ID: 1196670561

View in Genome Browser
Species Human (GRCh38)
Location X:118362515-118362537
Sequence ATGCTCAGCAAAAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196670561 Original CRISPR ATGCTCAGCAAAAAGCAGGA AGG (reversed) Intronic
902089346 1:13891103-13891125 ATACACAGCATAAACCAGGAGGG - Intergenic
903451502 1:23456649-23456671 ATGCTGAGCAAAAGGCCAGAGGG + Intronic
903650398 1:24918306-24918328 ATGCTGTGCAAGGAGCAGGAAGG - Intronic
904571199 1:31466789-31466811 GTTATCAGCAAAAAGCAAGAAGG - Intergenic
905160675 1:36030778-36030800 ATGCTCAATTAAAACCAGGAGGG - Intronic
905701357 1:40018140-40018162 CTGCTCAGCAAAAATCAAGATGG + Intergenic
906171040 1:43725496-43725518 ATGGTCAGAAAAAAGCATGCAGG - Intronic
907190659 1:52645238-52645260 CTGAGCAGCAAAAAGCAGGAGGG + Intronic
907306103 1:53513932-53513954 GTGATCAGCAAAAAACAGCAGGG + Intronic
907331687 1:53675967-53675989 ATCCCCAGGCAAAAGCAGGAGGG + Intronic
907422514 1:54356833-54356855 TTGCTGAGCACAAAGCAGGTGGG - Intronic
907570350 1:55477501-55477523 ATGCTTAGCCAAAGGAAGGATGG - Intergenic
908520178 1:64934077-64934099 GTGCTGACCAAAATGCAGGAGGG + Intronic
909948378 1:81689744-81689766 AGGGTCATCAAAAGGCAGGAAGG + Intronic
911953213 1:104203572-104203594 AGGGTCAGCTAAAAGCAAGAGGG + Intergenic
912683597 1:111744461-111744483 CTGCTCTTCAGAAAGCAGGAGGG + Intronic
913271228 1:117095459-117095481 ATGCTCAGCAGAAAGCACTGAGG + Intronic
915022733 1:152796789-152796811 ATGCTCAGAACAGAGCAGGAGGG + Intronic
915153375 1:153853581-153853603 CTGCACAGCAAACAGCAGAATGG - Intronic
915298376 1:154937658-154937680 ATGCTCAGAAAAATGCAGGACGG - Intergenic
915732692 1:158065484-158065506 CTGCCCAGGAAAAGGCAGGATGG + Intronic
916274063 1:162974806-162974828 AGCCTCAGCAAAATGGAGGATGG + Intergenic
917089714 1:171340746-171340768 ATGCTCAGAACAAAGGATGATGG - Intronic
917624163 1:176829302-176829324 ATGCTCAGCAAACAGCAGGAGGG + Intronic
918773535 1:188596750-188596772 ATGCAAAGCAAAAAGCAAAAAGG + Intergenic
920387115 1:205576990-205577012 AGGCTCAGCCACAGGCAGGAGGG - Intronic
921626426 1:217382011-217382033 ATGCAAAGCAAAAAACAGCAGGG + Intergenic
921656273 1:217742081-217742103 CTCCTCAGCACAAAGCAGGTTGG + Exonic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
923849151 1:237774287-237774309 ATGCTAAGGATAAAACAGGAGGG + Intronic
1063185222 10:3644431-3644453 ATTCTCAGTAATAACCAGGAGGG - Intergenic
1063425378 10:5946361-5946383 ATGCTCAGCAAAGGGTAGAATGG + Intronic
1064868433 10:19908875-19908897 ATGCTCAGCAAAGAAAAGCAAGG - Intronic
1066356586 10:34690505-34690527 ATGCTCAGCATAATGTAGTAAGG - Intronic
1067200283 10:44164463-44164485 ATGCTCAGGAAAGACCAGAAAGG - Intergenic
1067525818 10:47037989-47038011 ATGCTCAGCAAAAGGGGGCATGG + Intergenic
1068736312 10:60417094-60417116 ACACTCAGCAAACAGCAGGCAGG + Intronic
1069910142 10:71753977-71753999 AGGCTCAGTCCAAAGCAGGATGG + Intronic
1070652642 10:78249016-78249038 ATGCACAGCACACAGGAGGAAGG - Intergenic
