ID: 1196676069

View in Genome Browser
Species Human (GRCh38)
Location X:118421149-118421171
Sequence CTGCTTTGCTTTAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 309}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196676062_1196676069 27 Left 1196676062 X:118421099-118421121 CCGCTTCCTCCATAAAGCCTCAC 0: 1
1: 0
2: 12
3: 62
4: 506
Right 1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 309
1196676065_1196676069 10 Left 1196676065 X:118421116-118421138 CCTCACTGACTAATGTAGCAGAG 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 309
1196676061_1196676069 28 Left 1196676061 X:118421098-118421120 CCCGCTTCCTCCATAAAGCCTCA 0: 1
1: 2
2: 2
3: 29
4: 305
Right 1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 309
1196676064_1196676069 18 Left 1196676064 X:118421108-118421130 CCATAAAGCCTCACTGACTAATG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 309
1196676063_1196676069 21 Left 1196676063 X:118421105-118421127 CCTCCATAAAGCCTCACTGACTA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196676069 Original CRISPR CTGCTTTGCTTTAGGGAAAA GGG Intronic
901293904 1:8146050-8146072 CTGTTTGGCTTGAGGGAATACGG + Intergenic
901315329 1:8303534-8303556 ATGCTTTGATTTAAAGAAAAAGG + Intergenic
902294619 1:15458212-15458234 CTGCTCTGCTTTAAAGAAACGGG - Intronic
903010128 1:20323947-20323969 CAGCTTTTCTATATGGAAAATGG - Intronic
904801551 1:33096592-33096614 CTGCTTTGATTTCCGGAAGAAGG - Intronic
905524795 1:38628165-38628187 TTTGTTTGTTTTAGGGAAAAAGG + Intergenic
906307101 1:44726346-44726368 CTGCTCTGCTTTATGGAACCTGG - Intergenic
906546431 1:46622563-46622585 CTGCTTAGCCTTAGGCAAAGCGG - Intergenic
906964293 1:50441443-50441465 CTCTTTTGCTTCAAGGAAAAGGG + Exonic
908026083 1:59952910-59952932 TCGCTTTGCTTTAGGGAAACAGG + Intergenic
908453776 1:64282006-64282028 CTGCTTTGGTTCAGGGCACAAGG - Intergenic
908661032 1:66435300-66435322 CTGCTTTACTACTGGGAAAAGGG - Intergenic
908903557 1:68983088-68983110 ATGCCTTGCTTTAGGAGAAAGGG + Intergenic
909141522 1:71872516-71872538 ATGCTTTGCTGGAGGGAAAAGGG - Intronic
909186890 1:72498732-72498754 CTGCTTTGTGTTGGGGCAAAGGG - Intergenic
910494099 1:87806711-87806733 CTGTTTTGCCTTATGAAAAAGGG + Intergenic
910862465 1:91755454-91755476 CAGGCTTCCTTTAGGGAAAACGG - Intronic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
913126838 1:115798806-115798828 CTGTTTTCCTTTAGGAATAAAGG - Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919108001 1:193177983-193178005 CAGCTTTGCTTTTGGTCAAAGGG - Intronic
919612811 1:199767108-199767130 CTGTTTTGTTTCAGGGAATAGGG - Intergenic
922136344 1:222830915-222830937 CTTTTTTGTTTTAGGGATAATGG + Intergenic
922797249 1:228346438-228346460 CTGGCTGGCTTTAGAGAAAAAGG + Intronic
923646277 1:235823616-235823638 TTGCTTTGCTTTTGGTAAAACGG - Intronic
924803332 1:247343771-247343793 ATGGCTGGCTTTAGGGAAAAGGG + Intergenic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1063374859 10:5548270-5548292 CTGCTTGGGTTTAGGCAAACAGG + Intergenic
