ID: 1196685262

View in Genome Browser
Species Human (GRCh38)
Location X:118505177-118505199
Sequence CACAAAACTTAGCCGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1754
Summary {0: 1, 1: 1, 2: 18, 3: 290, 4: 1444}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196685262_1196685266 -3 Left 1196685262 X:118505177-118505199 CCATTGCCCGGCTAAGTTTTGTG 0: 1
1: 1
2: 18
3: 290
4: 1444
Right 1196685266 X:118505197-118505219 GTGTTTTTAGTATAGAGACAGGG 0: 1
1: 8
2: 72
3: 265
4: 2364
1196685262_1196685267 11 Left 1196685262 X:118505177-118505199 CCATTGCCCGGCTAAGTTTTGTG 0: 1
1: 1
2: 18
3: 290
4: 1444
Right 1196685267 X:118505211-118505233 GAGACAGGGTTTTGCCATGTTGG 0: 3927
1: 13830
2: 62029
3: 112235
4: 137083
1196685262_1196685265 -4 Left 1196685262 X:118505177-118505199 CCATTGCCCGGCTAAGTTTTGTG 0: 1
1: 1
2: 18
3: 290
4: 1444
Right 1196685265 X:118505196-118505218 TGTGTTTTTAGTATAGAGACAGG 0: 1
1: 19
2: 98
3: 364
4: 4063
1196685262_1196685269 20 Left 1196685262 X:118505177-118505199 CCATTGCCCGGCTAAGTTTTGTG 0: 1
1: 1
2: 18
3: 290
4: 1444
Right 1196685269 X:118505220-118505242 TTTTGCCATGTTGGCCAGGCTGG 0: 13466
1: 38217
2: 134614
3: 201451
4: 192209
1196685262_1196685268 16 Left 1196685262 X:118505177-118505199 CCATTGCCCGGCTAAGTTTTGTG 0: 1
1: 1
2: 18
3: 290
4: 1444
Right 1196685268 X:118505216-118505238 AGGGTTTTGCCATGTTGGCCAGG 0: 3909
1: 20710
2: 71265
3: 165880
4: 213507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196685262 Original CRISPR CACAAAACTTAGCCGGGCAA TGG (reversed) Intronic
900035213 1:402105-402127 TACAAAAATTAGCTGGGCATGGG + Intergenic
900056834 1:637858-637880 TACAAAAATTAGCTGGGCATGGG + Intergenic
900340657 1:2187456-2187478 TACAAAAATTAGCCGGGCGTGGG - Intronic
900426438 1:2582054-2582076 TACAAAAGTTAGCTGGGCATGGG + Intergenic
901028002 1:6289252-6289274 TACAAAAATTAGCCGGGCGTGGG - Intronic
901230355 1:7638484-7638506 TACAAAAATTAGCCGGGCTGTGG + Intronic
901264140 1:7896848-7896870 TACAAAAATTAGCCAGGCATGGG - Intergenic
901299951 1:8192369-8192391 TACAAAAATTAGCCGGGCTTGGG + Intergenic
901408477 1:9066387-9066409 TACAAAAATTAGCTGGGCATGGG - Intronic
901480402 1:9521028-9521050 TACAAAAATTAGCCGGGGCATGG - Intergenic
901539390 1:9905575-9905597 AAAAAAAATTAGCCGGGCATGGG - Intronic
901594677 1:10375537-10375559 TACGAAAATTAGCCAGGCAATGG - Intronic
901805105 1:11733762-11733784 TACAAAAATTAGCCAGGCATGGG - Intergenic
901838927 1:11941836-11941858 TACAAAAATTAGCCAGGCAGTGG - Intronic
901962385 1:12837838-12837860 TACAAAAATTAGCCGGGCTTGGG + Intergenic
901968997 1:12892613-12892635 TACAAAAATTAGCCGGGCGTGGG + Intronic
902056581 1:13605775-13605797 TACAAAAATTAGCTGGGCATGGG - Intronic
902345661 1:15815183-15815205 TACAAAAATTAGCCGGGCATGGG - Intergenic
902347948 1:15832742-15832764 TACAAAAATTAGCCGGGCTTGGG - Intergenic
902429089 1:16348545-16348567 TACAAAAATTAGCCGGGCGTGGG + Intronic
902521231 1:17018022-17018044 TACAAAAATTAGCTGGGCAGTGG - Intergenic
902559689 1:17269771-17269793 TACAAAAATTAGCCGGGCGGTGG - Intronic
902789911 1:18760669-18760691 CAGAAAAATTAGCCAGGCATGGG - Intergenic
902900762 1:19514285-19514307 TACAAAAATTAGCCGGGCGTGGG - Intergenic
902933661 1:19748668-19748690 CACAAAAATTAGCCAGGCGTGGG + Intronic
903062246 1:20677698-20677720 TACAAAAATTAGCCGGGCATGGG + Intronic
903116799 1:21185007-21185029 TACAAAAATTAGCCAGGCAGTGG + Intergenic
903314896 1:22495664-22495686 TACAAAAATTAGCCAGGCATGGG - Intronic
903323930 1:22558848-22558870 TACAAAAATTAGCCGGGCATGGG - Intergenic
903488110 1:23706630-23706652 CACAAAAATTAGCCAGGCAGAGG + Intergenic
903510302 1:23869533-23869555 TACAAAAATTAGCCGGGCATGGG + Intergenic
903518370 1:23928157-23928179 CAAAAAACTTAGCCGGGCGTGGG - Intergenic
903593956 1:24479789-24479811 TACAAAAATTAGCCAGGCATGGG + Intergenic
903613844 1:24637671-24637693 TACAAAAATTAGTCGGGCAGTGG - Intronic
903688921 1:25155913-25155935 TACAAAACTTAGCCAGGCCATGG + Intergenic
903714162 1:25351006-25351028 AAAAAAAATTAGCCGGGCATAGG + Intronic
903763811 1:25719225-25719247 CACAAAAATAAGCCGGGCATGGG - Intronic
903961374 1:27059836-27059858 TACAAAAATTAGCCGGGCATGGG - Intergenic
904022911 1:27481542-27481564 TACAAAAATTAGCCAGGCATGGG + Intronic
904146729 1:28398662-28398684 CACAAAAATTAGCCGGGCGTGGG + Intronic
904148821 1:28419134-28419156 CAAAAAAATTAGCTGGGCATGGG - Intronic
904234228 1:29103820-29103842 TAAAAAAATTAGCCGGGCATGGG - Intronic
904245233 1:29182696-29182718 TACAAAAATTAGCCGGGCGTGGG - Intergenic
904251573 1:29228504-29228526 TACAAAAATTAGCTGGGCATGGG - Intronic
904274754 1:29373455-29373477 TACAAAAATTAGCTGGGCATGGG - Intergenic
904498215 1:30899524-30899546 CACAAAAATTAGCCAGGCGGTGG - Intronic
904645029 1:31959178-31959200 TACAAAAATTAGCCAGGCATAGG - Intergenic
904715348 1:32463829-32463851 TACAAAAATTAGCCGGGCGTGGG - Intergenic
904729607 1:32579293-32579315 TACAAAAATTAGCCGGGGCATGG + Intronic
905111975 1:35602174-35602196 CACAAAAACTAGCTGGGCATTGG + Exonic
905236169 1:36550822-36550844 TACAAAAATTAGCCAGGCAGTGG + Intergenic
905380132 1:37556036-37556058 TACAAAATTTAGCCGGGCATGGG + Intergenic
905436678 1:37960803-37960825 AAAAAAAATTAGCCGGGCATGGG - Intronic
905464460 1:38142116-38142138 TACAAAAATTAGCCAGGCATGGG + Intergenic
905795254 1:40812409-40812431 AACAAAAATTAGCCAGGCATGGG - Intronic
906307637 1:44730136-44730158 CACAAAAATTAGCTGGGCGTGGG - Intergenic
906350708 1:45056436-45056458 TACAAAAATTAGCTGGGCCATGG + Intronic
906387162 1:45380052-45380074 TACAAAAATTAGCCAGGCATGGG - Intronic
906412217 1:45587828-45587850 TACAAAAATTAGCCGAGCATGGG + Intronic
906629472 1:47353869-47353891 TACAAAAATTAGCCAGGCATGGG - Intronic
906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG + Intronic
906802888 1:48752902-48752924 TACAAAAATTAGCTGGGCATGGG - Intronic
906986373 1:50687593-50687615 TACAAAAATTAGCCAGGCATGGG + Intronic
907006889 1:50923267-50923289 AAAAAAATTTAGCCAGGCAAAGG + Intronic
907027811 1:51138840-51138862 TACAAAAATTAGCTGGGCATAGG - Intronic
907076755 1:51586016-51586038 TACAAAAATTAGCCGGGCATAGG + Intronic
907123633 1:52030214-52030236 TACAAAACTTAGCCGGTCGTGGG + Intronic