1071168273 10:82832351-82832373 CTGATCAGCAACAAGGAGGAGGG - Intronic
1072682305 10:97516273-97516295 ATGCTCAGACAAAAGCAGAGAGG - Intronic
1072841086 10:98774630-98774652 CTGCTCAGGAAAAAGCAGCAGGG + Intronic
1073201531 10:101739721-101739743 ATGCTCAGGAAGGAGCAGCATGG + Intergenic
1073769472 10:106719778-106719800 ATGCTCAACAAAGAACAGTATGG + Intronic
1074356624 10:112791358-112791380 ACGCTCAGCAAAAGGCCAGAGGG + Intronic
1075276340 10:121096332-121096354 ATTCTAAGCCAAAAGCAGGCAGG - Intergenic
1077252633 11:1567331-1567353 ATGCACTGCAAACAGCAGGCTGG + Intronic
1077974300 11:7231799-7231821 ATGCTCAGAAAACAGACGGATGG + Intergenic
1079130380 11:17743803-17743825 ACGTTCAGCAAAAAGCAGGGAGG - Intronic
1079248721 11:18772008-18772030 TTTCTCAGCAAAAAGCAAGCTGG + Exonic
1079715345 11:23736585-23736607 ATCCTAAGCAAAAAGAAAGATGG + Intergenic
1080605550 11:33862115-33862137 ATTCTCAGGAAAAACCTGGAAGG + Intronic
1082938335 11:58677317-58677339 ATGCTTAGCAAAAATCAAAATGG - Intronic
1082982854 11:59139643-59139665 TTGCACAGTTAAAAGCAGGATGG - Intergenic
1083368587 11:62159113-62159135 ATGCTAAGCAAAAAAAAGCAGGG + Intergenic
1084299114 11:68234541-68234563 ATGCTCAGAAAACTACAGGAGGG - Intergenic
1085071583 11:73551273-73551295 AAGCTCAGGAAGAAGCAGTAGGG + Intronic
1085808881 11:79662178-79662200 ATGCTAAGGAAAAAGATGGAGGG - Intergenic
1085814527 11:79723130-79723152 ATGCTGAGCAAAAAGAATGCTGG + Intergenic
1086168424 11:83807558-83807580 ATGCTCAGTAAATAATAGGAAGG + Intronic
1088126129 11:106425760-106425782 TTACTCAGCAAAAAACAGGCTGG + Intergenic
1088917731 11:114240057-114240079 CTGGCCAACAAAAAGCAGGAAGG - Intronic
1091248547 11:134121471-134121493 ATGCTCAAAAAAAAAAAGGAGGG - Intronic
1092514043 12:9189195-9189217 ATCCTAAGCAAAAAGAAGAAAGG + Intronic
1093361216 12:18230895-18230917 ATCCTGAGCAAAAAGAAGAAAGG - Intronic
1093541540 12:20292728-20292750 ATGCTCAGTAAAAAACAAAAAGG - Intergenic
1094329697 12:29277701-29277723 ATGTTCAAGAAAATGCAGGAGGG + Intronic
1094478129 12:30858027-30858049 ATGCACATCAAAAAGCATGCAGG + Intergenic
1095139700 12:38646357-38646379 CTGCTTAGCAACAAGCAAGAAGG - Intergenic
1095383825 12:41627186-41627208 ATGCCCAGCAATTAGCATGATGG + Intergenic
1096625809 12:52895416-52895438 TTGCTCAGGGAAAGGCAGGATGG - Intergenic
1097148220 12:56956228-56956250 ATGATGAATAAAAAGCAGGAAGG + Intronic
1097303680 12:58045608-58045630 GAGCTAAGCAAGAAGCAGGAGGG - Intergenic
1098303241 12:69075865-69075887 ATGCTCAGGAAACAGGAAGAAGG + Intergenic
1099506024 12:83477028-83477050 TTGCTGAGTAAAAAGCTGGAGGG + Intergenic
1099753633 12:86810933-86810955 ACTCAGAGCAAAAAGCAGGAAGG - Intronic
1099753696 12:86811836-86811858 ACTCAGAGCAAAAAGCAGGAAGG - Intronic
1100695409 12:97087408-97087430 ATGCTTGGCAACAAACAGGAAGG - Intergenic
1101382242 12:104224191-104224213 TTGCCCAGCAAAGAGAAGGAAGG - Intronic
1101397401 12:104360396-104360418 ATGCTGAGCAACAAGTTGGAAGG + Intergenic
1101526999 12:105539964-105539986 ATGCCCAGCTAAGAGCAGCAGGG + Intergenic
