ID: 1196675126

View in Genome Browser
Species Human (GRCh38)
Location X:118412201-118412223
Sequence AGTATGTTAAAGGTACTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196675122_1196675126 10 Left 1196675122 X:118412168-118412190 CCAGGGACTAGCAAGTGCAAAAG 0: 1
1: 0
2: 2
3: 15
4: 168
Right 1196675126 X:118412201-118412223 AGTATGTTAAAGGTACTACAAGG 0: 1
1: 0
2: 1
3: 6
4: 132
1196675121_1196675126 11 Left 1196675121 X:118412167-118412189 CCCAGGGACTAGCAAGTGCAAAA 0: 1
1: 0
2: 2
3: 31
4: 231
Right 1196675126 X:118412201-118412223 AGTATGTTAAAGGTACTACAAGG 0: 1
1: 0
2: 1
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196675126 Original CRISPR AGTATGTTAAAGGTACTACA AGG Intronic
906417303 1:45630421-45630443 AGTATGTTCAAGGTCCTTAAAGG + Intronic
911818152 1:102381334-102381356 AGTATATTAAATGTACTTCAGGG - Intergenic
912890694 1:113526519-113526541 AGTATGGAGAAGGAACTACAGGG + Intronic
913110540 1:115653687-115653709 AGTCTCTTAAAGTTACTACAAGG - Intronic
913385926 1:118258389-118258411 AATATGCGAAAGGTACTATATGG - Intergenic
918130784 1:181627222-181627244 ACAATGTTACAGGTACTGCAGGG + Intronic
918954371 1:191186612-191186634 AGTATGTTCAGAGTGCTACAGGG + Intergenic
919223176 1:194657998-194658020 ACTATGCTAAAGGTCTTACAAGG - Intergenic
919526826 1:198664034-198664056 AGTATGTTAAAGATGCTATGGGG + Intronic
919527002 1:198665731-198665753 AGTATGTTCAATGTAGTACATGG + Intronic
921517992 1:216121227-216121249 ATTATGTTAAAGCTGCTAAAAGG + Intronic
921557216 1:216613044-216613066 AGTATCTTAAAGGGATTTCAGGG + Intronic
921908667 1:220524327-220524349 ACTTTGTTTTAGGTACTACAAGG - Intergenic
921920093 1:220658766-220658788 AGTTTGTTAAAAAGACTACATGG - Intronic
922544302 1:226444234-226444256 AGTATTTCAAAGGTATTTCAGGG + Intergenic
1064933196 10:20650275-20650297 AGTATGTTCCAGGAAATACAGGG - Intergenic
1066588260 10:36962249-36962271 AGTATTTAAAAGGTCATACAAGG - Intergenic
1070084353 10:73221445-73221467 AGCATTTTAAAAGTACTAGAAGG - Intronic
1071043659 10:81345694-81345716 AGTATGTTCAAGGAACTAAAGGG + Intergenic
1072020128 10:91390868-91390890 AGAATGTGAAGGGTACTACTGGG - Intergenic
1072797979 10:98371377-98371399 AAGATGTTAAAGGTAAAACAAGG + Intergenic
1073771680 10:106741934-106741956 AGTATGGAAAAGCGACTACAAGG - Intronic
1073899669 10:108205204-108205226 ATTCAGATAAAGGTACTACATGG + Intergenic
1074661681 10:115666212-115666234 AGTATTTTAAAGGTCGTCCAAGG + Intronic
1078760424 11:14246996-14247018 AGTATGTCTAAGGCACTAAAAGG + Intronic
1081474364 11:43411238-43411260 AGTATGTTCAAGGAACTACAAGG - Intronic
1086018159 11:82192404-82192426 AGTATGTGAAAAGTGCTACATGG + Intergenic
1086573354 11:88309530-88309552 AGTAGTTTAAAAGTACTTCATGG - Intronic
1094256645 12:28437317-28437339 AATATTTTAAATGTACAACAAGG - Intronic
1095601662 12:44020305-44020327 AGCATTCTAAAAGTACTACATGG + Intronic
1097790110 12:63806546-63806568 ACTATGTTACAGGAACAACAGGG + Intronic
1105569598 13:21589143-21589165 AGTATAACAAAGGTACTGCAAGG + Intronic
1105743188 13:23350467-23350489 AGGATTTTAAATGTAATACAAGG + Intronic
1107428748 13:40319554-40319576 AGTATGGTAAAGGAGATACAGGG + Intergenic
1107804404 13:44140823-44140845 AGGATTTTAAAGGTAATTCATGG + Intergenic
1108079212 13:46716597-46716619 AGTATGTTACATGTAATACCTGG + Intronic
1108844624 13:54662425-54662447 AGTATGTAAAATGCACTGCAGGG + Intergenic
1109360326 13:61286756-61286778 AGTATGTACAAGGCACTGCATGG + Intergenic
1110063984 13:71078393-71078415 AGTATTTTAAAGAAACTAAAAGG + Intergenic