907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG + Intronic
907213843 1:52845459-52845481 TACAAAAATTAGCCAGGAAATGG - Intronic
907331406 1:53674015-53674037 TACAAAAATTAGCTGGGCATGGG + Intronic
907389627 1:54149906-54149928 CAGAAAACTGAGCCCGGGAAAGG + Intronic
907469405 1:54663526-54663548 TACAAAAATTAGCTGGGCAATGG - Intronic
907841930 1:58166899-58166921 CACAAAAATTAGCCAGCCCATGG - Intronic
908238627 1:62170599-62170621 TACAAAAATTAGCCGGGCTTGGG + Intergenic
908565807 1:65355108-65355130 TACAAAAATTAGCCAGGCATGGG + Intronic
908908316 1:69041852-69041874 TACAAAAATTAGCTGGGCATGGG + Intergenic
909007768 1:70297446-70297468 TAAAAAAATTAGCCGGGCATGGG - Intronic
909503478 1:76361822-76361844 TACAAAAATTAGCCTGGCATGGG + Intronic
909904886 1:81182673-81182695 TACAAAATTTAGCTGGGCATGGG + Intergenic
910158563 1:84248725-84248747 CACAAAAATTAGCTGGGCCTGGG + Intergenic
910347961 1:86262807-86262829 TACAAAAATTAGCCGGCCATGGG - Intergenic
910404483 1:86872740-86872762 TACAAAAATTAGCCAGGCACGGG + Intronic
910635397 1:89402388-89402410 TACAAAAATTAGCCAGGCATGGG - Intergenic
910768157 1:90803191-90803213 TACAAAAATTAGCCAGGCATAGG + Intergenic
911383645 1:97147191-97147213 TACAAAAATTAGCTGGGCATGGG + Intronic
911739776 1:101374815-101374837 CAAAAAAATTAGCCGGGCGTAGG - Intergenic
912340149 1:108906721-108906743 TACAAAAATTAGCCAGGCACAGG + Intronic
912358728 1:109076778-109076800 TACAAAAATTAGCTGGGCATTGG - Intergenic
912359992 1:109087330-109087352 CACAAAAATTAGCCGGGCATGGG - Intergenic
912367427 1:109146163-109146185 CAAAAAAATTAGCCGGGCATGGG + Intronic
912379264 1:109238318-109238340 CACAAAAGCTTGCAGGGCAAGGG + Intergenic
912387132 1:109276875-109276897 CACAAACCCTAGCTGGGCAGTGG + Intergenic
912457999 1:109811701-109811723 TACAAAAATTAGCTGGGCATGGG + Intergenic
912943549 1:114066408-114066430 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
912985043 1:114419050-114419072 CACAAAAATTAGCCAGGCCTGGG + Intronic
913569836 1:120109574-120109596 TACAAAAATTAGCCGGGCGTGGG + Intergenic
914290645 1:146270540-146270562 TACAAAAATTAGCCGGGCGTGGG + Intergenic
914551689 1:148721323-148721345 TACAAAAATTAGCCGGGCGTGGG + Intergenic
914728065 1:150345503-150345525 TACAAAAATTAGCCGGGCGTGGG - Intronic
914759939 1:150590534-150590556 TACAAAAATTAGCCAGGCATGGG - Intergenic
914779934 1:150776134-150776156 TACAAAAATTAGCCGGGCGCGGG - Intergenic
914791384 1:150880373-150880395 CAAAAAAATTAGCGGGGCAGTGG - Intergenic
914811062 1:151028576-151028598 TACAAAAATTAGCCGGGCATGGG - Intronic
914828402 1:151152543-151152565 TACAAAAATTAGCCGGGCGTGGG + Intergenic
914870123 1:151466604-151466626 TACAAAAATTAGCCGGGCATGGG + Intergenic
915124075 1:153650995-153651017 TACAAAAATTAGCGGGGCATGGG + Intergenic
915124151 1:153651536-153651558 TACAAAAATTAGCCGGGCATGGG + Intergenic
915153539 1:153855381-153855403 TACAAAAATTAGCCGGGCGTGGG - Intronic
915255486 1:154625702-154625724 TACAAAAATTAGCCGGGCATAGG + Intronic
915338377 1:155161729-155161751 TACAAAAATTAGCCAGGCATGGG - Intergenic
915397011 1:155592707-155592729 TACAAAAATTAGCCGGGGCATGG - Intergenic
915620887 1:157083412-157083434 TACAAAAATTAGCTGGGCATGGG - Intergenic
916124826 1:161560090-161560112 TACAAAAATTAGCTGGGCATGGG - Intergenic
916134716 1:161641435-161641457 TACAAAAATTAGCTGGGCATGGG - Intronic
916705033 1:167340584-167340606 CACAAAAATTAGCTGGGCGTGGG - Intronic
916750643 1:167720457-167720479 CAAAAAAATTAGCCGGGCATGGG - Intergenic
917109091 1:171526961-171526983 TACAAAAATTAGCCAGGCATGGG - Intronic
917330155 1:173872221-173872243 CACAAAAATTAGCTGAGCATGGG - Intronic
917363001 1:174197642-174197664 TACAAAAATTAGCCGGGCATTGG + Intronic
918265509 1:182838679-182838701 TACAAAAATTAGCCGGGCATGGG - Intergenic
918266261 1:182844815-182844837 CACAAAAATTAGCTGGGCGTGGG - Intronic
918474449 1:184908218-184908240 CACAAAGCTTAGCCCATCAAAGG + Intronic
918603473 1:186392660-186392682 TACAAAAGTTAGCTGGGCATTGG + Intronic
919391731 1:196993449-196993471 TACAAAAATTAGCCAGGCATGGG - Intronic
919937333 1:202263275-202263297 TACAAAATTTAGCTGGGCATTGG - Intronic
920120611 1:203654136-203654158 CACAAAAATTAGCCAGGCATGGG - Intronic
920154446 1:203937144-203937166 TACAAAAATTAGCCAGGCATGGG + Intergenic
920368922 1:205465059-205465081 TACAAAAATTAGCCAGGCATGGG - Intergenic
920625000 1:207588322-207588344 TACAAAAATTAGCTGGGCATGGG - Intronic
921058369 1:211561892-211561914 TACAAAAATTAGCCAGGCAAGGG + Intergenic
921317052 1:213902281-213902303 TACAAAATTTAGCTGGGCATGGG + Intergenic
921347144 1:214197977-214197999 CAAAAAAATTAGCCAGGCATGGG + Intergenic
921400645 1:214719768-214719790 TACAAAAATTAGCCAGGCATGGG - Intergenic
921441933 1:215197843-215197865 TACAAAAATTAGCTGGGCATGGG + Intronic
921818631 1:219592007-219592029 TACAAAACTTAGCTGGGCCTGGG - Intergenic
921924667 1:220701503-220701525 TATAAAAATTAGCCGGGCATGGG + Intergenic
922144809 1:222931299-222931321 CTCAAAACTTAGCAGCCCAAAGG - Intronic
922283286 1:224145766-224145788 TACAAAAATTATCCGGGCATGGG + Intronic
922296345 1:224253204-224253226 TAGAAAACTTAGCCGGGCGTGGG - Intronic
922352326 1:224744419-224744441 TACAAAAATTAGCTGGGCATAGG - Intergenic
922520228 1:226244028-226244050 TACAAAACTTAGCCCGGCGCAGG - Intronic
922538775 1:226403332-226403354 TACAAAAATTAGCCAGGCATGGG - Intronic
922753259 1:228081001-228081023 TACAAAAATTAGCTGGGCATAGG + Intergenic
922770207 1:228177641-228177663 TACAAAAATTAGCCGGGCATGGG - Exonic
922850285 1:228727462-228727484 TACAAAAATTAGCTGGGCATGGG - Intergenic
922873597 1:228922439-228922461 TACAAAAATTAGCCGGGCGCTGG + Intergenic
922930734 1:229387228-229387250 TACAAAAATTAGCCAGGCATAGG + Intergenic
922940066 1:229455404-229455426 TACAAAAATTAGCCGGGCATGGG + Intronic
922952778 1:229573239-229573261 TACAAAAATTAGCCGGGCATGGG - Intergenic
922987495 1:229877283-229877305 TACAAAAATTAGCCGGGCTGTGG + Intergenic
923309714 1:232724753-232724775 TACAAAAATTAGTCGGGCAATGG + Intergenic
923476577 1:234338352-234338374 TACAAAAATTAGCCTGGCACTGG - Intergenic
923597418 1:235371528-235371550 TACAAAAATTAGCCAGGCTATGG - Intronic
923639860 1:235744744-235744766 TACAAAAATTAGCCGGGCATGGG + Intronic