1101534104 12:105601730-105601752 ATGCCCTGAAAAAAACAGGAAGG - Intergenic
1101803523 12:108043456-108043478 CTGTTCAGGAAAAAGCAGGGAGG + Intergenic
1103627129 12:122227691-122227713 ATGTTCAGAAAAAAACAAGAAGG - Intronic
1105636599 13:22221472-22221494 ATGCTGAGGAAAATGCAGGTAGG - Intergenic
1105812221 13:24005783-24005805 AGGCTCAGCAAGATGCAGCATGG + Intronic
1107237008 13:38183555-38183577 ATAATTAGCAAAAAGTAGGAAGG - Intergenic
1110111206 13:71748248-71748270 CTGCTCAGCAAAAAGTGGTAGGG + Intronic
1110260708 13:73482055-73482077 CTGCTCACCAAAAAGCTGGTTGG - Intergenic
1110791053 13:79587194-79587216 ATGCTCAGCAAAAATTGGCATGG + Intergenic
1110878908 13:80545587-80545609 ATTCGGAGCCAAAAGCAGGAGGG + Intergenic
1111807179 13:93052222-93052244 ATAATCAGCAAAAAGCTGGATGG + Intergenic
1113332955 13:109348662-109348684 ATGGTCATCAAAATGCATGAGGG + Intergenic
1113596863 13:111539783-111539805 ATGCTCAGCAAACCCCAGCAGGG - Intergenic
1114627475 14:24138855-24138877 GTCCCCAGTAAAAAGCAGGAAGG - Exonic
1115516133 14:34186981-34187003 CCGCTCAGGAAAAGGCAGGAGGG + Intronic
1117012176 14:51482218-51482240 ATGGTCAGCAAATAGCTGTAGGG - Intergenic
1117219211 14:53585404-53585426 TTGCTCAGTAAAAAGCAGATGGG + Intergenic
1120710103 14:87784602-87784624 ATGCTGAACAAAAAGCATGTGGG - Intergenic
1121668619 14:95691425-95691447 AATCTCAGCAAACAGCAGGGAGG - Intronic
1121915181 14:97832093-97832115 AGGCTGAGCATAAAGCGGGAGGG + Intergenic
1123184361 14:106501835-106501857 TTTCTCACCAAAAATCAGGAAGG - Intergenic
1124443211 15:29705064-29705086 ATGCTCAGCAGAGTGCATGAAGG - Intronic
1125101745 15:35921458-35921480 AGGGTCAGCAAACAGCAGGTAGG + Intergenic
1125855387 15:42944010-42944032 TTGCTGAGCAAAAAGAAGGTAGG + Exonic
1126685023 15:51240988-51241010 CTGCTCATAAAAAATCAGGAAGG + Intronic
1127058272 15:55154538-55154560 AGGCTCAGCAACCAGGAGGAAGG + Intergenic
1127758440 15:62114754-62114776 CTGCTCTGTAAAAAGCAGGGTGG + Intergenic
1128855884 15:71014439-71014461 GTGATCAACGAAAAGCAGGAAGG + Intronic
1130518021 15:84641132-84641154 CTGCTCAGAGAAAAGCAGGAGGG - Exonic
1130619097 15:85442708-85442730 TTGCTGAGCCAAAATCAGGATGG - Intronic
1130653914 15:85778690-85778712 GTGCTCAGCAAAGAGAGGGATGG - Intronic
1131018709 15:89079778-89079800 ATGCTGAGCTAGAAGAAGGAGGG - Intergenic
1131374489 15:91912430-91912452 TTGCTCTGCAAAGAGCAGGTGGG + Intronic
1134798246 16:17061232-17061254 ATGCTCAAAAAATATCAGGAAGG - Intergenic
1135886896 16:26318386-26318408 ATGTTCAGGAAGAAGAAGGAAGG + Intergenic
1137485810 16:48889965-48889987 ATGCTGAACAAAAAACAGCAGGG + Intergenic
1138877253 16:60966962-60966984 ATTCCCAGGAAAAAGCAGAATGG - Intergenic
1139329751 16:66178107-66178129 GTGCCCAGCAAAAGGCTGGAGGG + Intergenic
1139906891 16:70372280-70372302 ATGCCTAGCCAAAATCAGGAGGG - Exonic
1140874932 16:79141997-79142019 CTGCTCAGAAAAGAGCAGTAAGG + Intronic
1141246292 16:82310701-82310723 ATGATCAGGATTAAGCAGGATGG - Intergenic