1063795406 10:9508651-9508673 CTCCTTTGGTTAATGGAAAATGG + Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1065059266 10:21881514-21881536 CTGCTGTGCCTTAGGGAGTAGGG + Intronic
1065976753 10:30848472-30848494 CTGTTTTGATTTGGGGAAGAGGG - Intronic
1066285460 10:33961965-33961987 CTGATTTGATATAGGCAAAAAGG + Intergenic
1068188929 10:53624609-53624631 TTGGTTTTCTTTAGGCAAAACGG - Intergenic
1068611315 10:59063519-59063541 ATGGTTGGCTTTGGGGAAAAGGG - Intergenic
1068703422 10:60045658-60045680 TTGTTTTGTTTTAGGGAAAATGG + Intronic
1072012672 10:91317167-91317189 CTGCTTTGCTGTAATGAAAATGG + Intergenic
1073024330 10:100475788-100475810 CCCCTTTGCTTTGGGGAAAGGGG - Intronic
1075391485 10:122095723-122095745 CAGCGTTGCTGTAGGGAACAGGG - Intronic
1079722399 11:23834448-23834470 CTGCTGTGTCTTAGGGAATAGGG + Intergenic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1081574516 11:44310676-44310698 GAGCTTTGCCTTAGGGCAAAGGG + Intergenic
1084487743 11:69460675-69460697 AGGCTATGTTTTAGGGAAAAGGG + Intergenic
1084608918 11:70188426-70188448 GTGCGATGCTTCAGGGAAAATGG + Exonic
1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG + Intergenic
1088063280 11:105683776-105683798 CTGCTTTGCTTTTGTCATAAGGG - Intronic
1089035948 11:115391625-115391647 TTGTTTTGTTTTGGGGAAAAAGG - Intronic
1089164925 11:116468467-116468489 GAGCTTTGCTTTAAGTAAAATGG - Intergenic
1089344630 11:117783177-117783199 ATACTTTGCTTTTGGGAACAGGG + Intronic
1089398926 11:118153261-118153283 TTGCTTTGCTTGGGGGAACACGG + Intergenic
1090613441 11:128492791-128492813 CAGTTTTACTTTAGAGAAAAGGG + Intronic
1092210293 12:6641517-6641539 CTGCTCTGCTCCAGGTAAAAGGG + Intronic
1093096540 12:14978200-14978222 CTGCTTTTGTTTTGGGAAATTGG + Intronic
1093926555 12:24913925-24913947 ATGGTTGGCTTTGGGGAAAAGGG + Intronic
1094662642 12:32485316-32485338 CTTTTTTGCTTTTGGGAATATGG + Intronic
1095313530 12:40729673-40729695 CTGCTTTATTTTAGGCACAATGG - Intronic
1095360139 12:41327472-41327494 CTGCTTTAATTTTGGGAAAGTGG + Intronic
1097140147 12:56895676-56895698 CTCCTTTGTTTTAAGGTAAATGG + Intergenic
1097494524 12:60314039-60314061 ATGACTAGCTTTAGGGAAAAGGG - Intergenic
1097557462 12:61156941-61156963 ATGGTTGGCTTTAGGAAAAATGG + Intergenic
1098899893 12:76101903-76101925 CTGCTTTGCTGTAGGGGAAGGGG - Intergenic
1099072693 12:78065829-78065851 CTGTTTTGTTTTGGGGAGAAAGG + Intronic
1099571518 12:84325944-84325966 CTGCTTAGTCTTATGGAAAATGG - Intergenic
1100322112 12:93505454-93505476 CTCCTTTGCTTTTAGGCAAAGGG + Exonic
1101229997 12:102731115-102731137 CTGCTTTGCTTTCTGGAAGCAGG - Intergenic
1101869173 12:108548527-108548549 ATGCTTTGCAGAAGGGAAAAGGG + Intronic
1103593989 12:122012057-122012079 CTGCTTAGCTTAAGTGGAAAAGG + Intergenic
1103864945 12:124044228-124044250 CTGCTTTGCTGTAGGGTTGAGGG + Intronic
1105939797 13:25137511-25137533 CTGCTCTGCTTTATGGAACTAGG + Intergenic
1106280232 13:28260589-28260611 CTCCTGTGCTTTAGTGAACAGGG + Intronic
1108961592 13:56239139-56239161 CTCCTTTGCCTTAATGAAAATGG - Intergenic
1109254695 13:60064923-60064945 TTGCTGTGCTTCAGGGAATAGGG + Intronic
1109559798 13:64031932-64031954 ATGCTTTGCTTTAAAAAAAAAGG + Intergenic