924105582 1:240645880-240645902 TACAAAAATTAGCTGGGCATGGG + Intergenic
924303966 1:242667908-242667930 TACAAAAATTAGCTGGGCATGGG - Intergenic
924702390 1:246467013-246467035 CAAAAAAATTAGCCGGGAATGGG + Intronic
924732304 1:246723735-246723757 CACAAAAATTAGCAGGGCGTGGG + Intergenic
1063235523 10:4111277-4111299 CACAAAAATTAGCTGGGTATGGG + Intergenic
1063600806 10:7479638-7479660 TACAAAAATTAGCCGGGCATAGG + Intergenic
1063692231 10:8297601-8297623 TACAAAAATTAGCTGGGCATGGG - Intergenic
1064011445 10:11739820-11739842 TACAAAAATTAGCTGGGCATGGG - Intergenic
1064455256 10:15481829-15481851 TACAAAAATTAGCCAGGCATGGG + Intergenic
1064635560 10:17362864-17362886 TACAAAAATTAGCCGGACATGGG - Intronic
1064715731 10:18174556-18174578 TACAAAAATTAGCTGGGCATGGG - Intronic
1064826756 10:19412142-19412164 TACAAAAATTAGCCAGGCATGGG + Intronic
1064955175 10:20900521-20900543 TAGAAAAATTAGCCGGGCATGGG + Intronic
1065004607 10:21367867-21367889 CACACAAATTAGCCAGGCATTGG - Intergenic
1065176606 10:23082292-23082314 TACAAAAATTAGCCAGGCATGGG + Intergenic
1065305306 10:24362844-24362866 TACAAAAATTAGCCAGGCAGAGG + Intronic
1065312105 10:24426467-24426489 TACAAAAATTAGCCGGACATGGG + Intronic
1065354977 10:24831857-24831879 TACAAAAATTAGCCAGGCATTGG - Intergenic
1065576782 10:27128752-27128774 TACAAAAATTAGCCAGGCATAGG + Intronic
1065581574 10:27176997-27177019 TACAAAAATTAGCCGAGCATGGG - Intronic
1065651112 10:27892992-27893014 TACAAAAATTAGCCAGGCATGGG + Intronic
1065705284 10:28466633-28466655 CACAAAAATTAGCCAGGCGTAGG + Intergenic
1066663162 10:37756244-37756266 TACAAAAATTAGCCGGGCAGTGG - Intergenic
1066699894 10:38115931-38115953 CACAAAAATTAGCCAGGCATGGG - Intronic
1066991830 10:42522540-42522562 CACAAAAATCAGCCAGGCATGGG + Intergenic
1067484415 10:46634107-46634129 TACAAAAATTAGCTGGGCATGGG + Intergenic
1067610345 10:47707539-47707561 TACAAAAATTAGCTGGGCATGGG - Intergenic
1067680197 10:48430246-48430268 CACAAAAATTAGCCGGGCTTGGG - Intronic
1067731549 10:48815612-48815634 TACAAAAATTAGCTGGGCATTGG - Intronic
1067931030 10:50562696-50562718 CAAAAAAATTAGCCGGGCATAGG - Intronic
1068238500 10:54271363-54271385 TACAAAAATTAGCCGGGCGTGGG - Intronic
1068602940 10:58974761-58974783 TACAAAAATTAGCCGAGCATGGG - Intergenic
1068940946 10:62680692-62680714 TACAAAACTTAGCCAGGCATGGG + Intergenic
1069030964 10:63595730-63595752 TACAAAAATTAGCCAGGCCATGG - Intronic
1069204192 10:65661345-65661367 CAAAAAAATTAGCCAGGCACGGG + Intergenic
1069218554 10:65853842-65853864 TACAAAAATTAGCCAGGCATGGG - Intergenic
1069297743 10:66868200-66868222 TACAAAACATAGCCGGGCATGGG + Intronic
1069297791 10:66868594-66868616 TACAAAAATTAGCCAGGCATAGG + Intronic
1069428596 10:68312763-68312785 CAAAAAAATTAGCCAGGCCATGG - Intronic
1069451397 10:68520832-68520854 TACAAAAATTAGCCAGGCGAAGG + Intronic
1069482992 10:68800706-68800728 CAGAAAACTTTTCAGGGCAAAGG - Intergenic
1069502465 10:68966229-68966251 TACAAAAATTAGCCGGGCGTGGG - Intronic
1069646097 10:69998857-69998879 TACAAAAATTAGCCGGGCATGGG + Intergenic
1070125542 10:73618587-73618609 TACAAAAATTAGCTGGGCATGGG + Intronic
1070169110 10:73919324-73919346 CACAAAAATGAGCCGGGTAGTGG - Intronic
1070310989 10:75273672-75273694 TACAAAAATTAGCCAGGCAGTGG - Intergenic
1070323432 10:75372084-75372106 TACAAAAATTAGCTGGGCAGTGG - Intergenic
1070334484 10:75442033-75442055 AACAATACTTAGCTGTGCAAAGG - Intronic
1070561861 10:77573988-77574010 TACAAAAATTAGCCTGGCATTGG - Intronic
1070569224 10:77628499-77628521 TACAAAAATTAGCCAGGCATGGG + Intronic
1070625579 10:78048718-78048740 CACAAAAATTAGCCGGGCATGGG + Intronic
1070770323 10:79078697-79078719 TACAAAAATTAGCTGGGCATGGG - Intronic
1071219796 10:83451914-83451936 TACAAAAATTAGCTGGGCATGGG + Intergenic
1071625756 10:87167797-87167819 TACAAAAATTAGCTGGGCATGGG - Intronic
1071729705 10:88235105-88235127 CAAAAAAATTAGCCGGGCGTCGG + Intergenic
1072099097 10:92212401-92212423 CACAAAAATTAGCTGGGCAGTGG - Intronic
1072323140 10:94270822-94270844 TACAAAAATTAGCCAGGCATGGG - Intronic
1072517489 10:96199867-96199889 TACAAAAATTAGCCGGGCTTGGG + Intronic
1072581469 10:96743587-96743609 TACAAAAATTAGCTGGGCATGGG + Intergenic
1073006980 10:100331672-100331694 AACAAAAATTAGCCAGGCATGGG + Intergenic
1073046689 10:100643301-100643323 TACAGAAATTAGCCGGGCATAGG - Intergenic
1073128786 10:101171455-101171477 AACAAAAATTAGCCGGGCGTGGG + Intergenic
1073774359 10:106769328-106769350 TACAAAAATTAGCCGGGCGTGGG + Intronic
1074348052 10:112707486-112707508 TACAAAAATTAGCCAGGCATGGG - Intronic
1074612538 10:115036089-115036111 TACAAAAATTAGCCAGGCATGGG - Intergenic
1074635201 10:115307414-115307436 CACAAAAATCAGCCAGGCATGGG - Intronic
1074823814 10:117200649-117200671 TACAAAAATTAGCTGGGCATGGG + Intronic
1074856062 10:117474432-117474454 CAAAAAAGTTAGCTGGGCATGGG + Intergenic
1075029959 10:119016406-119016428 TACAAAACTTAGCTTGGCATTGG + Intergenic
1075050141 10:119177501-119177523 CACAAAACTTAGCCAGGCGGCGG + Intronic
1075379794 10:122009769-122009791 TACAAAAATTAGCTGGGCATGGG + Intronic
1075596893 10:123738438-123738460 CAAAAAAATTAGCTGGGCATGGG - Intronic
1076174088 10:128352683-128352705 TACAAAAATTAGCCGGGCAGTGG + Intergenic
1076292222 10:129354611-129354633 TACAAAAATTAGCCAGGCATGGG + Intergenic
1076397162 10:130148283-130148305 TACAAAAATTAGCTGGGCAGGGG - Intronic
1077586993 11:3461436-3461458 CACAAAAATTAGCTAGGCATGGG - Intergenic
1077656944 11:4028561-4028583 TACAAAAATTAGCCGGGCGTGGG - Intronic
1077758114 11:5058327-5058349 AACAAAAATTAGCCAGGCCATGG + Intergenic
1078193007 11:9108839-9108861 TACAAAAATTAGCCAGGCACGGG + Intronic
1078223234 11:9369251-9369273 CAAAAAATTTAGCTGGGCAGGGG + Intergenic
1078262628 11:9725130-9725152 TACAAAAATTAGCTGGGCATGGG - Intronic
1078520578 11:12059881-12059903 TACAAAAATTAGCTGGGCATGGG + Intergenic
1078893482 11:15578253-15578275 AACAAAAATTAGCTGGGCATGGG - Intergenic
1078955424 11:16188906-16188928 TACAAAAATTAGCTGGGCATAGG + Intronic
1079187767 11:18252985-18253007 TGCAAAAATTAGCCGGGCATGGG - Intergenic
1079193050 11:18297923-18297945 TACAAAAATTAGCTGGGCATGGG + Intronic