1142479904 17:212920-212942 AGGCTGAGCAAAAACCAGGCAGG + Exonic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1142923319 17:3210310-3210332 AAGCTAAGCAGAAAGCAGAATGG + Intergenic
1144512150 17:15886525-15886547 ATGCTCAGCAAGGAGCAGGGTGG + Intergenic
1144808708 17:17984847-17984869 ATTGTCAGCACAAAGGAGGATGG - Intronic
1148975192 17:51521341-51521363 ATATTCAGCAGAAAGCAGCAAGG - Intergenic
1149727813 17:58914407-58914429 ATGCTCATAGAAAAGAAGGAAGG - Intronic
1151953260 17:77366978-77367000 ATGTTCTGCACAAAGCAGGCTGG + Intronic
1152008478 17:77696724-77696746 ATGGACAGGAAAAAGCAGGGGGG + Intergenic
1152332018 17:79678935-79678957 TTGCTCAGAGGAAAGCAGGAGGG - Intergenic
1152434112 17:80264682-80264704 GTGCTGAGCAGGAAGCAGGAAGG - Intronic
1152787303 17:82255432-82255454 TTGGTCAGCAAGCAGCAGGACGG + Exonic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155930157 18:31698707-31698729 ATACTCAGTAAATAGCAGAAAGG + Intergenic
1156258041 18:35417388-35417410 CTACTCAGCAATAAACAGGAAGG - Intergenic
1157783218 18:50458404-50458426 ATGATCAGCTCAAAGGAGGAGGG - Intergenic
1158615902 18:58986942-58986964 ATGCTCAACAAAAATCATGCTGG + Intergenic
1158753844 18:60298936-60298958 ATGCTCAGAAAAGTGTAGGAAGG + Intergenic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
1160462838 18:79052449-79052471 AGCCTCAGCCAAAAGCAGCAGGG - Intergenic
1161173716 19:2827070-2827092 ATACCCAACAAAAAGCAGGATGG - Intronic
1161635511 19:5386353-5386375 ATGCTCAGCACAAGGTAGAAAGG - Intergenic
1162138697 19:8572153-8572175 ATCTTCCCCAAAAAGCAGGAGGG - Intronic
1162278588 19:9677457-9677479 ATGCACTGCAGAAAGCAGCAGGG - Intergenic
1162673611 19:12280502-12280524 ATGCTCAGCTAAAAGGAAAAAGG + Intronic
1163403783 19:17110216-17110238 ATGCTGACCAAAAAACAGGAAGG + Intronic
1163460990 19:17437418-17437440 AGGCTCAGAAAAAAGCAAAACGG + Intronic
1164049750 19:21574986-21575008 ATTGTCTGAAAAAAGCAGGAGGG - Intergenic
1165028185 19:32977252-32977274 ACACTCAGCAAAAAGCATTAGGG + Exonic
1166333911 19:42094060-42094082 ATCCTGAGCCACAAGCAGGAAGG + Intronic
1167664199 19:50813931-50813953 ATGTTCATCAAAAATCTGGAGGG - Intergenic
1167888363 19:52520305-52520327 ATGCACTGCAGAAAGCAGCAGGG - Intergenic
1167897763 19:52594812-52594834 ATGCTCCTCAAAAACCAGAACGG - Intronic
1167899704 19:52610582-52610604 ATGCTCCTCAAAAACCAGAATGG - Intronic
1167908144 19:52679307-52679329 ATGCTCCTCAAAAACCAGAATGG + Intronic
925283022 2:2698033-2698055 ATCCTCTGTAAAAAGCAGGAAGG + Intergenic
927095038 2:19741768-19741790 ATGCTCAGCAAAAGGAACCAAGG + Intergenic
928365999 2:30703438-30703460 ATGCTCACAAGAAAGCAGGAGGG - Intergenic
928622333 2:33103771-33103793 ATGCTACTCAACAAGCAGGATGG - Intronic
928977470 2:37103762-37103784 ATGTTCAGCAAAAATCAACATGG - Exonic
929489721 2:42385477-42385499 AGTGTCAGCAAAATGCAGGAGGG + Intronic
929526992 2:42713712-42713734 ATGTTAAGTAAAAAGCAGCAAGG - Intronic
930342078 2:50129703-50129725 ATGCCCAGCAAAAAGAAAGGAGG + Intronic
931345141 2:61439522-61439544 CTGCTCAGCACACAGCTGGATGG - Intronic