1109697192 13:65976610-65976632 GTGCTCTGCCTTTGGGAAAATGG - Intergenic
1110656913 13:78011317-78011339 TTGTTTTGCTTTAGGGATAAAGG + Intergenic
1111398721 13:87703535-87703557 CTACTTTGCTGTGGGAAAAATGG + Intergenic
1112921585 13:104619800-104619822 TTGCTTTGCTTTAAGGCAATAGG - Intergenic
1113103054 13:106741636-106741658 CTTCTTTGATTTAGGTAAACAGG + Intergenic
1113593379 13:111515614-111515636 CTCCTTTGCTTTCGGGAAACTGG + Intergenic
1114500117 14:23162299-23162321 CTTATTTCCTTTAGGGGAAATGG - Intronic
1115374375 14:32657153-32657175 CTGATTTGACATAGGGAAAAAGG + Intronic
1116039923 14:39673745-39673767 TTCCTTTTCTTTGGGGAAAATGG - Intergenic
1116117324 14:40671672-40671694 ATGATTTGGTTTAGGGGAAAAGG - Intergenic
1117919899 14:60718694-60718716 TTGCATTTCTTTAGGCAAAATGG - Intronic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1120017206 14:79487564-79487586 ATGCTTTGCTTTGGGGAAACAGG - Intronic
1120662834 14:87270872-87270894 CTGCCTTTCTTTGGGGAAAATGG + Intergenic
1120786230 14:88539599-88539621 TTGCTTTTCTTTTAGGAAAATGG + Intronic
1121136625 14:91504724-91504746 CTACCTTGCTTTAGAGGAAAAGG - Intronic
1122723971 14:103738615-103738637 CTGCTTTGCATAAGGAAAACAGG - Intronic
1123041839 14:105493443-105493465 CTGCTTGGATCTAGGGAAATGGG - Intronic
1123568498 15:21577562-21577584 GTGCTTTGCTTAGGGGAAGAGGG - Intergenic
1123604607 15:22012886-22012908 GTGCTTTGCTTAGGGGAAGAGGG - Intergenic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1124920088 15:34017319-34017341 CTGCTTAACTTTATGGAACAGGG - Intronic
1125244809 15:37622794-37622816 CTGCTATTCTTTAGGTAAATGGG + Intergenic
1126208757 15:46076013-46076035 TTGATTGGCTTAAGGGAAAAAGG + Intergenic
1127027855 15:54827878-54827900 CTGGTTTATTTTTGGGAAAAGGG + Intergenic
1127211209 15:56776789-56776811 CTGGTTTGCTTTAGGGAAGAGGG - Intronic
1128888566 15:71310749-71310771 ATGGTTGGCTTTGGGGAAAAGGG + Intronic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1129956560 15:79642394-79642416 CTGCTTTGATTTAGAGCAAGAGG - Intergenic
1130206060 15:81876929-81876951 TTGCTTTGATATAGGTAAAATGG - Intergenic
1131795856 15:96016184-96016206 CTTCTTTAATTTAGGGGAAAAGG + Intergenic
1132176061 15:99716159-99716181 CTGCTTTGCTATATTTAAAATGG + Exonic
1202976854 15_KI270727v1_random:304649-304671 GTGCTTTGCTTAGGGGAAGAGGG - Intergenic
1134531726 16:14989248-14989270 CTGCTTTGCTTTTGGGCACCTGG + Intronic
1134537955 16:15041590-15041612 CATCTTTGCTTTGGGGCAAATGG + Intronic
1136028023 16:27482330-27482352 CTGCTTGGCATTTGGGAAAAAGG + Intronic
1138149936 16:54647488-54647510 GTACTTTGCTTTAGGGCACATGG - Intergenic
1138525228 16:57601362-57601384 CTCCTTTGCTTTAGTGATGAAGG + Intergenic
1139898608 16:70309145-70309167 CTGCTTTGGTGTTGGGAAAGAGG - Intronic
1140268224 16:73439074-73439096 TTGCTTTGGTTTAGGGAGGAAGG - Intergenic
1140844798 16:78876362-78876384 CTCCTTTCCTTTTGTGAAAAAGG + Intronic
1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG + Intergenic
1141863280 16:86732736-86732758 TTGCTTTGCTGTAGGAAAGACGG + Intergenic
1145056199 17:19705572-19705594 CTGCTTTGCTTTGGGGACTCAGG + Intronic