1079211033 11:18460990-18461012 TACAAAAATTAGCTGGGCATGGG - Intronic
1079738144 11:24023590-24023612 CAAAAAAATTAGCCGGGCATGGG + Intergenic
1080449335 11:32365692-32365714 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1080468478 11:32521456-32521478 TACAAAAATTAGCTGGGCATGGG + Intergenic
1080675653 11:34424104-34424126 TACAAAAATTAGCTGGGCATGGG + Intergenic
1080758694 11:35227044-35227066 TACAAAAATTAGCCGGTCATGGG - Intronic
1080948173 11:36998391-36998413 TACAAAAATTAGCCGGGGTAGGG - Intergenic
1081136607 11:39447468-39447490 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1081159770 11:39737023-39737045 CACAAAAGTTATGGGGGCAAAGG - Intergenic
1081222770 11:40482622-40482644 TACAAAAATTAGCTGGGCATGGG - Intronic
1081365155 11:42226070-42226092 TACAAAAATTAGCTGGGCATGGG - Intergenic
1081533676 11:43982380-43982402 TACAAAAATTAGCCGGGCATGGG - Intergenic
1081849242 11:46263561-46263583 TACAAAAATTAGCCAGGCATGGG + Intergenic
1081971694 11:47203550-47203572 CACAAAAATTAGCTGGGCATGGG + Intergenic
1081972763 11:47211376-47211398 TACAAAAATTAGCCAGGCATGGG - Intergenic
1082048223 11:47748083-47748105 TACAAAAATTAGCCGGGCGTGGG + Intronic
1082846572 11:57730580-57730602 TACAAAAATTAGCCAGGCATTGG + Intronic
1083181006 11:60985337-60985359 TACAAAAATTAGCCAGGCAATGG - Intronic
1083320675 11:61844414-61844436 AACAAAAATTAGCCAGGCGAGGG + Intronic
1083426263 11:62588397-62588419 TACAAAAATTAGCTGGGCATGGG + Intronic
1083435772 11:62642055-62642077 TACAAAAATTAGCCAGGCATGGG + Intronic
1083449632 11:62734443-62734465 CACAAAAATTAGCTGGACATGGG + Intronic
1083589316 11:63883738-63883760 CACAAAAATTAGCCGGGGTGTGG - Intronic
1083818290 11:65150384-65150406 TACAAAAATTAGCCAGGCATTGG + Intergenic
1083844755 11:65324760-65324782 TACAAAAATTAGCTGGGCACCGG - Intergenic
1084101801 11:66954787-66954809 TACAAAAATTAGCCAGGCAAAGG + Intronic
1084129927 11:67125615-67125637 TACAAAAATTAGCTGGGCACTGG + Intronic
1084130387 11:67129432-67129454 TACAAAAATTAGCCGGGCATAGG + Intronic
1084242991 11:67835459-67835481 CACAAAAATTAGCTAGGCATGGG - Intergenic
1084339622 11:68487412-68487434 TACAAAAATTAGCCGGGGCATGG + Intronic
1084903418 11:72327508-72327530 CACAAAATTTAGCTGCCCAAGGG - Intronic
1084985240 11:72864388-72864410 TACAAAAATTAGCTGGGCATGGG + Intronic
1085159009 11:74323864-74323886 TACAAAAATTAGCCAGGCATTGG - Intergenic
1085185540 11:74573022-74573044 CACAAAAATTAGCCAGGCGTTGG - Intronic
1085358190 11:75859218-75859240 TACAAAAATTAGCCGGGCGGTGG + Intronic
1085425283 11:76399294-76399316 TACAAAAATTAGCCAGGCATTGG - Intronic
1085472891 11:76769376-76769398 CTCAAATCTCAGCCGGGCCAGGG - Intergenic
1085505877 11:77058548-77058570 AATAAAAATTAGCCGGGCATGGG + Intergenic
1085537067 11:77228196-77228218 TACAAAAATTAGCCAGGCATGGG + Intronic
1085616358 11:78002361-78002383 TACAAAAATTAGTCGGGCATGGG - Intergenic
1086075578 11:82847745-82847767 CAAAAAAATTAGCAGGGCATAGG - Intronic
1086112526 11:83215947-83215969 TACAAAAATTAGCTGGGCATGGG - Intronic
1086119795 11:83294124-83294146 AAAAAAAATTAGCCGGGCAATGG + Intergenic
1086206028 11:84259115-84259137 TACAAAAATTAGCCGGGCATGGG + Intronic
1086363559 11:86085080-86085102 CACAAAAATTAGCCAGGCCATGG - Intergenic
1086623252 11:88913739-88913761 TACAAAAATTAGCCTGGCATGGG - Intronic
1087221705 11:95553196-95553218 TACAAAAATTAGCCAGGCATGGG + Intergenic
1087457084 11:98400523-98400545 TACAAAAATTAGCCAGGCATGGG + Intergenic
1087517212 11:99179285-99179307 TACAAAAATTAGCCGGGCAAAGG + Intronic
1087656077 11:100924510-100924532 TACAAAAATTAGCTGGGCATGGG + Intronic
1087658212 11:100952887-100952909 CACAAAAATCAGCTGGGCACTGG - Intronic
1087744205 11:101924618-101924640 CAAAAAAATTAGCCGGGCACGGG - Intronic
1087758383 11:102078862-102078884 TACAAAAATTAGCTGGGCCATGG - Intronic
1087814923 11:102648085-102648107 AAAAAAAATTAGCCGGGCGAGGG + Intergenic
1088243187 11:107791854-107791876 TACAAAACTTAGCTGGGCGTGGG + Exonic
1088251131 11:107861734-107861756 TACAAGAATTAGCCGGGCATGGG - Intronic
1088602422 11:111492989-111493011 TACAAAAATTACCCGGGCATGGG + Intronic
1089080917 11:115775610-115775632 TACAAAAATTAGCCAGGCATTGG + Intergenic
1089171756 11:116516644-116516666 TACAAAAATTAGCCAGGCATGGG + Intergenic
1089204235 11:116746081-116746103 TACAAAAATTAGCTGGGCATGGG + Intergenic
1089245497 11:117116433-117116455 TACAAAAATTAGCCAGGCATGGG + Intergenic
1089449710 11:118584978-118585000 CAAAAAAATTAGCCGGGCGTAGG - Intronic
1089477231 11:118774585-118774607 TACAAAAATTAGCTGGGCATGGG - Intronic
1089644519 11:119869809-119869831 CAAAAAACTTGGCTGAGCAAGGG - Intergenic
1089817495 11:121189526-121189548 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1090122796 11:124050387-124050409 TACAAAAATTAGCCAGGCATAGG - Intergenic
1090222263 11:125038072-125038094 TACAAAAATTAGCCAGGCAGTGG - Intronic
1090384233 11:126347376-126347398 TACAAAAATTAGCTGGGCATGGG - Intergenic
1090774369 11:129950079-129950101 TACAAAATTTAGCTGGGCAGTGG + Intronic
1090792559 11:130104371-130104393 TACAAAAATTAGCCAGGCATGGG - Intronic
1091040152 11:132270381-132270403 TACAAAAATTAGCTGGGCATTGG - Intronic
1091298201 11:134488161-134488183 TACAAAAATTAGCCGGGCATGGG + Intergenic
1091364644 11:135007535-135007557 AACAAAACTTACCCGGGCCATGG - Intergenic
1091455035 12:600398-600420 AAAAAAAGTTAGCCGGGCATGGG + Intronic
1091462721 12:657431-657453 TACAAAAATTAGCCGGGGCATGG + Intronic
1091791697 12:3275652-3275674 CACAAAGCTTCGCCAGGGAACGG - Intronic
1091876349 12:3936751-3936773 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
1091924331 12:4332396-4332418 TACAAAAATTAGCTGGGCATGGG - Intronic
1091938699 12:4454783-4454805 TACAAAAATTAGCCGGGCTGTGG + Intergenic
1092278318 12:7079823-7079845 CAAAAAATTTAGCTGGGCAGTGG + Intergenic
1092307337 12:7315039-7315061 TACAAAAATTAGCTGGGCATGGG + Intronic
1092350942 12:7755273-7755295 TACAAAAATTAGCTGGGCAGTGG - Intergenic
1092457612 12:8658192-8658214 TACAAAAATTAGCTGGGCATGGG + Intronic
1092617537 12:10229238-10229260 TACAAAAATTAGCTGGGCACGGG + Intergenic
1092783305 12:12006960-12006982 TACAAAAATTAGCCGGGCCTGGG - Intergenic
1093471445 12:19506252-19506274 TACAAAAATTAGCTGGGCATGGG - Intronic