932146012 2:69317930-69317952 ATGATCAGCAAATTACAGGAAGG + Intergenic
932559469 2:72854785-72854807 ATGCTCAAAAAACAACAGGATGG - Intergenic
932685180 2:73863138-73863160 ATCCTCAGCCAAAAGCATGGAGG - Exonic
934636635 2:95995320-95995342 ATGCTTAGAAAAAGGCATGATGG + Intergenic
937621003 2:123985341-123985363 TTTCTCAACAAAAATCAGGAAGG + Intergenic
937928013 2:127182777-127182799 GTGCTCTGACAAAAGCAGGAGGG - Intergenic
939120958 2:138115966-138115988 ATGCTCAGCAAACAGCTGGGAGG - Intergenic
940129991 2:150370143-150370165 ATGCTCAGCCCACAGCAGGAAGG - Intergenic
941007281 2:160261130-160261152 AGGCTTAGGAGAAAGCAGGAAGG - Intronic
944890388 2:204111075-204111097 ATATTCAGCAAAAAGCAGACCGG + Intergenic
945239265 2:207661172-207661194 AGGCTCAGGGAGAAGCAGGAAGG + Intergenic
948157308 2:235793644-235793666 TTGAGCAGCAAAAAGGAGGAAGG + Intronic
948690336 2:239698054-239698076 CTGCTCAGCACTGAGCAGGAGGG - Intergenic
1168854905 20:1001803-1001825 ATGGTCAGCAGAAAGGAGGATGG - Intronic
1171017596 20:21555866-21555888 AGGATCAGCAAAGAGAAGGAAGG - Intergenic
1172176067 20:32972653-32972675 AGGCCCAGAAAAAAGCAGGCAGG - Intergenic
1172681737 20:36721079-36721101 ATGTTAAGCAGAAAGCATGAGGG - Intronic
1173219919 20:41124081-41124103 ATGCTCAGAACAAAGGATGATGG - Exonic
1175332487 20:58175092-58175114 ATCCACAGCAAACAGCAGGCAGG + Intergenic
1176892551 21:14335711-14335733 AAGGGCAGCAAAAAGTAGGATGG + Intergenic
1177210994 21:18070531-18070553 CTGCTGAGCAAAAGGCAGGCAGG - Intronic
1177278447 21:18947443-18947465 ATGCTCATTAAAAAGCAAAATGG + Intergenic
1177374193 21:20247937-20247959 ATTTTTAGCAAGAAGCAGGAAGG - Intergenic
1180141783 21:45897641-45897663 AAGATGAGCAAAGAGCAGGATGG - Intronic
1180880135 22:19197713-19197735 CTGCTGAGCAGACAGCAGGATGG - Intronic
1181719880 22:24765643-24765665 ATGCTCAGAACAAAGGATGATGG - Intronic
1183898114 22:40985229-40985251 CAGCTCAGCAAATGGCAGGAAGG + Intergenic
1184555746 22:45232170-45232192 GTGCTGAGCAGAAGGCAGGAGGG - Intronic
1185390509 22:50558640-50558662 CTACTTACCAAAAAGCAGGACGG - Intronic
949198090 3:1337496-1337518 AAGCTCTGCAAAGAGGAGGAAGG - Intronic
950796809 3:15516824-15516846 ATACTGAGGAAAAAGCAGGAGGG + Intronic
951488675 3:23243468-23243490 ATGATCAGAAAGAAGCAGAAAGG - Intronic
951518023 3:23583373-23583395 ATGCTAAGCAAAAAGAACAAAGG - Intronic
951728926 3:25789438-25789460 AAGCTAAGCAAAAATAAGGAGGG + Intronic
951852665 3:27159972-27159994 ATGTTCCGGAAAAAGCAGAAAGG - Intronic
952145912 3:30531719-30531741 CTGCTCAGGAATAAGGAGGATGG - Intergenic
952865057 3:37849665-37849687 ATGCTGTGCTTAAAGCAGGATGG - Intergenic
953295427 3:41710887-41710909 ATGGTGAGCAGAAAGCAGGTAGG + Intronic
953767818 3:45757420-45757442 ATGCACAGCAGAAAGCTGCAGGG - Exonic
953915128 3:46914163-46914185 ATGCTGAGCAAAAACCAGTCCGG - Intergenic
956287517 3:67626361-67626383 ATGATCAGCACCAAGCAGCAAGG + Intronic
956835798 3:73095159-73095181 AAGCTGAGCAGAAAGCAGGCGGG - Intergenic
957769718 3:84675170-84675192 ATGCTCAGGAGAAAGAATGAAGG - Intergenic
