ID: 1196651552

View in Genome Browser
Species Human (GRCh38)
Location X:118173290-118173312
Sequence AACATCCAGCTGTCACTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196651549_1196651552 -10 Left 1196651549 X:118173277-118173299 CCTCCTCCATAACAACATCCAGC No data
Right 1196651552 X:118173290-118173312 AACATCCAGCTGTCACTAAAAGG No data
1196651548_1196651552 -9 Left 1196651548 X:118173276-118173298 CCCTCCTCCATAACAACATCCAG No data
Right 1196651552 X:118173290-118173312 AACATCCAGCTGTCACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196651552 Original CRISPR AACATCCAGCTGTCACTAAA AGG Intergenic
No off target data available for this crispr