ID: 1196651548

View in Genome Browser
Species Human (GRCh38)
Location X:118173276-118173298
Sequence CTGGATGTTGTTATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196651548_1196651554 -5 Left 1196651548 X:118173276-118173298 CCCTCCTCCATAACAACATCCAG No data
Right 1196651554 X:118173294-118173316 TCCAGCTGTCACTAAAAGGAGGG No data
1196651548_1196651556 6 Left 1196651548 X:118173276-118173298 CCCTCCTCCATAACAACATCCAG No data
Right 1196651556 X:118173305-118173327 CTAAAAGGAGGGAAAGCCAGAGG No data
1196651548_1196651552 -9 Left 1196651548 X:118173276-118173298 CCCTCCTCCATAACAACATCCAG No data
Right 1196651552 X:118173290-118173312 AACATCCAGCTGTCACTAAAAGG No data
1196651548_1196651553 -6 Left 1196651548 X:118173276-118173298 CCCTCCTCCATAACAACATCCAG No data
Right 1196651553 X:118173293-118173315 ATCCAGCTGTCACTAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196651548 Original CRISPR CTGGATGTTGTTATGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr