ID: 1196651556

View in Genome Browser
Species Human (GRCh38)
Location X:118173305-118173327
Sequence CTAAAAGGAGGGAAAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196651549_1196651556 5 Left 1196651549 X:118173277-118173299 CCTCCTCCATAACAACATCCAGC No data
Right 1196651556 X:118173305-118173327 CTAAAAGGAGGGAAAGCCAGAGG No data
1196651548_1196651556 6 Left 1196651548 X:118173276-118173298 CCCTCCTCCATAACAACATCCAG No data
Right 1196651556 X:118173305-118173327 CTAAAAGGAGGGAAAGCCAGAGG No data
1196651550_1196651556 2 Left 1196651550 X:118173280-118173302 CCTCCATAACAACATCCAGCTGT No data
Right 1196651556 X:118173305-118173327 CTAAAAGGAGGGAAAGCCAGAGG No data
1196651551_1196651556 -1 Left 1196651551 X:118173283-118173305 CCATAACAACATCCAGCTGTCAC No data
Right 1196651556 X:118173305-118173327 CTAAAAGGAGGGAAAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196651556 Original CRISPR CTAAAAGGAGGGAAAGCCAG AGG Intergenic
No off target data available for this crispr