ID: 1196652687

View in Genome Browser
Species Human (GRCh38)
Location X:118184686-118184708
Sequence CGGTGTGGCCACAGAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196652682_1196652687 22 Left 1196652682 X:118184641-118184663 CCAGTCAGAATAGCTATTATCGA No data
Right 1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196652687 Original CRISPR CGGTGTGGCCACAGAGAAAA GGG Intergenic
No off target data available for this crispr