1147490340 17:40860173-40860195 ATGTTCTGCATTAGGGAAAAAGG - Intergenic
1150356170 17:64486730-64486752 ATGGTGTGCTTTAGGGAAAGGGG + Intronic
1150984189 17:70176636-70176658 ATGCTTCTCTTTAGGGAACAAGG + Exonic
1154324802 18:13382175-13382197 CTACTTTGATTTTGGAAAAAAGG + Intronic
1155239505 18:23852040-23852062 CTGACTGGCTGTAGGGAAAATGG - Intronic
1155452908 18:25981581-25981603 ATGTTTTGCTTTAAGAAAAAGGG + Intergenic
1156292127 18:35756402-35756424 CAGCTTTGCTTTAGGGGGCATGG + Intergenic
1156652979 18:39249514-39249536 CTGCTTTTCTTTTAGGATAAAGG + Intergenic
1156710365 18:39936924-39936946 CTCCTTTGAGTTAGGGAACATGG + Intergenic
1156956246 18:42967807-42967829 CTGCTTGCCTTTAGAGCAAATGG + Intronic
1160162914 18:76488920-76488942 CTATTTTGATTTAGGGGAAAAGG - Intronic
1165352103 19:35281208-35281230 CTGCTGTGTTTTAGGGGAGATGG + Intronic
1166977380 19:46612617-46612639 CAGCTGGGCTTTAGGGTAAATGG + Intergenic
925177012 2:1793183-1793205 CTGCATTTCTCTAAGGAAAAAGG + Intronic
926726128 2:15999413-15999435 CTTCTTTTCTCCAGGGAAAATGG + Intergenic
927874265 2:26644248-26644270 CTTCTTTGCTCTAGGGAAGGCGG + Intergenic
928246864 2:29638083-29638105 AAGGTGTGCTTTAGGGAAAACGG - Intronic
928712709 2:34025271-34025293 CTGCTTTGCATTTTGGAAAATGG - Intergenic
930108024 2:47655285-47655307 CTGCTTTGCTTGTGGGGCAAAGG + Intergenic
930410959 2:51026903-51026925 CTGCTTTTCGTTGTGGAAAAAGG - Intronic
931457123 2:62419170-62419192 CTGTTTCCCTTTAGTGAAAATGG - Intergenic
933636319 2:84712461-84712483 CAGATTTGCTTTGAGGAAAAAGG + Intronic
933771665 2:85748547-85748569 CTGCTGTGCTTTATGGAGACTGG - Intergenic
936856383 2:116962916-116962938 CTGCGTTACTATGGGGAAAATGG + Intergenic
937296601 2:120813282-120813304 CTGCATTGCTTTGGGGAAGAAGG + Intronic
939757061 2:146127664-146127686 CTGCTTTCCTATAAGGAATATGG + Intergenic
939920658 2:148108112-148108134 TTGCATTTCCTTAGGGAAAAGGG + Intronic
941426903 2:165358438-165358460 CTGCTTCATTTTAGGGAAAATGG + Intronic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
942419637 2:175794809-175794831 ATGGCTTGCTTTGGGGAAAAGGG + Intergenic
942646779 2:178120123-178120145 CTTCTTTGCTTTCTGGAAGATGG - Intronic
942761098 2:179399293-179399315 CTTCTTTCCTTTAGGGTACAAGG - Intergenic
943404108 2:187457826-187457848 CTGCTTTATTTTAGAGAAAGTGG + Intergenic
945427829 2:209729145-209729167 CTGGTTAGCATTAGGGAAAATGG + Intronic
946059073 2:216926308-216926330 ATGCTTTGCCTCAAGGAAAAAGG - Intergenic
947283605 2:228484162-228484184 CTGCTTTCCTTTAGGGAGTCTGG - Intergenic
947704501 2:232263324-232263346 CTGCTATGCTCTGGGGAAATGGG - Exonic
947837535 2:233186492-233186514 CTTCTTTGCTATAGAAAAAATGG + Intronic
948207631 2:236170825-236170847 CTGCATTGCATTTGCGAAAAAGG - Intergenic
1168904976 20:1395837-1395859 CTGCTAGGCTTCAGGGAAAACGG - Intergenic
1169253835 20:4082764-4082786 CTGACTTGCTCTAGGGAAAGGGG + Intergenic
1169604521 20:7301759-7301781 CAGCTTTGGTTAAGGTAAAAGGG - Intergenic
1169719748 20:8661639-8661661 CTGCCTTGTTTTAGGATAAAGGG + Intronic
1169788928 20:9389109-9389131 CTGCTTAGCTTTAGAAAGAAAGG - Intronic