958529363 3:95306752-95306774 ATGCTCAGCAGAAATATGGATGG - Intergenic
959707339 3:109350310-109350332 GTGCTCTGCAAAAACCAAGAAGG - Intergenic
960021543 3:112961045-112961067 ATGTTCAGCAAAAAAAAGAAAGG + Intronic
962032985 3:131621047-131621069 ATCCTTAGCAAAAACCAGCATGG + Intronic
962246701 3:133801394-133801416 ATTCTCAGGAATGAGCAGGAGGG - Intronic
963892653 3:150653042-150653064 GTGATCAGCAAAATGCAGGAAGG - Intergenic
964054825 3:152440922-152440944 ATGTTCACCAATAAGCAGCATGG - Intronic
964840795 3:160991354-160991376 ATTCTCAGGAAAAAGAAAGATGG + Intronic
965614046 3:170574866-170574888 TTGCTCAGTTAAAAGCAGTACGG - Intronic
967998369 3:195183859-195183881 ATGGTCAGAAAAAAACTGGAAGG + Intronic
968012724 3:195296183-195296205 CTACTCTGCAAAAAGCATGAGGG - Intronic
969275344 4:6131335-6131357 AAGCTCAGAAAATAGCAAGAAGG + Intronic
969923236 4:10560299-10560321 ATGCTCAATAAATAGAAGGATGG + Intronic
970018887 4:11544351-11544373 AAGCTAAGCCAAAATCAGGATGG - Intergenic
972232808 4:37095177-37095199 CTGCACAGCAAAAGGCAGGTTGG + Intergenic
972793373 4:42393886-42393908 ATACTGAGGAAAAAGGAGGAAGG - Intergenic
974885506 4:67811968-67811990 ATGCAAAGCAAAAAGAAGCAGGG + Intergenic
974946382 4:68534261-68534283 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
977435975 4:96994884-96994906 CTGCTCAGCATAATGAAGGATGG + Intergenic
983400222 4:167254278-167254300 GTGCTCAGCAAAACCCAAGATGG + Intergenic
987379828 5:17275226-17275248 AAGCTCAGCAAGAAGAAGAAGGG + Exonic
987454793 5:18130103-18130125 ATGTTCAGAAAAAAACAGAATGG + Intergenic
988252325 5:28775577-28775599 ATGCTCAGTAAATAGCAGGCTGG + Intergenic
988650856 5:33149034-33149056 ATCCTCCTCAAAAAGCAGTAAGG - Intergenic
989095465 5:37777512-37777534 ATGCTCAACAAAAAAATGGAGGG - Intergenic
989377182 5:40776736-40776758 ATGTTCAGGTATAAGCAGGATGG + Intronic
991274441 5:64827889-64827911 TTGGGCAGCACAAAGCAGGATGG - Intronic
991409809 5:66334796-66334818 ATGCTCAGAAATAGACAGGATGG - Intergenic
991473223 5:66991879-66991901 ACACACAGAAAAAAGCAGGAAGG - Intronic
993209980 5:84936400-84936422 ATGATTAGCACAAATCAGGAAGG - Intergenic
993404670 5:87496520-87496542 ATCCTAAGCAAAAAGAAGAAAGG + Intergenic
994194972 5:96912675-96912697 GTGCTCAGACAACAGCAGGATGG + Exonic
996035284 5:118751767-118751789 ATGCTTAGCAAAATGCATAAAGG + Intergenic
997605622 5:135173858-135173880 ATGCTCAGTTCAAAGGAGGAAGG - Intronic
998007041 5:138663894-138663916 ATGCTCAGGGCAGAGCAGGAGGG + Intronic
998045671 5:138984742-138984764 ATACCCAGACAAAAGCAGGAAGG + Intronic
998966405 5:147545598-147545620 TTTCTCAGCAAAGAGCATGAAGG - Intergenic
999285833 5:150393710-150393732 ATGCTCATCAAAGTGCAGGTGGG + Intronic
1001075970 5:168628337-168628359 ATGCCCAGCAGAAGGCAAGAAGG + Intergenic
1003665926 6:8111348-8111370 CTGCACAGCCAAATGCAGGAAGG - Intergenic
1004518241 6:16338904-16338926 ATGCACACCAACAAGAAGGAAGG + Intronic
1004815183 6:19304714-19304736 ATGCTCAGGAACAAACTGGAAGG + Intergenic
