ID: 1196652963

View in Genome Browser
Species Human (GRCh38)
Location X:118187565-118187587
Sequence TTGTTGTTGTTGTTGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196652963_1196652966 -6 Left 1196652963 X:118187565-118187587 CCCTGTTTCAACAACAACAACAA No data
Right 1196652966 X:118187582-118187604 CAACAAAATAATAATTAGCTGGG No data
1196652963_1196652968 1 Left 1196652963 X:118187565-118187587 CCCTGTTTCAACAACAACAACAA No data
Right 1196652968 X:118187589-118187611 ATAATAATTAGCTGGGATGGTGG No data
1196652963_1196652965 -7 Left 1196652963 X:118187565-118187587 CCCTGTTTCAACAACAACAACAA No data
Right 1196652965 X:118187581-118187603 ACAACAAAATAATAATTAGCTGG No data
1196652963_1196652967 -2 Left 1196652963 X:118187565-118187587 CCCTGTTTCAACAACAACAACAA No data
Right 1196652967 X:118187586-118187608 AAAATAATAATTAGCTGGGATGG No data
1196652963_1196652971 28 Left 1196652963 X:118187565-118187587 CCCTGTTTCAACAACAACAACAA No data
Right 1196652971 X:118187616-118187638 TGTAGTCCTAGCTACTCAGGAGG 0: 2392
1: 49778
2: 169739
3: 225167
4: 205384
1196652963_1196652969 25 Left 1196652963 X:118187565-118187587 CCCTGTTTCAACAACAACAACAA No data
Right 1196652969 X:118187613-118187635 ACCTGTAGTCCTAGCTACTCAGG 0: 1546
1: 35804
2: 160409
3: 253588
4: 212621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196652963 Original CRISPR TTGTTGTTGTTGTTGAAACA GGG (reversed) Intergenic
No off target data available for this crispr