1111285358 13:86084171-86084193 AGTATTGTAAATGTACTAAATGG + Intergenic
1112557867 13:100485609-100485631 AGTTTCCTAAACGTACTACAAGG + Intronic
1113222950 13:108126308-108126330 AATATGTTAAAGGGACTATCTGG + Intergenic
1114543058 14:23477652-23477674 AGTATGGAAGAGATACTACAGGG - Intronic
1116207455 14:41886309-41886331 AGTATGTCCAGGGTACTCCATGG - Intronic
1116673646 14:47876582-47876604 AGTATATTAAAGTTAATTCATGG - Intergenic
1118673731 14:68159720-68159742 AATATGTTAAAAGTAGTAAATGG - Intronic
1126073342 15:44885243-44885265 AGTATGTTAATGGTTCCTCAGGG - Intergenic
1126084920 15:45002382-45002404 AGTATGTTAATGGTTCCTCAGGG + Intergenic
1128000126 15:64183537-64183559 AGGATGTTAATGGTAGAACAAGG - Intronic
1139005608 16:62567933-62567955 TGTATGTTAAAGGCACTCAAAGG - Intergenic
1142723801 17:1796741-1796763 AGTATTTTAAAGGCAAGACATGG + Intronic
1146695105 17:34902943-34902965 CTTGTGTTAAAGGGACTACAAGG - Intergenic
1148521278 17:48277970-48277992 AGTATGTAAAAGGTGCTTAATGG - Intronic
1153393370 18:4589752-4589774 AGTATGTTTAAAGTACTGTAAGG - Intergenic
1154958009 18:21278077-21278099 AGGATATTAAAGTTACAACAAGG + Intronic
1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG + Intergenic
1168025939 19:53643628-53643650 AGCATGTTAAAGGTGCCTCAAGG + Intergenic
928829962 2:35469190-35469212 AGTATGTCAAGTATACTACATGG - Intergenic
930978817 2:57496894-57496916 AGCATGATAAAGGTACAAAAAGG - Intergenic
932375719 2:71234067-71234089 AGTATGATAAATGTTCTAGAAGG + Intergenic
932394977 2:71437742-71437764 GACACGTTAAAGGTACTACATGG - Intergenic
933563051 2:83913210-83913232 AGAATGTCAAAGGTAGTAGAAGG + Intergenic
935126492 2:100228175-100228197 AAAATATTAAAGGTATTACATGG + Intergenic
938396595 2:130954578-130954600 AGTGTGTTAAATGTGCTAAAAGG - Intronic
938669592 2:133574225-133574247 AGTGTGTTTTAGGGACTACAGGG - Intergenic
941713060 2:168735253-168735275 AGTCTGTTAAAAGTATTATATGG - Intronic
942114957 2:172719779-172719801 AATATGTTAAAGGCTCTAAATGG - Intergenic
943381091 2:187149408-187149430 AGGATGATAAAGGTAGTTCAAGG + Intergenic
945918553 2:215730595-215730617 AGTATGTAAAAAGTATCACATGG - Intergenic
948231725 2:236353956-236353978 AGTACATAAAAGGTATTACAAGG - Intronic
1169804966 20:9550058-9550080 AGCATGTAAAATGTACTCCATGG + Intronic
1171019842 20:21575229-21575251 AATATGTAAAAGTTACCACAGGG + Intergenic
1171276735 20:23862616-23862638 AGAATCTTCAAGGAACTACAAGG - Intergenic
1171563930 20:26159782-26159804 AATATTTTATAGGTAATACAAGG + Intergenic
1175000325 20:55621121-55621143 AATATATTAAAGCTACTAAATGG - Intergenic
1175156565 20:56975740-56975762 AGCATGTTAAAGATCCCACAGGG + Intergenic
1179922118 21:44513054-44513076 AGTATGTTTCAAGTATTACATGG - Intronic
949102279 3:160307-160329 AATATGTTAATGGGACTTCATGG + Intergenic
949202522 3:1395794-1395816 AGTATGATAAAGTTAATACAGGG - Intronic
949263336 3:2127788-2127810 AGTGTTTAAAAGGTGCTACAGGG + Intronic
951002028 3:17573958-17573980 AGTACGTAAAAAGTACTTCATGG + Intronic
951697646 3:25462505-25462527 ATAATGTTACAGGTACTCCATGG + Intronic
953576351 3:44115952-44115974 ACTATGTTACAGGCACTCCAGGG + Intergenic
955150130 3:56358811-56358833 AGTATATTAAACGTCTTACATGG - Intronic
956155693 3:66294222-66294244 AGGAGGTGAAAGATACTACAAGG - Intronic
956976052 3:74581112-74581134 ATTATACTAAAGGTCCTACAAGG + Intergenic
958612790 3:96448958-96448980 TTTAAGTTAAAGGTATTACAAGG + Intergenic
963391405 3:144668753-144668775 AGTATGCTAAAGATTTTACATGG + Intergenic
965917835 3:173872644-173872666 AGTAAGTTAAAGTTTCTTCAGGG + Intronic
971212264 4:24630057-24630079 AGCATGTTCAAGGGACTTCAGGG - Intergenic
