ID: 1196652682

View in Genome Browser
Species Human (GRCh38)
Location X:118184641-118184663
Sequence TCGATAATAGCTATTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196652682_1196652684 7 Left 1196652682 X:118184641-118184663 CCAGTCAGAATAGCTATTATCGA No data
Right 1196652684 X:118184671-118184693 AAAAACAAAAGATGCCGGTGTGG No data
1196652682_1196652687 22 Left 1196652682 X:118184641-118184663 CCAGTCAGAATAGCTATTATCGA No data
Right 1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG No data
1196652682_1196652686 21 Left 1196652682 X:118184641-118184663 CCAGTCAGAATAGCTATTATCGA No data
Right 1196652686 X:118184685-118184707 CCGGTGTGGCCACAGAGAAAAGG No data
1196652682_1196652683 2 Left 1196652682 X:118184641-118184663 CCAGTCAGAATAGCTATTATCGA No data
Right 1196652683 X:118184666-118184688 AGTCAAAAAACAAAAGATGCCGG 0: 8
1: 464
2: 3068
3: 8390
4: 21776

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196652682 Original CRISPR TCGATAATAGCTATTCTGAC TGG (reversed) Intergenic
No off target data available for this crispr