Intergenic
1044821179 8:96157251-96157273 GAGGATAGGGAGAAGTGGCCTGG + Intronic
1045232702 8:100319878-100319900 CAGGACAGAGTGCAATGGTAGGG + Intronic
1045718270 8:105074454-105074476 CAGGCCAGAGTGAAGGGGTCAGG + Intronic
1045733513 8:105268098-105268120 CATCACAGGCTGAAGTGCTCTGG - Intronic
1046384176 8:113487145-113487167 CAGTACAGGATGAAGGGCTCTGG - Intergenic
1048109163 8:131448305-131448327 CAGGCCAGAGTGCAGTGGTGCGG + Intergenic
1049110564 8:140639860-140639882 CAGGATAGGGTGGAGGGGCCTGG + Intergenic
1049277862 8:141728910-141728932 CACGTCAGGGAGAATTGGTCAGG + Intergenic
1049523905 8:143110964-143110986 CAAGAGAGGGTAAAATGGTCTGG - Intergenic
1049846138 8:144802760-144802782 CAGGAGAGGGTAAAGTGCTAGGG - Intronic
1050019134 9:1265903-1265925 CAGGCCCCGGTGTAGTGGTCTGG + Intergenic
1050986651 9:12091539-12091561 CAGGCCCTGGGGAAGTGGTCAGG + Intergenic
1051137138 9:13935061-13935083 GAGGACAGAGGAAAGTGGTCTGG + Intergenic
1052847703 9:33351748-33351770 CAGGGCAGGGTGAGCTGGTATGG - Exonic
1055131940 9:72785709-72785731 CTGGGCAGGGTGAAGTGGGAAGG + Intronic
1057525501 9:95796050-95796072 CAGGTCAGGGGGAACTGGTCAGG - Intergenic
1058142957 9:101377451-101377473 CAAGAGAGGGTAAAATGGTCTGG + Intronic
1059517931 9:114913186-114913208 CAGGCGAGGGTGGAGTTGTCAGG + Intronic
1061043651 9:128153163-128153185 GAGGCCAGGGTGCAGTGGGCTGG + Intronic
1061664227 9:132151033-132151055 CAGGCCAGAGTGCAGTGGTGAGG - Intergenic
1062285584 9:135771194-135771216 CAGGACAGGGGGAGGTGACCAGG + Intronic
1062591181 9:137275510-137275532 CAGGATAGGGGGAAGTGGCAGGG + Intergenic
1187296975 X:18011678-18011700 CAGGAAGTGGTGGAGTGGTCCGG + Intergenic
1189580013 X:42396198-42396220 CAGGACAGGCTGAAATTGTCAGG - Intergenic
1189625771 X:42895277-42895299 CAGGACGGGGTGAGGTGTCCTGG + Intergenic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1191080843 X:56508135-56508157 GAGGAAAAGTTGAAGTGGTCTGG + Intergenic
1193600490 X:83504254-83504276 CAGGACAGGGAGTAGCGGTGGGG - Intergenic
1193906629 X:87253047-87253069 CAGATCAGGATGAAGAGGTCAGG - Intergenic
1195933505 X:110103390-110103412 CAGGACAGGGTGAATAGTTAAGG + Intronic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1197618681 X:128722253-128722275 CAGGGCAGGGCAAAGTGGTCAGG + Intergenic
1199128039 X:144147850-144147872 CAGGACAGTGTGCTGAGGTCTGG - Intergenic
1199317412 X:146396378-146396400 CAGCACAGGATAAAGTGCTCTGG - Intergenic
1200281019 X:154776960-154776982 CTAGACAGGGTGAAGAGTTCTGG + Exonic
1201127683 Y:10929431-10929453 CAGAACAGGGTGGAGTGGAGTGG - Intergenic