ID: 1196678745

View in Genome Browser
Species Human (GRCh38)
Location X:118448615-118448637
Sequence GGATGCTTGGACCTATTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196678745_1196678752 11 Left 1196678745 X:118448615-118448637 CCTAGGAATAGGTCCAAGCATCC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1196678752 X:118448649-118448671 GACTGTAATATCCTCAAGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1196678745_1196678753 12 Left 1196678745 X:118448615-118448637 CCTAGGAATAGGTCCAAGCATCC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1196678753 X:118448650-118448672 ACTGTAATATCCTCAAGCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196678745 Original CRISPR GGATGCTTGGACCTATTCCT AGG (reversed) Intronic
901470176 1:9450568-9450590 GGAGGCTTGGACCTGCTCCAGGG - Intergenic
904615428 1:31746858-31746880 GGAGGCCTGGATCTGTTCCTGGG - Intronic
906202291 1:43967834-43967856 GGATGCTTGGACCCAGGCCTTGG + Exonic
906635497 1:47407439-47407461 GTAAGTTTGGATCTATTCCTTGG - Intergenic
909460210 1:75903338-75903360 AAATGCTTGGACTTATTTCTGGG + Intronic
910376489 1:86577377-86577399 GAATGCTGGGACCTTTCCCTAGG + Intronic
910821764 1:91358480-91358502 GTATGTTTGGACTTATTTCTGGG - Intronic
911536768 1:99109089-99109111 GGATGCTGGGATTAATTCCTAGG + Intergenic
915930468 1:160057733-160057755 GTATGATGAGACCTATTCCTTGG + Intronic
916082027 1:161239835-161239857 AGATGCTTGGATCTGTTCCTTGG + Intergenic
917821568 1:178768894-178768916 AGATGCTTGGAGATATGCCTGGG + Intronic
918667573 1:187171506-187171528 GGATACTTGGAATTATACCTGGG + Intergenic
918667593 1:187171619-187171641 GAATGCTTGGAATTATGCCTGGG + Intergenic
918784884 1:188751889-188751911 GGCTGCATGGACCTCTGCCTAGG - Intergenic
923058202 1:230445422-230445444 GTATGTTTGGATTTATTCCTGGG - Intergenic
1063913480 10:10855724-10855746 GGATCCTTGGAGGTATTCATAGG + Intergenic
1066147654 10:32578099-32578121 GGATGCCTAGACCTCTTCCAAGG + Intronic
1068757685 10:60672705-60672727 GGTTCCTAGGACCCATTCCTTGG - Intronic
1071135303 10:82446681-82446703 GGATGCTTGGCTTAATTCCTGGG + Intronic
1083474835 11:62909124-62909146 TGATGCTTGGACATTTGCCTTGG + Exonic
1087604946 11:100366205-100366227 GGATGCCTGGACTTCTTCCTGGG + Intergenic
1088432456 11:109773843-109773865 GGATGATTGCATATATTCCTGGG - Intergenic
1095092713 12:38121775-38121797 GGATGCTGGGACAGATTCCATGG + Intergenic
1096845247 12:54403077-54403099 GGAAGTTTAGACCCATTCCTGGG + Intronic
1108596680 13:51955603-51955625 AGTTGCTTGGAACTATTCCAGGG - Intronic
1108864960 13:54911975-54911997 GAATGCTTGGAGATTTTCCTAGG - Intergenic
1113043885 13:106133340-106133362 GGATGCTTACACTTATTTCTGGG + Intergenic
1115082436 14:29472780-29472802 GTATGCTTGGTTCTATCCCTTGG + Intergenic
1117481160 14:56146384-56146406 AGATTCATGGACCTATTCTTAGG - Intronic
