ID: 1196651553

View in Genome Browser
Species Human (GRCh38)
Location X:118173293-118173315
Sequence ATCCAGCTGTCACTAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196651548_1196651553 -6 Left 1196651548 X:118173276-118173298 CCCTCCTCCATAACAACATCCAG No data
Right 1196651553 X:118173293-118173315 ATCCAGCTGTCACTAAAAGGAGG No data
1196651550_1196651553 -10 Left 1196651550 X:118173280-118173302 CCTCCATAACAACATCCAGCTGT No data
Right 1196651553 X:118173293-118173315 ATCCAGCTGTCACTAAAAGGAGG No data
1196651549_1196651553 -7 Left 1196651549 X:118173277-118173299 CCTCCTCCATAACAACATCCAGC No data
Right 1196651553 X:118173293-118173315 ATCCAGCTGTCACTAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196651553 Original CRISPR ATCCAGCTGTCACTAAAAGG AGG Intergenic
No off target data available for this crispr