1170097004 20:12657020-12657042 GTGGTTTGAGTTAGGGAAAACGG - Intergenic
1170104070 20:12734833-12734855 CTGTCTTGCTACAGGGAAAAAGG - Intergenic
1177650347 21:23952344-23952366 CTGCTCTGTATTGGGGAAAATGG + Intergenic
1179149631 21:38798871-38798893 CTGCTCTAGTTTAGGGGAAAAGG - Intergenic
1181315283 22:21967091-21967113 CTGCTTGGCTGTTAGGAAAACGG - Intronic
1181818044 22:25454268-25454290 TTGTTTTGCTTTTGGAAAAATGG + Intergenic
1182274071 22:29173637-29173659 CTGGTTTGCTTTAAAAAAAACGG + Intergenic
1183406964 22:37634944-37634966 ATGCTTTCCTTTCTGGAAAAGGG + Intronic
1183500359 22:38175151-38175173 CTGCTTTTCTGTAGTGAAAGGGG + Intronic
1183814296 22:40286741-40286763 GTGCTTTGTTTTGGGGATAAAGG + Intronic
1183904516 22:41030413-41030435 CTGTGTTGCTTTAGTGAAGATGG + Intergenic
949219148 3:1608833-1608855 CTCCTTTGCTTTGATGAAAAAGG - Intergenic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
950113586 3:10435953-10435975 CTGCTTTCCTTTAGGGGATTTGG + Intronic
950707310 3:14791005-14791027 CTGCTCTGCCTTAGTTAAAAGGG - Intergenic
950834541 3:15906421-15906443 CTTCCTTGCTGTAAGGAAAATGG + Intergenic
950916582 3:16652026-16652048 CTTGTTTGCTTTTAGGAAAAGGG + Intronic
953067245 3:39484913-39484935 TTGCTTTGTTTTAGGCAACAAGG - Intronic
955141878 3:56277779-56277801 CTAATTTTCTTTAGGGAAACTGG + Intronic
955378720 3:58419618-58419640 ATGGCTTGCTTTGGGGAAAAGGG + Intronic
955819552 3:62881672-62881694 ATGGCTTGCTTTAGGGAAAAAGG + Intergenic
956541095 3:70340558-70340580 CTGCCTTCCTTCAGGGAACATGG + Intergenic
957864366 3:86003137-86003159 ATGCTTTACTCTAGAGAAAATGG + Intronic
958634849 3:96730669-96730691 ATGCTGTCCTTTAGGGTAAAGGG + Intergenic
958844403 3:99248778-99248800 CTGGTTTTCTTTAGGGAGAGAGG + Intergenic
959813337 3:110644903-110644925 TTGTTTGGCTGTAGGGAAAAGGG - Intergenic
960611260 3:119556780-119556802 CTTCTTTGTTTTTGGGAAACTGG + Intronic
961061909 3:123835765-123835787 CTGGCTGGCTTTAAGGAAAAGGG - Intronic
961209099 3:125111511-125111533 CTACTTTCCTTTAGGCACAATGG + Intronic
961981319 3:131082052-131082074 CTGCTTTGCTTGGAGGAAAGTGG + Intronic
963061257 3:141229125-141229147 CTAATTTGCTTGGGGGAAAATGG + Intronic
963271328 3:143288895-143288917 CTGTTTTGCCTTAGGTAAGAGGG - Intronic
963733486 3:148993349-148993371 CTGCTTTTCTTTGGAGAAGAAGG - Intronic
964324181 3:155528503-155528525 CTGCTTTGTTTTAGGTACCATGG + Intronic
964392196 3:156209374-156209396 ATGCTCTCCTTTAGGGGAAAAGG + Intronic
964650838 3:159009494-159009516 CTGCTGTGCATTAGGGATACAGG - Intronic
964761835 3:160141815-160141837 CTGCTTGCCTTTGGGGAAGAAGG - Intergenic
965224188 3:165966693-165966715 CTGTTATGTCTTAGGGAAAAGGG - Intergenic
966080303 3:175992074-175992096 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
967817891 3:193814696-193814718 CTGATTTGCTTCAGGGAAAGGGG + Intergenic
970153684 4:13118707-13118729 ATGCTTTGCTGTAGGGAAGGAGG - Intergenic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
970789185 4:19836349-19836371 ATGTGTTGCTTTAGGGATAAGGG - Intergenic
971141789 4:23932561-23932583 ATTGTTTACTTTAGGGAAAATGG + Intergenic