1093543444 12:20316448-20316470 AAAAAAACTTAGCCGGGCGTGGG - Intergenic
1093691547 12:22115064-22115086 CAAAAAAATTAGCCGGGCATGGG - Intronic
1093729451 12:22550675-22550697 TACAAAAATTAGCCAGGCATGGG + Intergenic
1093737185 12:22634694-22634716 TACAAAAATTAGCCGGGCATGGG - Intronic
1093873268 12:24318054-24318076 TACAAAAATTAGCTGGGCATGGG + Intergenic
1093884868 12:24448024-24448046 CACAAAAATTAGCTGGGCATTGG + Intergenic
1094143332 12:27203461-27203483 TACAAAAATTAGCTGGGCATGGG - Intergenic
1094187958 12:27665031-27665053 CAAAAAAATTAGCTGGGCATGGG + Intronic
1094254753 12:28410674-28410696 TACAAAAATTAGCCAGGCATGGG - Intronic
1094547811 12:31421197-31421219 TACAAAAATTAGCCAGGCATGGG - Intronic
1094610577 12:31991703-31991725 TACAAAAATTAGCTGGGCAGAGG - Intronic
1094629405 12:32158258-32158280 TACAAAAATCAGCCGGGCATGGG - Intronic
1095275318 12:40275763-40275785 TACAAAAATTAGCCAGGCATGGG - Intronic
1095463270 12:42464173-42464195 TACAAAAATTAGCTGGGCATGGG - Intronic
1095471685 12:42543675-42543697 TACAAAAATTAGCTGGGCATGGG - Intronic
1095590449 12:43897465-43897487 TACAAAAATTAGCTGGGCCATGG - Intronic
1095785351 12:46102906-46102928 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1095794420 12:46202036-46202058 TACAAAAGTTAGCTGGGCATGGG + Intronic
1096069936 12:48769255-48769277 TACAAAAATTAGCTGGACAATGG + Intronic
1096325122 12:50653493-50653515 CACAAAAATTAGCTGGGCATGGG - Intronic
1096333537 12:50735617-50735639 CACAAAAATTAGCTGGGCGTGGG - Intronic
1096423173 12:51477974-51477996 TACAAAAATTAGCTGGGCATGGG + Intronic
1096437999 12:51611646-51611668 TACAAAAATTAGCCAGGCATAGG - Intronic
1096632924 12:52940778-52940800 CAAAAAAATTAGCGGGGCATGGG - Intronic
1096679883 12:53248644-53248666 CAAAAAAAATAGCCGGGCCATGG - Intergenic
1096683898 12:53275143-53275165 TACAAAAATTAGCTGGGCATTGG + Intronic
1096834034 12:54336865-54336887 TACAAAAATTAGCTGGGCATGGG + Intronic
1096889737 12:54757477-54757499 TACAAAAATTAGCCGGGCAAGGG - Intergenic
1097049185 12:56210884-56210906 TACAAAAATTAGCCGGGCATAGG + Intronic
1097199149 12:57263621-57263643 TACAAAAATTAGCTGGGCATGGG - Intronic
1097794973 12:63851717-63851739 CAAAAAAATTAGCTGGGCATGGG - Intronic
1097975793 12:65684731-65684753 TACAAAAATTAGCCGGACACGGG + Intergenic
1097995762 12:65886511-65886533 TACAAATATTAGCCGGGCATGGG - Intronic
1098573452 12:72014543-72014565 TACAAAAATTAGCTGGGCATGGG - Intronic
1098987490 12:77028344-77028366 TACAAAAATTAGCCAGGCATGGG - Intronic
1099047427 12:77738855-77738877 CAAAAAAATTAGCCGGGCTTGGG + Intergenic
1099245753 12:80191281-80191303 CACAAAAATTAGCCAGGCGCGGG + Intergenic
1099525064 12:83709062-83709084 AAAAAAAGTTAGCCGGGCATGGG + Intergenic
1099612738 12:84895501-84895523 TACAAAAATTAGCCGGGCATGGG - Intronic
1099796353 12:87405445-87405467 TACAAAAATTAGCTGGGCATGGG + Intergenic
1099872865 12:88370298-88370320 CACAAAAGTTATGGGGGCAAGGG - Intergenic
1100240046 12:92702035-92702057 TACAAAAGTTAGCCGGGCCCTGG + Intergenic
1100541874 12:95565012-95565034 TACAAAAATTAGCCGGGCTGTGG + Intergenic
1100634985 12:96426882-96426904 TACAAAAATTAGCCGGGCATGGG + Intergenic
1100816266 12:98390176-98390198 TACAAAAATTAGCTGGGCATGGG + Intergenic
1100827654 12:98489936-98489958 TACAAAAATTAGCCAGGCATGGG - Intronic
1101114156 12:101515906-101515928 TACAAAAATTAGCTGGGCACGGG - Intergenic
1101132725 12:101705878-101705900 TACAAAAATTAGCCGGGCGTGGG - Intronic
1101355786 12:103976248-103976270 TACAAAAATTAGCCAGGCATTGG + Intronic
1101408873 12:104452984-104453006 TACAAAAATTAGCTGGGCATGGG + Intergenic
1101439202 12:104690672-104690694 TACAAAAATTAGCTGGGCATGGG + Intronic
1101515469 12:105430786-105430808 TACAAAAATTAGCTGGGCATGGG + Intergenic
1101531437 12:105576898-105576920 TACAAAAGTTAGCTGGGCATGGG - Intergenic
1101895461 12:108753281-108753303 TACAAAAATTAGCCAGGCACAGG - Intergenic
1101911438 12:108863001-108863023 TACAAAAATTAGCTGGGCATGGG - Intronic
1102062718 12:109945977-109945999 CAAAAAAATTAGCCAGGCACAGG + Intronic
1102158226 12:110747334-110747356 TACAAAAATTAGCCGGGGCATGG - Intergenic
1102244079 12:111343904-111343926 TACAAAAGTTAGCCAGGCAGGGG + Intronic
1102281030 12:111619097-111619119 CAGAAAAATTAGCCAGGCATTGG + Intergenic
1102286528 12:111661864-111661886 TACAAAAATTAGCTGGGCATGGG - Intronic
1102288018 12:111675104-111675126 TACAAAAATTAGCCGGGCATGGG + Intronic
1102337389 12:112093383-112093405 TACAAAAATTAGCCAGGCAGTGG + Intronic
1102348459 12:112174716-112174738 TACAAAAATTAGCCGGGCATGGG - Intronic
1102379958 12:112456612-112456634 TACAAAAATTAGCCAGGCATAGG - Intronic
1102381710 12:112472653-112472675 CACAAAAATTAGCCAGACATGGG - Intronic
1102691092 12:114761718-114761740 TACAAAAATTAGCCAGGCATGGG - Intergenic
1103177499 12:118877448-118877470 CAAAAAAATTAGCCTGGCATTGG - Intergenic
1103482338 12:121258995-121259017 TACAAAAATTAGCTGGGCATGGG - Intronic
1103483930 12:121269892-121269914 TACAAAAATTAGCCGGGGCATGG + Intronic
1103538769 12:121651840-121651862 CACACAACTGAGCTGGGCACGGG - Intronic
1103538802 12:121652088-121652110 CACAAAAATTAGCTGGGCGTGGG - Intronic
1103670227 12:122608279-122608301 TAAAAAAATTAGCCGGGCACAGG - Intronic
1103753733 12:123186068-123186090 TACAAAAATTAGCTGGGCATGGG + Intronic
1103790674 12:123468532-123468554 CACAAAAATTAGCCGGGTGTTGG + Intronic
1103790775 12:123469307-123469329 TACAAAAATTAGCTGGGCATGGG - Intronic
1103808679 12:123595072-123595094 TACAAAAATTAGCCAGGCATGGG + Intronic
1103875786 12:124126161-124126183 TACAAAAATTAGCCAGGCATGGG - Intronic
1103977448 12:124712689-124712711 TACAAAAATTAGCTGGGCATTGG - Intergenic
1104146311 12:126037179-126037201 TACAAAAATTAGCCAGGCATGGG + Intergenic
1104256936 12:127147079-127147101 CACAAAAAATAGCCGGGCATGGG + Intergenic
1104282038 12:127387330-127387352 TACAAAAATTAGCTGGGCATGGG - Intergenic
1104573273 12:129944100-129944122 GACAAAAACTAGCCGGGCATGGG + Intergenic
1105367020 13:19774647-19774669 TACAAAAATTAGCCGGGGCATGG + Intronic
1105893059 13:24695759-24695781 CAAAAAAATTAGCTGGGCAGGGG - Intronic
1105989348 13:25602915-25602937 CAAAAAAATTAGCCAGGCATGGG + Intronic
1106161929 13:27209126-27209148 TACAAAAATTAGCCCGGCATTGG - Intergenic