972672070 4:41222074-41222096 ACTCTGTGAAAGGTAGTACAGGG + Intergenic
974373607 4:61048445-61048467 AGTGTTTTAAAAGTACTATACGG + Intergenic
975479909 4:74866288-74866310 AGAATCTTAAAGGTGATACAAGG + Intergenic
976331046 4:83831524-83831546 AGTATTTTTAAAGTACTCCAGGG - Intergenic
976396983 4:84566519-84566541 AGTATGTTCCAAATACTACATGG + Intergenic
977662578 4:99608060-99608082 AGAATTTTAAGGATACTACATGG - Intronic
981566507 4:146107111-146107133 AGTATGTTAAAGGCACCATGGGG + Intergenic
988306084 5:29496154-29496176 AGTATGTTAAATGTGCTAATGGG + Intergenic
993759211 5:91771327-91771349 AATATGTTGAAGATACCACAGGG + Intergenic
993969410 5:94398391-94398413 AGCATGTTAAAGGTCTTAAAGGG - Intronic
996447116 5:123567613-123567635 AATATTTTAAAAGTAATACATGG + Intronic
997880652 5:137586689-137586711 AGTATGGAAATGGTGCTACATGG + Intronic
1001160210 5:169306031-169306053 AGTTTGGTAAAGGGACTATATGG - Intergenic
1003978545 6:11367370-11367392 AGTCTGTTAAAGTTATTATATGG + Intronic
1006088432 6:31613567-31613589 AGTATATTAAAGGTGCTAGGTGG - Intergenic
1008002187 6:46372084-46372106 ATTAATTTAAAGGAACTACATGG + Intronic
1011681684 6:89789643-89789665 ACTATGTTGCAGGTACTTCATGG - Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016565933 6:145453878-145453900 AGTATTTTAAAGTTATTTCATGG + Intergenic
1017852908 6:158320889-158320911 AGTCTGTTAAGTGTACAACAGGG - Intronic
1021272271 7:18604819-18604841 AGTATGTTAAGGGTTCTAATGGG - Intronic
1022587715 7:31631526-31631548 AGTATGATAGAAGTAATACAAGG - Intronic
1030864430 7:114681751-114681773 AGTATATTTAAGGTAATAAAAGG - Intronic
1032231597 7:130079560-130079582 AGTATTTTAAACGTACTGCTGGG + Intronic
1037297770 8:17419285-17419307 ATTATGCTAAGGCTACTACACGG + Intergenic
1037497597 8:19455185-19455207 AGTTTGTAAAAGGTAATACTTGG - Intronic
1038669773 8:29573432-29573454 TGTATGTTAAATGCACTGCAAGG + Intergenic
1039594067 8:38775388-38775410 AGTCTGTTAAGGCTACTATAAGG + Intronic
1040987527 8:53312779-53312801 AGTATGTGACAGGAAGTACATGG - Intergenic
1042960603 8:74299785-74299807 AACATGTTAAAGATACTTCAAGG - Intronic
1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG + Intergenic
1044472852 8:92591391-92591413 AGACTGTTAAAAGTCCTACAGGG + Intergenic
1045519110 8:102887854-102887876 ACTATGTTAAAGGCTTTACATGG - Intronic
1045526533 8:102945264-102945286 TGTATGTTGAAAGTATTACACGG - Intronic
1051492697 9:17684166-17684188 AATATGTTAAAGGTTCTAAGTGG + Intronic
1051979110 9:22991933-22991955 AGTATGTTAAAGGGATTAATGGG + Intergenic
1059012618 9:110478452-110478474 AGCAGGTTAAAGGTGCTATAAGG - Intronic
1059837425 9:118171574-118171596 AGCATGTTCAAGATATTACAAGG - Intergenic
1060568462 9:124615419-124615441 AGGATTTTAAAGGTGCTATATGG - Intronic
1187727633 X:22220245-22220267 AGGATGTTGGAGATACTACAGGG - Intronic
1192299004 X:69880993-69881015 AGGAAGTTAAAGTTTCTACATGG - Intronic
1193383487 X:80843889-80843911 AGTGTGTTAAAGCTAGTAAAAGG - Intergenic
1193807726 X:86014396-86014418 AGAATGTTAAAGTTACCAGAAGG + Intronic
1194356965 X:92897292-92897314 AATATATTAAAGGTCCTATATGG - Intergenic
1194559383 X:95402377-95402399 AATATGGTACAGGTACTCCACGG + Intergenic
1196675126 X:118412201-118412223 AGTATGTTAAAGGTACTACAAGG + Intronic
1196692802 X:118578573-118578595 AGAATTGAAAAGGTACTACAGGG + Exonic
1199042832 X:143134022-143134044 AGTATATTAAAGTTACTGTATGG + Intergenic
1200665297 Y:6014286-6014308 AATATATTAAAGGTCCTATATGG - Intergenic
1200753178 Y:6965670-6965692 AGTATAATAAAAGTACTGCAAGG + Intronic