1120147073 14:80990304-80990326 GGCTGTATGGACCTATGCCTTGG + Intronic
1132048957 15:98591156-98591178 GTTTTCTTGGACCTATTCCATGG - Intergenic
1134384256 16:13757261-13757283 GGATGCTGGTCCCTAGTCCTTGG - Intergenic
1139752284 16:69116388-69116410 AGCTGCTTGGACGGATTCCTTGG + Exonic
1140050439 16:71476084-71476106 GGATTCTTGGAACCTTTCCTTGG + Exonic
1149137204 17:53381573-53381595 AGATGCCTGGACATCTTCCTGGG + Intergenic
1151808194 17:76419910-76419932 GCCTGCTTGGCCCCATTCCTCGG + Intronic
1154082055 18:11267356-11267378 ATATGTTTGGACCTATGCCTGGG + Intergenic
1156219024 18:35032652-35032674 GTGTGCTGGGACCTCTTCCTGGG + Intronic
1158087397 18:53668364-53668386 GGATGCTAGGACTAATACCTGGG + Intergenic
1158675915 18:59518023-59518045 GGAAACTTGCACCCATTCCTAGG + Intronic
1161758783 19:6155155-6155177 GTATGCATGGAGCTATTTCTGGG - Intronic
1164394921 19:27853897-27853919 GGATGTTTGAACCTATTGCAAGG + Intergenic
1166538664 19:43591965-43591987 GGATGCCTGGGCTTAATCCTGGG - Exonic
1167817919 19:51900385-51900407 GGATGCTTAGATATATTGCTTGG - Intronic
926318473 2:11729936-11729958 GGCTTCTTGGACCTATAGCTTGG + Intronic
926593062 2:14760059-14760081 GGCTGCTTGGAGCTGTTCCGGGG - Intergenic
927491245 2:23522504-23522526 GGATGCTTGTTCTTATTTCTGGG + Intronic
928828109 2:35444579-35444601 CGATGTTTGCACCTATTACTTGG - Intergenic
929146119 2:38708385-38708407 GGATGCTGGGACAGATTCCATGG - Intronic
930117404 2:47730346-47730368 GCATGCATGGATCTATTTCTGGG + Intronic
930462367 2:51698155-51698177 GGATGATAAGACCTAGTCCTAGG - Intergenic
935273812 2:101459138-101459160 GGATGTTTGAACCCATTGCTAGG - Intronic
946187137 2:217987524-217987546 GGTTGCCTGGACCTATAGCTTGG - Intronic
946802673 2:223437001-223437023 AGATGCTTTGACAGATTCCTTGG + Intergenic
946992620 2:225352282-225352304 TCATGCTTGGAACTATTCTTTGG - Intergenic
946992704 2:225353143-225353165 TCATGCTTGGAACTATTCTTTGG - Intergenic
947789817 2:232858695-232858717 GGGTGCTTGGAGCTTTTCCATGG - Intronic
1173121446 20:40293480-40293502 GGATGCGTGGACTTGTTTCTAGG - Intergenic
1173628818 20:44494258-44494280 GGATTCTTGTAGCTATGCCTCGG + Exonic
1174325855 20:49778233-49778255 CAATGCTTGGACATATACCTAGG - Intergenic
1175012185 20:55749202-55749224 GGATGCTGGGCCCAATACCTAGG + Intergenic
1176232681 20:64040149-64040171 GGGTGCTTGGACTTATCCCGAGG + Intronic
1177774111 21:25549240-25549262 GGATGCTTTGTCCTATCCCTGGG - Intergenic
1178585215 21:33865819-33865841 GGATGCCAGGACCTCTTCCTTGG + Intronic
1180013175 21:45064802-45064824 GGAGCCTGGGACCTGTTCCTGGG + Intergenic
1184287488 22:43479684-43479706 GGATGCATGGACCCATTCCCAGG + Intronic
951174974 3:19588537-19588559 GGCTGGTTGGACTTATTCCTTGG - Intergenic
954276422 3:49544718-49544740 AGAAGCCTGGACCAATTCCTTGG + Intergenic