971960854 4:33485341-33485363 GTGCTTTCCTTTAGTGAAAGTGG - Intergenic
972217846 4:36916915-36916937 ATGCTCTGCCTTAGGGAAGAGGG - Intergenic
972474109 4:39434442-39434464 CTTCTCTGCTTCAGAGAAAATGG - Exonic
974190304 4:58495372-58495394 CCGCTTTGCTTAAGGGAATCTGG - Intergenic
974640148 4:64619472-64619494 CTGATTTGCTTTTGGGAATGAGG - Intergenic
974817671 4:67026274-67026296 ATCCTATGCTTTAGGGAACAAGG - Intergenic
976386527 4:84465778-84465800 CTGTTTTGTTTTAGTGACAAAGG + Intergenic
976646650 4:87394355-87394377 CTTTTTTGCGTTAGGGAAGAAGG - Intergenic
977106963 4:92898558-92898580 CTGCTTTGCATCAGGGGAAAAGG + Intronic
978214966 4:106188968-106188990 CTGCATTATTTTATGGAAAAGGG - Intronic
978223400 4:106304643-106304665 CTGATTTTCTTCAGGGAGAAAGG - Intronic
978382380 4:108143260-108143282 TTGTTTTGCTTTAGAGGAAAGGG + Intronic
979008127 4:115330664-115330686 CTGTTTTACTGTTGGGAAAATGG + Intergenic
979135278 4:117103680-117103702 CTGGCTTGCTTTGGGGAAATGGG - Intergenic
979404802 4:120296498-120296520 CTGATTTTCTTTATGGAAAGAGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982791123 4:159592643-159592665 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
983166343 4:164481748-164481770 CTGCTCAGCTTGGGGGAAAAAGG + Intergenic
984108205 4:175576645-175576667 CTGCTTTGTCACAGGGAAAATGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984666627 4:182436174-182436196 CTTCTTTGCTTAAGGGAGTATGG + Intronic
985682737 5:1265041-1265063 CTGCTGTGCTTTAGACAAAGGGG + Intronic
986317614 5:6601077-6601099 CTGCTTTACATTAGGAAAAATGG - Intronic
990365887 5:55069835-55069857 CTGCTTTCCTTTTGGTAAACAGG + Intergenic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
990445370 5:55888905-55888927 CTCCTGTGCTTTAAGGAAATTGG - Intronic
990501339 5:56399476-56399498 ATGCTTTGATACAGGGAAAAAGG + Intergenic
990962335 5:61407859-61407881 CTGATTTGCATGAGGGAAATAGG + Intronic
992673930 5:79086302-79086324 CTACTTTGCTTGTGGGCAAAAGG - Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993124452 5:83815972-83815994 CTGCTTTCCTTAGTGGAAAAAGG - Intergenic
993898362 5:93566266-93566288 TTGCTTTGCTGAAAGGAAAAAGG - Intergenic
996111737 5:119573714-119573736 CTTCCTTGCCTTAGGCAAAAAGG - Intronic
998086136 5:139325218-139325240 CTGCTTTACTTGAAGGGAAACGG - Intronic
998427446 5:142040832-142040854 ATGGCTGGCTTTAGGGAAAAGGG - Intergenic
998929884 5:147169783-147169805 ATGCTTTGTTTGAGGGCAAAAGG - Intergenic
999356959 5:150944323-150944345 CTGCTTTGGTTTAGGAAATAAGG - Intergenic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
1000130261 5:158290416-158290438 CAGCATTGCTTTAGGGAAGGGGG + Intergenic
1002552125 5:180002383-180002405 CAGCTTAGCCTTAGGGACAAAGG + Intronic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1003178292 6:3770361-3770383 CATCTTTTCTTTAAGGAAAAGGG + Intergenic
1003237977 6:4315842-4315864 CAGGTTTGCTTTCAGGAAAATGG - Intergenic
1004623658 6:17354232-17354254 TTGCTTTGCATCTGGGAAAAAGG - Intergenic
1005444197 6:25904218-25904240 AAGCCTTGCTTTAGGTAAAAGGG - Intergenic
1005477254 6:26219859-26219881 GTGGTTGGCTTTGGGGAAAAAGG - Intergenic
