ID: 1196646805

View in Genome Browser
Species Human (GRCh38)
Location X:118126917-118126939
Sequence AACTTAACATTTAAAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196646802_1196646805 17 Left 1196646802 X:118126877-118126899 CCACATTCCTTGTTATTGACAGC No data
Right 1196646805 X:118126917-118126939 AACTTAACATTTAAAAACTGAGG No data
1196646801_1196646805 18 Left 1196646801 X:118126876-118126898 CCCACATTCCTTGTTATTGACAG No data
Right 1196646805 X:118126917-118126939 AACTTAACATTTAAAAACTGAGG No data
1196646800_1196646805 19 Left 1196646800 X:118126875-118126897 CCCCACATTCCTTGTTATTGACA No data
Right 1196646805 X:118126917-118126939 AACTTAACATTTAAAAACTGAGG No data
1196646803_1196646805 10 Left 1196646803 X:118126884-118126906 CCTTGTTATTGACAGCTCTTTTT No data
Right 1196646805 X:118126917-118126939 AACTTAACATTTAAAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196646805 Original CRISPR AACTTAACATTTAAAAACTG AGG Intergenic
No off target data available for this crispr