1005353990 6:24964473-24964495 ATACTCAGCAATAAAAAGGAGGG - Intronic
1005522129 6:26610788-26610810 ATTCCCAGGGAAAAGCAGGAAGG + Intergenic
1006637849 6:35473429-35473451 GTGCTCAGCTGGAAGCAGGAGGG + Intergenic
1009711377 6:67326171-67326193 ATGCTGTGCAAACAGCAGAATGG + Intergenic
1010820465 6:80409746-80409768 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
1010849519 6:80754824-80754846 ATCCTGAGCAAAAAGAAGGAAGG - Intergenic
1011571361 6:88740144-88740166 ATACTCAGGAGAAAGCAAGAGGG + Intronic
1012143839 6:95656720-95656742 TTCCTCAGGAAAAAGGAGGAAGG - Intergenic
1014480659 6:121932510-121932532 ATGCTCAGCAGGAATCAGGTGGG - Intergenic
1015075242 6:129148735-129148757 AGGCTCAGAAGAAAGCAGGAAGG - Intronic
1015976773 6:138798596-138798618 ATGCTTAGTCAAAAGAAGGATGG - Intronic
1016516066 6:144894196-144894218 TTGCTCACTAAATAGCAGGAGGG + Intergenic
1017422582 6:154288143-154288165 ATGGTCACCAAAAAGCACAATGG + Intronic
1017809138 6:157971830-157971852 ATGCTCAGCAAAATCCGGGCTGG + Intergenic
1018432184 6:163730985-163731007 AGGCACAGCAGGAAGCAGGAGGG + Intergenic
1019882028 7:3869773-3869795 CTACTCAGCAAAAAGGAGGAGGG + Intronic
1020007459 7:4790125-4790147 AGGCTCGGCAGAAAGAAGGACGG - Intronic
1020031131 7:4933557-4933579 CTGCTCAGCAATAAAAAGGAAGG - Intronic
1021107458 7:16654256-16654278 AAGCTTAGAAAAAAGCAAGATGG - Intronic
1022084316 7:27051580-27051602 ATGCCCAGCCAAAAGCAATATGG + Intergenic
1022908867 7:34881103-34881125 AAGGTCAGCAAAAAGAAGGAAGG + Intergenic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024368449 7:48550917-48550939 ATGCTCAGTAAAGAGCTGGAAGG - Intronic
1024386936 7:48762393-48762415 ATGCTCAATATAAAGGAGGAAGG + Intergenic
1024395819 7:48865525-48865547 ATGTGCAGCAAACAGCAGAATGG + Intergenic
1024399417 7:48906751-48906773 ATGTGCAGCAAACAGCAGAATGG - Intergenic
1024699064 7:51887352-51887374 ATGCTCTGCAGAAAGCAAGCTGG - Intergenic
1026462911 7:70630572-70630594 CTGGTCAGCAAACAGCAGGCAGG - Intronic
1026766063 7:73160624-73160646 ATTCTCAGCATAAAGCCAGAAGG + Intergenic
1027042538 7:74970320-74970342 ATTCTCAGCATAAAGCCAGAAGG + Intronic
1027081105 7:75232037-75232059 ATTCTCAGCATAAAGCCAGAAGG - Intergenic
1027473173 7:78597653-78597675 ATGGTTAGGTAAAAGCAGGAAGG - Intronic
1028640254 7:93034458-93034480 ATCCTAAGGAAAAAGCAGGAGGG + Intergenic
1031844115 7:126783514-126783536 AAGCTTAGAAAAAAGCAGGTAGG - Intronic
1032017452 7:128389067-128389089 CTCCTCAGCAGGAAGCAGGAGGG + Intergenic
1032862947 7:135898774-135898796 ATGCTCCGGAAAATGCAGAATGG - Intergenic
1033946740 7:146727921-146727943 ATGCTCAGCAAAATGCTAGGTGG - Intronic
1034727907 7:153357394-153357416 ATGCTCAGACAAAGACAGGATGG - Intergenic
1034864789 7:154631845-154631867 AAGTTCAACAAGAAGCAGGAGGG + Intronic
1035030159 7:155851728-155851750 CAGCTCAGCAAAGAACAGGAGGG + Intergenic
1035071746 7:156149940-156149962 ATGCTCAGTAAATGGCAGCAAGG - Intergenic
1036406474 8:8459824-8459846 ATCCTCAGAAGAAAGGAGGAAGG + Intergenic