1006207937 6:32365974-32365996 TTGCATAGCTTTGGGGAAAATGG + Intronic
1007947925 6:45842459-45842481 CAGGTTTGCATTAGGGAAAGGGG + Intergenic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1008161464 6:48081321-48081343 CTGCTCTGTTTTAGGAATAATGG + Intergenic
1008295237 6:49767640-49767662 CTTCTTTGCTGTAGGAACAAAGG + Intergenic
1008493199 6:52107091-52107113 GTGCATTGATTTAGTGAAAAAGG - Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009031426 6:58063265-58063287 CTGGCTGGCTTTGGGGAAAAGGG + Intergenic
1009207276 6:60817718-60817740 CTGGCTGGCTTTGGGGAAAAGGG + Intergenic
1010995365 6:82525681-82525703 CTGCTTTGTTTGGGAGAAAATGG + Intergenic
1011512415 6:88115594-88115616 CTGTTTTGCATTAGGAAACATGG - Intergenic
1012189533 6:96262174-96262196 CTCCTTTGCTTTTGGAAAGAGGG + Intergenic
1012191140 6:96281587-96281609 ATGGTTTGCTTTGGGGCAAATGG - Intergenic
1012404470 6:98879343-98879365 CTACATTGTTTTAGGGAACAGGG + Intronic
1012694633 6:102363304-102363326 CCGCTTTGCTTAAAGGAAGAAGG + Intergenic
1013812491 6:114060697-114060719 CTGCTTTGTTTGAGGTCAAATGG + Intronic
1013939071 6:115638895-115638917 TTGTTTTTCTATAGGGAAAAGGG - Intergenic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1015042433 6:128738404-128738426 ATGATTTGCTTTAGGGGAAAGGG + Intergenic
1016828365 6:148408909-148408931 GTGATTTGCTTTGGAGAAAAAGG + Intronic
1017995568 6:159529105-159529127 GTGATTTCCTTTGGGGAAAAGGG + Intergenic
1018540520 6:164874737-164874759 CTGCTTTGGTTTAATGAAGAAGG + Intergenic
1019632338 7:2056412-2056434 CTGCTCTGCTCTAGGGAAAGAGG + Intronic
1020090883 7:5339967-5339989 TTGTTGTGCTTTAGGGAATAGGG - Intronic
1021502517 7:21346360-21346382 CTGCTTTGCTTTAAGGACTCAGG - Intergenic
1021568828 7:22043945-22043967 CTGCTTAGCTATAATGAAAAAGG + Intergenic
1021836701 7:24683649-24683671 CTGGTTTCTTTTAGGGTAAATGG + Intronic
1022002846 7:26242573-26242595 ATGATTTTCTTTAGGGGAAAAGG - Intergenic
1023063408 7:36351473-36351495 TTGCTCTGGTGTAGGGAAAAAGG + Intronic
1023232199 7:38045746-38045768 CTGCATTGCTTGAGGCAACATGG + Intergenic
1026197087 7:68182519-68182541 CTGATTTTCTTTAGTGAGAAAGG - Intergenic
1026639452 7:72111357-72111379 CTGCTTCCCTTTAGGGAGGAGGG - Intronic
1027943765 7:84719507-84719529 CTGCTTTATTTTAGGGGAGAGGG + Intergenic
1028264723 7:88708937-88708959 CTGCTTTACTTTGGGAGAAATGG + Intergenic
1028282063 7:88943129-88943151 CTGCTTAGCTTTCGTGAATACGG + Intronic
1029456426 7:100674520-100674542 CAGCTTTCTTTTAGGCAAAATGG + Intronic
1032142891 7:129349824-129349846 CTGCTTTGTTTTGGGAAAAGGGG + Intronic
1032771147 7:135058433-135058455 CTGCATTGCTTTATGTAGAATGG + Intronic
1033674736 7:143529181-143529203 CTGCTTTAATTTAAGGAATAAGG - Intergenic
1033697100 7:143800258-143800280 CTGCTTTAATTTAAGGAATAAGG + Intergenic
1034860593 7:154591768-154591790 CTGGGTTTCTTTAGGGGAAAAGG + Intronic
1037938735 8:22933192-22933214 CTGCTTTGCCTAAGGGAAAAGGG + Intronic
1038080587 8:24131221-24131243 CTGCATTTTTTTAGGGTAAAAGG - Intergenic
1038661318 8:29499479-29499501 CTGCTTTGCTTTAGCTGAAAGGG + Intergenic
