ID: 1196652220

View in Genome Browser
Species Human (GRCh38)
Location X:118179587-118179609
Sequence ATATAGAAAGAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196652216_1196652220 -10 Left 1196652216 X:118179574-118179596 CCCAAAGACTCACATATAGAAAG No data
Right 1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196652220 Original CRISPR ATATAGAAAGAGATGGAGCT GGG Intergenic
No off target data available for this crispr