ID: 1196661744

View in Genome Browser
Species Human (GRCh38)
Location X:118277935-118277957
Sequence CCATAAAGGCATAAGTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196661744_1196661751 24 Left 1196661744 X:118277935-118277957 CCTGGTCACTTATGCCTTTATGG No data
Right 1196661751 X:118277982-118278004 TTAATAGCCATTTGGTGAGGTGG No data
1196661744_1196661750 21 Left 1196661744 X:118277935-118277957 CCTGGTCACTTATGCCTTTATGG No data
Right 1196661750 X:118277979-118278001 ATATTAATAGCCATTTGGTGAGG No data
1196661744_1196661749 16 Left 1196661744 X:118277935-118277957 CCTGGTCACTTATGCCTTTATGG No data
Right 1196661749 X:118277974-118277996 AAAAAATATTAATAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196661744 Original CRISPR CCATAAAGGCATAAGTGACC AGG (reversed) Intergenic
No off target data available for this crispr