ID: 1196650398

View in Genome Browser
Species Human (GRCh38)
Location X:118162984-118163006
Sequence CACCTAAGCCTGATCTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196650394_1196650398 21 Left 1196650394 X:118162940-118162962 CCAGGTCCTATCCTTGTTCAAAC No data
Right 1196650398 X:118162984-118163006 CACCTAAGCCTGATCTACCAAGG No data
1196650397_1196650398 10 Left 1196650397 X:118162951-118162973 CCTTGTTCAAACACAAGGCATCT No data
Right 1196650398 X:118162984-118163006 CACCTAAGCCTGATCTACCAAGG No data
1196650395_1196650398 15 Left 1196650395 X:118162946-118162968 CCTATCCTTGTTCAAACACAAGG No data
Right 1196650398 X:118162984-118163006 CACCTAAGCCTGATCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196650398 Original CRISPR CACCTAAGCCTGATCTACCA AGG Intergenic
No off target data available for this crispr