1106313274 13:28572281-28572303 TACAAAAATTAGCTGGGCAGTGG + Intergenic
1106334869 13:28775035-28775057 TACAAAAATTAGCTGGGCATGGG + Intergenic
1106446230 13:29834029-29834051 TACAAAAATTAGCCAGGCACAGG + Intronic
1106729222 13:32521819-32521841 TACAAAAATTAGCTGGGCATGGG + Intronic
1106731266 13:32543923-32543945 TACAAATATTAGCCGGGCATGGG - Intergenic
1106739622 13:32625992-32626014 CACAAAAATTAGCCAGGCGTTGG - Intronic
1106832300 13:33597698-33597720 TAGAAAAATTAGCCGGGCATGGG + Intergenic
1107134131 13:36925586-36925608 TACAAAAATTAGCTGGGCATGGG - Intergenic
1107338634 13:39382542-39382564 TACAAAAATCAGCCGGGCATGGG - Intronic
1107531911 13:41290547-41290569 TACAAAAATTAGCTGGGCACTGG - Intergenic
1107702626 13:43063162-43063184 TACAAAAATTAGCTGGGCATGGG - Intronic
1107812907 13:44217219-44217241 TACAAAAATTAGCTGGGCATGGG - Intergenic
1107857213 13:44628152-44628174 CAAAAAAATTAGCCGGGCTTGGG + Intergenic
1107934749 13:45336141-45336163 TACAAAAATTAGCTGGGCATAGG + Exonic
1108042834 13:46355448-46355470 CAAAAAAATTAGCCAGGCATGGG - Intronic
1108114782 13:47115480-47115502 AAAAAAAATTAGCCGGGCGAGGG + Intergenic
1108313773 13:49219453-49219475 CACAAAATTTAGCCGGGGCTTGG + Intergenic
1108386733 13:49906063-49906085 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1108514603 13:51188582-51188604 TACAAAATTTAGCCAGGCATGGG + Intergenic
1108606542 13:52045282-52045304 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1109795861 13:67312168-67312190 TACAAAAATTAGCTGGGCATGGG + Intergenic
1109897507 13:68712343-68712365 TACAAAAATTAGCCGGGCGGTGG + Intergenic
1111176421 13:84602201-84602223 CAAAAAAATTAGCCAGGCATGGG - Intergenic
1111658430 13:91179930-91179952 TACAAAAATTAGCCAGGCATGGG - Intergenic
1112254287 13:97815226-97815248 TACAAAAATTAGCTGGGCATGGG + Intergenic
1112280424 13:98058221-98058243 CAAAAAAATTAGCCGGGCGTAGG + Intergenic
1112922090 13:104626380-104626402 TGCAAAAATTAGCCGGGCATGGG + Intergenic
1114149187 14:20016196-20016218 CACAAAACTAAACCTAGCAAAGG + Intergenic
1114151529 14:20045635-20045657 TACAAAAATTAGCTGGGCATTGG - Intergenic
1114290029 14:21280398-21280420 CACAAAAATTAGCCGGGCAATGG - Intergenic
1114300821 14:21375745-21375767 TACAAAAATTAGCCAGGCATGGG - Intronic
1114421032 14:22582849-22582871 TACAAAAATTAGCCGGGCATGGG + Intronic
1114859075 14:26492808-26492830 CATAAAAATTAGCCAGGCATGGG + Intronic
1115038333 14:28888335-28888357 TACAAAAATTAGCCAGGCATGGG - Intergenic
1115317462 14:32040088-32040110 TACAAAAATTAGCCAGGCATGGG - Intergenic
1115530662 14:34324036-34324058 TACAAAAATTAGCCGGGCGTAGG - Intronic
1115557194 14:34553078-34553100 TACAAAAATTAGCCGGGCGTTGG + Intergenic
1115560925 14:34582284-34582306 TACAAAAGTTAGCCAGGCATGGG - Intronic
1115570698 14:34663896-34663918 CAAAAACATTAGCCGGGCATGGG - Intergenic
1115573714 14:34690900-34690922 CAAAAAAATTAGCCGGGCGGTGG - Intergenic
1115603293 14:34976318-34976340 TACAAAAATTAGCCAGGCATGGG + Intergenic
1115632928 14:35263530-35263552 TACAAAAATTAGCCAGGCATGGG + Intronic
1115639310 14:35322322-35322344 TACAAAAATTAGCTGGGCATGGG + Intergenic
1115685407 14:35791449-35791471 CAAAAAAATTAGCCGGGCATTGG + Intronic
1115700254 14:35946446-35946468 TACAAAAATTAGCTGGGCATGGG - Intergenic
1115745682 14:36435002-36435024 AAAAAAATTTAGCCGGGCATGGG - Intergenic
1117089630 14:52236918-52236940 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1117669723 14:58094173-58094195 TACAAAAATTAGCTGGGCATGGG + Intronic
1118026659 14:61775408-61775430 TACAAAAATTAGCCGGGTATGGG - Intronic
1118175080 14:63431111-63431133 TACAAAAATTAGCTGGGCATAGG + Intronic
1118393878 14:65319202-65319224 TACAAAAATTAGCCAGGCAGTGG - Intergenic
1118567772 14:67161136-67161158 TACAAAAATTAGCCGGGCGTTGG + Intronic
1118852943 14:69598568-69598590 TACAAAAATTAGCTGGGCATTGG - Intergenic
1118882176 14:69838687-69838709 TACAAAACTTAGCTGGGCACTGG - Intergenic
1119076083 14:71640777-71640799 TACAAAAGTTAGCCGGGCGTAGG - Intronic
1119275483 14:73351315-73351337 TACAAAAATTAGCTGGGCATGGG + Intronic
1119279734 14:73395466-73395488 TACAAAAATTAGCCTGGCAGTGG + Intronic
1119458132 14:74774386-74774408 CAAAAAAATTAGCTGGGCCATGG - Intronic
1119490569 14:75028992-75029014 TACAAAAATTAGCCGGGGCATGG + Intronic
1119503915 14:75155111-75155133 CATAAAAATTAGCCGGGCTTGGG - Intronic
1119565302 14:75623894-75623916 TACAAAAATTAGCCAGGCATTGG + Intronic
1119657988 14:76431138-76431160 TACAAAAATTAGCCAGGCATGGG + Intronic
1119753916 14:77100394-77100416 CACAAAAATTAGCTGGGCTTGGG - Intronic
1120206578 14:81593569-81593591 CACAAAACTTAGAAGTACAAAGG - Intergenic
1120789478 14:88566032-88566054 CACAAAAATTAGCCGGGGGGGGG - Intronic
1120804317 14:88729713-88729735 TACAAAAATAAGCCGGGGAATGG - Intronic
1120866642 14:89300949-89300971 CAAAAAAATTAGCCGGGCATGGG - Intronic
1120946956 14:90006837-90006859 TACAAAAATTAGCCAGGCATGGG - Intronic
1120976475 14:90253494-90253516 TACAAAAATTAGCTGGGCATGGG + Intergenic
1121079906 14:91099376-91099398 TACAAAAATTAGCCAGGCATGGG + Intronic
1121218372 14:92265957-92265979 TACAAAATTTAGCCGGGCATGGG + Intergenic
1121387245 14:93539055-93539077 TACAAAAATTAGCCGGGCGTGGG - Intronic
1121743533 14:96270123-96270145 TACAAAAATTAGCCAGGCATGGG + Intergenic
1121881583 14:97505716-97505738 TACAAAAATTAGCCGGGCATGGG + Intergenic
1122405798 14:101500232-101500254 CACAGCTCTTAGCCGGGCAAGGG + Intergenic
1122488899 14:102100030-102100052 TACAAAAATTAGCCAGGCAGTGG + Intronic
1122701831 14:103594874-103594896 TACAAAAATTAGCTGGGCCATGG + Intronic
1122756324 14:103983215-103983237 TACAAAAATTAACCGGGCATGGG - Intronic
1122910154 14:104823754-104823776 TACAAAAATTAGCTGGGCATGGG + Intergenic
1122996116 14:105265594-105265616 TACAAAAATTAGCTGGGCATGGG + Intronic
1202838899 14_GL000009v2_random:102009-102031 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1202908264 14_GL000194v1_random:92073-92095 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1123427691 15:20185387-20185409 TACAAAAATTAGCCTGGCATGGG + Intergenic
1123536928 15:21191937-21191959 TACAAAAATTAGCCTGGCATGGG + Intergenic