955076174 3:55615566-55615588 GGATGCTAAGACCTTTCCCTGGG - Intronic
956737505 3:72248996-72249018 GGATGCTGGGAGCTATGCCTTGG - Intergenic
959471377 3:106755584-106755606 AGATGTATGGACCTATTTCTGGG - Intergenic
962150251 3:132885242-132885264 AAATGCATGGATCTATTCCTGGG - Intergenic
970802103 4:19985042-19985064 ATATGTTTGGACCTATTTCTGGG + Intergenic
971958448 4:33453923-33453945 AGATGCCTGGACATATGCCTGGG - Intergenic
975957246 4:79856222-79856244 GGATGGTTGGACTTCTTCCATGG - Intergenic
984171788 4:176368410-176368432 GAATGCGTGGACTTATGCCTGGG + Intergenic
995019394 5:107350230-107350252 GGATGTATGGATCTATTTCTGGG + Intergenic
995672596 5:114623952-114623974 AGATGCTTGGGCTTATTTCTTGG + Intergenic
996538635 5:124605773-124605795 GCTTGCTTGGACCTGTCCCTTGG - Intergenic
997632557 5:135379804-135379826 GGATGCTGGGTCCCACTCCTGGG + Intronic
997877384 5:137561392-137561414 GGATGCTTGACCCCATTCCAGGG - Intronic
999179765 5:149661051-149661073 GGATCCCAGGACCTATTTCTGGG - Intergenic
1000247509 5:159460922-159460944 GGGGTCTTGGAACTATTCCTTGG + Intergenic
1004338858 6:14789330-14789352 GGAAGCTTGAACCACTTCCTAGG - Intergenic
1011530640 6:88317427-88317449 GGATGCAAAGACCTGTTCCTGGG + Intergenic
1011845825 6:91561912-91561934 GAATGCTTGGAAATATCCCTGGG - Intergenic
1020344064 7:7144522-7144544 GGATGCTTGAACCCATTGCAAGG - Intergenic
1023219385 7:37903361-37903383 GGATACTTAGAGCTATCCCTGGG + Intronic
1025605810 7:63039164-63039186 GCCTGCTTGGACCAGTTCCTGGG - Intergenic
1034558884 7:151867112-151867134 GGACGCTGGGACCCCTTCCTGGG + Intronic
1036779140 8:11633822-11633844 GCAGGCTTGGACCAGTTCCTGGG + Intergenic
1037203578 8:16287354-16287376 GGACACTTTCACCTATTCCTGGG + Intronic
1037460254 8:19101580-19101602 GGATGCTGGGACCTCTTCCATGG + Intergenic
1038978721 8:32732100-32732122 GATTGCTTGGACCTCCTCCTGGG + Intronic
1040568821 8:48590542-48590564 CAATGCCTGGACCCATTCCTTGG - Intergenic
1046287825 8:112118178-112118200 AGATGTTTGGACTTATTTCTGGG - Intergenic
1046860216 8:119082979-119083001 TGAGGCTTTGACCTCTTCCTGGG + Intronic
1049073695 8:140376937-140376959 GGATGCTGTGCCCTATGCCTTGG + Intronic
1053164013 9:35832035-35832057 TGATCCTTGGATCTTTTCCTTGG + Intronic
1057934668 9:99226771-99226793 GATTCCTTGGGCCTATTCCTTGG + Intronic
1059952564 9:119481487-119481509 GTATGCATGGACATATTTCTGGG + Intergenic
1187601685 X:20838873-20838895 AGCTGATTGGGCCTATTCCTGGG - Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1189558629 X:42170272-42170294 AGATGCTAAGACCTATTCCTGGG - Intergenic
1191659551 X:63635740-63635762 GGATGCTTGGACAAGTTTCTGGG - Exonic
1195746395 X:108122849-108122871 GAAAGCTTGGGCATATTCCTGGG + Intronic
1196678745 X:118448615-118448637 GGATGCTTGGACCTATTCCTAGG - Intronic
1199201802 X:145099175-145099197 GGTCTCTTGGATCTATTCCTGGG - Intergenic