1037647293 8:20804109-20804131 ATGCTCAGAAACCAGCAAGAAGG + Intergenic
1037704548 8:21308193-21308215 ATTGACAGGAAAAAGCAGGAAGG + Intergenic
1040096605 8:43450676-43450698 ATGCTCCACAAATAGCAGGCAGG - Intergenic
1040316670 8:46264721-46264743 ATGCACTGCGAAAAGCAGCAGGG - Intergenic
1045909534 8:107390618-107390640 ATGATCAGAAAATAGAAGGAGGG + Intronic
1046488900 8:114921453-114921475 ATGGTAAGGAAAAAGCAGAATGG - Intergenic
1048246101 8:132802215-132802237 ATGGGCAGCTAAAAGCAGTATGG - Intronic
1049698403 8:143994784-143994806 CTGCTCAGGAAATAGCCGGAAGG - Intronic
1050348527 9:4717278-4717300 ATCCTCTGTAAGAAGCAGGAAGG + Intronic
1052067624 9:24041748-24041770 GTACTCAGCAAAGAGCAGCAAGG + Intergenic
1052159005 9:25231893-25231915 ATGCTCAGCAAACGTCAAGAAGG - Intergenic
1052395425 9:27932532-27932554 ATGCTAAGCAAAAATCAAGTAGG + Intergenic
1052582555 9:30377712-30377734 ATACTCAGCAATAAAAAGGAAGG + Intergenic
1056819014 9:89823929-89823951 ACCCTGAGCAAAAGGCAGGAGGG - Intergenic
1058697265 9:107570023-107570045 ATGCTCAGGAAAGACAAGGATGG - Intergenic
1059886910 9:118755918-118755940 ATTCTCAGTAAAAACCAAGAAGG - Intergenic
1059996542 9:119915683-119915705 ATGCTCAGCAAAAGGGAAGAAGG + Intergenic
1060089518 9:120730811-120730833 CTGCTAAGCAAACAGCAGGTGGG + Intergenic
1061297589 9:129685277-129685299 ATGCGGAGCCAAAAGCAGGGTGG + Intronic
1061394543 9:130336929-130336951 AAGCTCAGCAGAAAGCAAGGTGG + Intronic
1062155573 9:135046353-135046375 ATGCTCAGCACACAGCTGGGTGG - Intergenic
1203495493 Un_GL000224v1:147430-147452 ACACTCAGAAAACAGCAGGAAGG - Intergenic
1203508118 Un_KI270741v1:89353-89375 ACACTCAGAAAACAGCAGGAAGG - Intergenic
1186406377 X:9307627-9307649 ATGCACAGAAAAAAGCACAAAGG + Intergenic
1186866865 X:13729295-13729317 ATCCTCAGCCAAAAGAAGAAAGG + Intronic
1187254967 X:17634268-17634290 ATGCGCAGCAAGAACCAGAATGG - Intronic
1187315541 X:18190374-18190396 GTACTCAGCAATAAACAGGAAGG + Intronic
1188403695 X:29780169-29780191 ATGCACAGTAAAAAGGAAGATGG - Intronic
1188501567 X:30832700-30832722 ATGCTCAGCCTCAAACAGGAAGG + Intronic
1190471840 X:50788846-50788868 ATGCTAACCAAAAAACAGCAAGG + Intronic
1192689602 X:73348559-73348581 AAGCTCAGAAGAAAACAGGAAGG + Intergenic
1194206703 X:91019174-91019196 ATGGTCAGGAAAGAGCAGGATGG + Intergenic
1194390081 X:93306343-93306365 ATAGTAAGCATAAAGCAGGATGG - Intergenic
1194860121 X:98988754-98988776 ATGCTCAGCTAAAAAGATGATGG - Intergenic
1196627562 X:117894000-117894022 AAACTCAGCAAAAATCAGGATGG - Intergenic
1196670561 X:118362515-118362537 ATGCTCAGCAAAAAGCAGGAAGG - Intronic
1197261020 X:124318181-124318203 ATGCTGAGCAAAAAGAAAGCTGG + Intronic
1198135204 X:133742774-133742796 ATTATCTGCAAAAAGCAGAAAGG + Intronic
1199070497 X:143469827-143469849 GGGCTCAGAAAAAGGCAGGAAGG - Intergenic
1200069867 X:153522864-153522886 GTGCTCAGGAAACAGCAGGGAGG + Intronic
1200552451 Y:4593963-4593985 ATGGTCAGGAAAGAGCAGGATGG + Intergenic
1201498405 Y:14614877-14614899 ATCCTAAGCAAAAAGAATGAAGG - Intronic