1124218119 15:27826148-27826170 CAGAACACTGTGCCGGGCAAAGG - Intronic
1124452434 15:29808111-29808133 TACAAAAATTAGCCAGGCATGGG + Intronic
1124498871 15:30209104-30209126 TACAAAAATTAGCTGGGCACTGG + Intergenic
1124657259 15:31518315-31518337 TACAAAAATTAGCCAGGCATTGG + Intronic
1124744708 15:32329572-32329594 TACAAAAATTAGCTGGGCACTGG - Intergenic
1124928355 15:34094377-34094399 TACAAAAATTAGCCGGGCGTTGG + Intronic
1124932158 15:34131320-34131342 TACAAAAATTAGCTGGGCATGGG + Intergenic
1125027341 15:35044235-35044257 TACAAAAATTAGCTGGGCATGGG - Intergenic
1125566347 15:40681839-40681861 TACAAAAATTAGCCAGGAAATGG - Intergenic
1125662893 15:41408108-41408130 TACAAAAATTAGCCGGGCATGGG + Intergenic
1125816217 15:42587008-42587030 TACAAAAATTAGCTGGGCATGGG - Intronic
1125820657 15:42627139-42627161 TACAAAAATTAGCTGGGCATGGG + Intronic
1125829751 15:42705905-42705927 CACAAAAATTAGCCAGGCGTGGG - Intronic
1125992921 15:44127718-44127740 TACAAAAATTAGCTGGGCATGGG + Intronic
1126478022 15:49087716-49087738 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1126590628 15:50336196-50336218 CACAAAAATTAGCCAGGCATGGG + Intronic
1126760775 15:51968384-51968406 TACAAAAATTAGCTGGGCATGGG + Intronic
1127076048 15:55326710-55326732 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1127119860 15:55762192-55762214 TACAAAAATTAGCCGGGCTGTGG + Intergenic
1127120969 15:55771745-55771767 CAAAAAAATTAGCCGGGGCATGG + Intergenic
1127300122 15:57644597-57644619 TACAAAAATTAGCTGGGCATGGG - Intronic
1127306700 15:57713037-57713059 CCAAAAAATTAGCCGGGCATTGG + Intronic
1127347681 15:58116820-58116842 TACAAAAATTAGCTGGGCAATGG + Intronic
1127524269 15:59776697-59776719 TACAAAAATTAGCCAGGCAGTGG - Intergenic
1127751284 15:62047271-62047293 ATCAAAAATTAGCCGGGCATGGG + Intronic
1127883185 15:63175996-63176018 TACAAAAATTAGCTGGGCATGGG - Intergenic
1128033550 15:64502901-64502923 TACAAAAATTAGCCGGGCATTGG + Intronic
1128044637 15:64606841-64606863 TACAAAAATTAGCCAGGCATGGG + Intronic
1128274222 15:66338974-66338996 TACAAAAATTAGCCAGGCATGGG + Intronic
1128344845 15:66847314-66847336 CACACAAATTAGCTGGGCATGGG - Intergenic
1128475572 15:67994269-67994291 CAAAAAAATTAGCCGGGCCGTGG + Intergenic
1128657634 15:69474165-69474187 TACAAAAATTAGCCAGGCATGGG - Intergenic
1128835261 15:70804427-70804449 TACAAAAATTAGCTGGGCATGGG - Intergenic
1128887007 15:71297488-71297510 TACAAAAATTAGCCAGGCATGGG - Intronic
1128906772 15:71474372-71474394 TACAAAAATTAGCCAGGCACAGG - Intronic
1128958078 15:71971004-71971026 CAAAAAAATTAGCCGGGCATGGG + Intronic
1129085580 15:73086808-73086830 TACAAAAATTAGCCAGGCATGGG - Intronic
1129096083 15:73209850-73209872 CACAAAAATTAGCTGGGCGTGGG + Intronic
1129146965 15:73656926-73656948 TACAAAAATTAGCCGGGCATGGG - Intergenic
1129281243 15:74486670-74486692 TACAAAAATTAGCCGGGCATGGG + Intergenic
1129319501 15:74766546-74766568 TACAAAAATTAGCTGGGCATTGG + Intergenic
1129366015 15:75055373-75055395 TACAAAAATTAGCCGGGCCATGG - Intronic
1129528564 15:76241643-76241665 TACAAAAATTAGCCAGGCATGGG + Intronic
1129860403 15:78856253-78856275 TACAAAAATTAGCCGGGCGTCGG + Intronic
1129986103 15:79921144-79921166 CACAAAAATTAGCTGGGCATGGG + Intronic
1129993014 15:79981020-79981042 TACAAAAATTAGCCGGGTATGGG - Intergenic
1130426275 15:83803986-83804008 TACAAAAATTAGCCAGGCACGGG + Intronic
1130529267 15:84733732-84733754 AACAAAAATTAGCTGGGCACTGG - Intergenic
1130552793 15:84902323-84902345 TACAAAAATTAGCTGGGCATGGG + Intronic
1130658729 15:85812947-85812969 TACAAAAATTAGCCGGGGCAAGG - Intergenic
1130687769 15:86053982-86054004 CACAAAAATCAGATGGGCAAAGG - Intergenic
1131178037 15:90222092-90222114 TACAAAAATTAGCTGGGCATGGG - Intronic
1131685898 15:94767324-94767346 TACAAAAATTAGCTGGGCATGGG + Intergenic
1131816775 15:96229671-96229693 TACAAAAATTAGCTGGGCATGGG + Intergenic
1132910859 16:2310247-2310269 TACAAAAATTAGCTGGGCATGGG + Intronic
1133134945 16:3704188-3704210 TACAAAAATTAGCTGGGCATGGG + Intronic
1133158258 16:3890957-3890979 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1133159820 16:3903585-3903607 TACAAAAATTAGCCAGGCAATGG - Intergenic
1133190537 16:4130473-4130495 TACAAAAATTAGCCGGGCATGGG + Intergenic
1133264036 16:4572452-4572474 AAAAAAAATTAGCCGGGCATGGG - Intronic
1133351065 16:5100726-5100748 TACAAAAATTAGCCGGGCATGGG - Intergenic
1133567725 16:7010717-7010739 TACAAAAATCAGCCGGGCAGTGG - Intronic
1133803133 16:9100687-9100709 TACAAAAATTAGCCAGGCATGGG - Intronic
1133888963 16:9860299-9860321 TACAAAAATTAGCCAGGCATGGG + Intronic
1133948863 16:10372751-10372773 TACAAAAATTAGCTGGGCATGGG - Intronic
1134061827 16:11203929-11203951 CACAAAAATTAGGCGGGCATAGG + Intergenic
1134185362 16:12080836-12080858 TACAAAAATTAGCCGGGCGTGGG - Intronic
1134267661 16:12705601-12705623 TACAAAAATTAGCTGGGCATGGG + Intronic
1134445990 16:14331788-14331810 CACAAAAACTAGCAGGGCATGGG + Intergenic
1134563536 16:15231351-15231373 CAAAAAAATTAGCCGGGCACGGG + Intergenic
1134588206 16:15430565-15430587 TACAAAAATTAGCCAGGCATGGG - Intronic
1134625066 16:15717638-15717660 TACAAAAATTAGCCGGGCAGTGG + Intronic
1134743501 16:16569506-16569528 CAAAAAAATTAGCCGGGCATGGG - Intergenic
1134785257 16:16936398-16936420 TACAAAAATTAGTGGGGCAATGG + Intergenic
1134831265 16:17325243-17325265 CAAAAAAATTAGCTGGGCATAGG + Intronic
1134924057 16:18142977-18142999 CAAAAAAATTAGCCGGGCATGGG + Intergenic
1135029389 16:19025908-19025930 CACACAAATTAGCTGGGCATGGG - Intronic
1135047230 16:19165954-19165976 TACAAAAATTAGCCCGGCATTGG - Intronic
1135053620 16:19212464-19212486 TACAAAAATTAGCTGGGCATGGG + Intronic
1135095593 16:19561950-19561972 TACAAAAATTAGCCGGGCGTGGG + Intronic
1135119986 16:19757516-19757538 CACAAAAATTAGCCAGGCCATGG + Intronic
1135316061 16:21445384-21445406 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1135368986 16:21877646-21877668 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1135442830 16:22493497-22493519 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1136119668 16:28124210-28124232 TACAAAAATTAGCCGGGCGTGGG - Intronic
1136138480 16:28273373-28273395 TACAAAAATTAGCTGGGCATGGG - Intergenic
