ID: 1196659316

View in Genome Browser
Species Human (GRCh38)
Location X:118253183-118253205
Sequence CTGGTCTGGGGTTGTTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196659316_1196659329 20 Left 1196659316 X:118253183-118253205 CCAGCCCAACAACCCCAGACCAG No data
Right 1196659329 X:118253226-118253248 AACCCGCAATTCAGGGGCTATGG No data
1196659316_1196659326 14 Left 1196659316 X:118253183-118253205 CCAGCCCAACAACCCCAGACCAG No data
Right 1196659326 X:118253220-118253242 GCCTCCAACCCGCAATTCAGGGG No data
1196659316_1196659324 12 Left 1196659316 X:118253183-118253205 CCAGCCCAACAACCCCAGACCAG No data
Right 1196659324 X:118253218-118253240 TGGCCTCCAACCCGCAATTCAGG No data
1196659316_1196659322 -8 Left 1196659316 X:118253183-118253205 CCAGCCCAACAACCCCAGACCAG No data
Right 1196659322 X:118253198-118253220 CAGACCAGAAACTTGAGTGCTGG No data
1196659316_1196659325 13 Left 1196659316 X:118253183-118253205 CCAGCCCAACAACCCCAGACCAG No data
Right 1196659325 X:118253219-118253241 GGCCTCCAACCCGCAATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196659316 Original CRISPR CTGGTCTGGGGTTGTTGGGC TGG (reversed) Intergenic
No off target data available for this crispr