ID: 1196665180

View in Genome Browser
Species Human (GRCh38)
Location X:118308735-118308757
Sequence CCATTGCCACGAGGACATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196665180_1196665187 -1 Left 1196665180 X:118308735-118308757 CCAAGATGTCCTCGTGGCAATGG No data
Right 1196665187 X:118308757-118308779 GAGGGTGGGATCCTGACAGCTGG No data
1196665180_1196665189 21 Left 1196665180 X:118308735-118308757 CCAAGATGTCCTCGTGGCAATGG No data
Right 1196665189 X:118308779-118308801 GCTGTCCTTTGAGTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196665180 Original CRISPR CCATTGCCACGAGGACATCT TGG (reversed) Intergenic
No off target data available for this crispr