1039304770 8:36249559-36249581 ATGGCTAGCTTTAGGGAAAAGGG + Intergenic
1041926520 8:63242664-63242686 CTGATTTGCTGTAGGCAGAAGGG + Intergenic
1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG + Intronic
1046021549 8:108671455-108671477 CTGCTTTTCTTTTGGGCACAGGG - Intronic
1046098720 8:109590116-109590138 GTGCTTAGCTTCAGTGAAAATGG - Intronic
1048024926 8:130577643-130577665 CTGCTTTTCAGTAGGTAAAAGGG + Intergenic
1048490792 8:134891759-134891781 CTGTTTTCCTTTAAGTAAAAAGG - Intergenic
1048801873 8:138201654-138201676 CTGCTTTGTGCTAGGGAAAATGG - Intronic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1049248372 8:141575022-141575044 CTGCTTTGCTGTAAAGATAAAGG - Intergenic
1050212955 9:3284775-3284797 CTCCTTTATTTTAGGTAAAATGG + Intronic
1052641718 9:31176167-31176189 TTGTTTTGACTTAGGGAAAATGG - Intergenic
1055430685 9:76240308-76240330 CAGCTCTGCTTCTGGGAAAATGG - Intronic
1055728950 9:79261112-79261134 CTGGTTGGATTTGGGGAAAAGGG - Intergenic
1056633569 9:88313604-88313626 ATGCTTTGCTTTTAGGAGAAAGG - Intergenic
1057360105 9:94365570-94365592 CTCTTTTGCTTAATGGAAAATGG + Intergenic
1057663235 9:97022518-97022540 CTCTTTTGCTTAATGGAAAATGG - Intergenic
1058785034 9:108378635-108378657 CTGCTTGGCTCTAGGGAAGAAGG + Intergenic
1059541850 9:115138160-115138182 CTGCTTTCTTTAAGGGAGAAAGG + Intergenic
1060623066 9:125084945-125084967 CTGCGTGACTTTGGGGAAAATGG - Intronic
1061358970 9:130128797-130128819 CTGCTTTGTGTTAGGCAAAGGGG - Intronic
1185563589 X:1079368-1079390 CTGGTTTGGTTTAAGGAAACAGG + Intergenic
1185814689 X:3143979-3144001 ATGCTTGGCTTTGGGGAAAAGGG + Intergenic
1185961350 X:4548852-4548874 CTGCTTTGCTTTAGCCACACTGG - Intergenic
1186058813 X:5681449-5681471 CTGCTTATCTTTAGAGAAAGAGG + Intergenic
1186706257 X:12142086-12142108 CTTCTTTTCTTTAAGCAAAACGG + Intronic
1186992129 X:15081640-15081662 CTGATTTGTATTATGGAAAATGG + Intergenic
1188230932 X:27661686-27661708 GTGCTTAGCTTTTAGGAAAATGG + Intronic
1189453619 X:41163339-41163361 CTGATTGGCTTGAGGGGAAAAGG + Intronic
1190752160 X:53372104-53372126 CCTCTTTGCTTTAGTCAAAATGG + Intergenic
1192830140 X:74742722-74742744 AAGCTTTGCTTTTGGGAAAAAGG + Exonic
1193753589 X:85378869-85378891 CTGCTTTGCAGTAGGGGCAAAGG + Intronic
1194640621 X:96399654-96399676 CTACTTTACATTAGGTAAAATGG - Intergenic
1195168646 X:102245100-102245122 TTGCTAGGCTTTAGGGAAAGGGG - Intergenic
1195190211 X:102441987-102442009 TTGCTAGGCTTTAGGGAAAGGGG + Intronic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1197574635 X:128196403-128196425 ATACTTTGCTTTGGGGTAAAAGG + Intergenic
1198366425 X:135944853-135944875 CTTCTTGGCTTTTAGGAAAAAGG + Intergenic
1198554663 X:137780182-137780204 CTGCTTGGCTTTGGGGGACATGG + Intergenic
1198889311 X:141375381-141375403 ATGGTTTGCTTTAGAGAAAAAGG + Intergenic
1200172941 X:154091778-154091800 TTGCTTTGGTTTGGGGTAAATGG - Intronic
1201266514 Y:12212221-12212243 ATGCCTGGCTTTGGGGAAAAAGG - Intergenic
1201285215 Y:12373651-12373673 CTGCGTTTCTTTTAGGAAAATGG + Intergenic
1201332775 Y:12845251-12845273 CTGCTTTATATTAGGGAAACTGG + Intronic