ID: 1196683933

View in Genome Browser
Species Human (GRCh38)
Location X:118495362-118495384
Sequence GGGCACTGCAGCTCGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196683921_1196683933 27 Left 1196683921 X:118495312-118495334 CCTGGGGGCTTGCGGGGTGGAGG No data
Right 1196683933 X:118495362-118495384 GGGCACTGCAGCTCGGAGGCGGG No data
1196683920_1196683933 28 Left 1196683920 X:118495311-118495333 CCCTGGGGGCTTGCGGGGTGGAG No data
Right 1196683933 X:118495362-118495384 GGGCACTGCAGCTCGGAGGCGGG No data
1196683926_1196683933 -10 Left 1196683926 X:118495349-118495371 CCAGCCCTCCTGCGGGCACTGCA No data
Right 1196683933 X:118495362-118495384 GGGCACTGCAGCTCGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196683933 Original CRISPR GGGCACTGCAGCTCGGAGGC GGG Intergenic
No off target data available for this crispr