ID: 1196650397

View in Genome Browser
Species Human (GRCh38)
Location X:118162951-118162973
Sequence AGATGCCTTGTGTTTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196650397_1196650400 17 Left 1196650397 X:118162951-118162973 CCTTGTTCAAACACAAGGCATCT No data
Right 1196650400 X:118162991-118163013 GCCTGATCTACCAAGGTCCCTGG No data
1196650397_1196650398 10 Left 1196650397 X:118162951-118162973 CCTTGTTCAAACACAAGGCATCT No data
Right 1196650398 X:118162984-118163006 CACCTAAGCCTGATCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196650397 Original CRISPR AGATGCCTTGTGTTTGAACA AGG (reversed) Intergenic
No off target data available for this crispr