1136155481 16:28379368-28379390 TACAAAAATTAGCCGGGCATGGG - Intergenic
1136156365 16:28385105-28385127 TACAAAAGTTAGCCGGGTAGTGG + Intronic
1136206722 16:28730182-28730204 TACAAAAGTTAGCCGGGTAGTGG - Intronic
1136207603 16:28735921-28735943 TACAAAAATTAGCCGGGCATGGG + Intergenic
1136312738 16:29424120-29424142 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1136326173 16:29525871-29525893 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1136440862 16:30265855-30265877 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1136476111 16:30514576-30514598 TACAAAAGTTAGCTGGGCATAGG - Intronic
1136535782 16:30898445-30898467 TACAAAAATTAGCCAGGCATTGG - Intronic
1136560343 16:31035379-31035401 TACAAAAATTAGCTGGGCATGGG - Intronic
1136585409 16:31181066-31181088 CACAAAAATTAGCCGGGCTGTGG - Intronic
1136602303 16:31300754-31300776 TACAAAAATTAGCCGGGCTGTGG + Intronic
1136751658 16:32641826-32641848 CACAAAAATTAGCTGGGCATGGG - Intergenic
1136856609 16:33664422-33664444 TACAAAAATTAGCCTGGCATGGG - Intergenic
1136985678 16:35102182-35102204 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
1137352665 16:47727172-47727194 CAAAAAAATTAGCCGGGCAATGG + Intergenic
1137489275 16:48918179-48918201 AACAAATCTTAGCCAGGCATGGG - Intergenic
1137695975 16:50462468-50462490 TACAAAAATTAGCCAGGCATGGG - Intergenic
1137740749 16:50770603-50770625 CACAAAAATTAGCTGGGCTCGGG - Intronic
1138074318 16:54025856-54025878 TACAAAAATTATCCGGGCATGGG + Intronic
1138356690 16:56386940-56386962 TACAAAAATTAGCCAGGCATGGG + Intronic
1138465823 16:57189147-57189169 TACAAAAATTAGCCAGGCACGGG - Intronic
1138555518 16:57769188-57769210 TACAAAAATTAGCTGGGCATGGG - Intronic
1138570156 16:57865617-57865639 TACAAAAATTAGCTGGGCATGGG + Intergenic
1138683413 16:58703992-58704014 AATAAAAATTAGCCGGGCCATGG - Intergenic
1138689835 16:58756952-58756974 CAAAAAAATTAGCCGGGTATTGG - Intergenic
1138745853 16:59362836-59362858 CAAAAAACTTAGCCTTGTAAAGG + Intergenic
1138777284 16:59738706-59738728 TACAAAAATTAGCTGGGCATGGG + Intronic
1138902751 16:61294627-61294649 CAAAAAAATTAGCCGGGCATTGG - Intergenic
1139526611 16:67520644-67520666 TACAAAAATTAGCTGGGCATGGG + Intronic
1139550778 16:67671825-67671847 CAAAAAAATTAGCTGGGCACTGG + Intergenic
1139557637 16:67722676-67722698 TACAAAAATTAGCTGGGCATGGG - Intergenic
1139561471 16:67745128-67745150 CAAAAAAATTAGCTGGGCATCGG - Intronic
1139769172 16:69259385-69259407 CAAAAAATTTAGCCGGGCGTTGG - Intronic
1139887376 16:70218171-70218193 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1140249587 16:73284160-73284182 TACAAAAATTAGCTGGGCACGGG + Intergenic
1140267259 16:73431383-73431405 TACAAAAATTAGCCGGGCTATGG + Intergenic
1140403150 16:74688122-74688144 TACAAAAATTAGCCGGGCGTTGG - Intronic
1140430219 16:74896478-74896500 TACAAAAATTAGCAGGGCATGGG + Intronic
1140431754 16:74910120-74910142 TACAAAAATTAGCCAGGCATGGG - Intronic
1140450820 16:75069566-75069588 TACAAAAATTAGCTGGGCATGGG - Intronic
1140462848 16:75154951-75154973 TACAAAAATTAGCTGGGCTATGG - Intronic
1140575462 16:76162882-76162904 TACAAAAATTAGCTGGGCATGGG - Intergenic
1140707039 16:77640468-77640490 CAAAAAAATTAGCCGGGCGCAGG + Intergenic
1140907434 16:79420877-79420899 CACAAAAATTATCCAGGCATGGG + Intergenic
1141040473 16:80668742-80668764 TACAAAAATTAGCCAGGCACGGG + Intronic
1141193839 16:81844474-81844496 TACAAAAATTAGCCGGGCATGGG - Intronic
1141463642 16:84192997-84193019 CAAAAAAATTAGCTGGGCACGGG - Intronic
1141991350 16:87612276-87612298 AACAAAACTTAGCTGGGCATGGG - Intronic
1142387932 16:89778479-89778501 AAAAAAACTTAGCCAGGCACAGG + Intronic
1203053794 16_KI270728v1_random:901079-901101 CACAAAAATTAGCTGGGCATGGG - Intergenic
1203118187 16_KI270728v1_random:1512897-1512919 TACAAAAATTAGCCTGGCATGGG - Intergenic
1142524782 17:532412-532434 TACAAAAATTAGCTGGGCATGGG - Intronic
1142539683 17:648393-648415 TACAAAACTTAGCTGGGCATGGG + Intronic
1142653466 17:1373086-1373108 CAAAAAAATTAGCCAGGCATGGG + Intronic
1142815547 17:2422155-2422177 TACAAAAATTAGCTGGGCATGGG + Intronic
1142892522 17:2953690-2953712 TACAAAAATTAGCTGGGCATGGG + Intronic
1143066497 17:4253063-4253085 TACAAAAATTAGCCGGACCAGGG + Intronic
1143129737 17:4670566-4670588 TACAAAAATTAGCCAGGCAGTGG + Intergenic
1143406582 17:6681730-6681752 CAAAAATATTAGCCGGGCACGGG - Intergenic
1143556143 17:7661913-7661935 TACAAAAATTAGCCTGGCAGTGG - Intronic
1143668737 17:8381771-8381793 CACAAAAATTAGCCGAGCCGTGG + Intronic
1143853698 17:9832574-9832596 AAAAAAACTTAGCCGAGCATGGG + Intronic
1143909539 17:10236310-10236332 CACAAAAATTAGCCGGGCGGTGG + Intergenic
1143955137 17:10662174-10662196 TACAAAAATTAGCCTGGCATGGG - Intergenic
1143986337 17:10917794-10917816 CAAAAGACTTTGCAGGGCAAAGG - Intergenic
1144514344 17:15905808-15905830 TACAAAAATTAGCTGGGCATGGG - Intergenic
1144532128 17:16049739-16049761 TACAAAAATTAGCCGGGGTATGG - Intronic
1144561947 17:16328124-16328146 TACAAAAATTAGCTGGGCATGGG + Intronic
1144871293 17:18373210-18373232 CACAAAAATTAGCTGGGCAGTGG + Intergenic
1144935317 17:18893713-18893735 CACAAAAATTAGCCAGGCAGTGG - Intronic
1145055483 17:19701011-19701033 TACAAAAATTAGCCAGGCATGGG + Intronic
1145187806 17:20810666-20810688 TACAAAAATTAGCCAGGCATAGG - Intergenic
1145220743 17:21086324-21086346 TACAAAAATTAGCCAGGCTATGG - Intergenic
1145246029 17:21270177-21270199 CGCAAAAATTAGCCGGGCGTGGG - Intergenic
1145874210 17:28304160-28304182 TACAAAAATTAGCCGGGGCATGG + Intergenic
1145961804 17:28891033-28891055 TACAAAAATTAGCTGGGCATGGG - Intronic
1146030622 17:29363202-29363224 TACAAAAATTAGCCGGGCCATGG + Intergenic
1146035070 17:29399137-29399159 TACAAAAATTAGCCAGGCAGTGG - Intronic
1146082732 17:29796494-29796516 TACAAAAATTAGCCAGGCCATGG - Intronic
1146185334 17:30720652-30720674 CACAAAAATTAGCCAGGCGGGGG + Intergenic
1146219029 17:31002463-31002485 TACAAAAATTAGCCGAGCATGGG - Intergenic
1146231681 17:31116820-31116842 CAAAAAAATTAGCTGGGCATGGG - Intronic
1146234996 17:31150877-31150899 CAAAAAAATTAGCCAGGCAATGG + Intronic
1146300151 17:31682141-31682163 TACAAAAATTAGCCGGCCACAGG - Intergenic
1146388818 17:32401956-32401978 CACAAAAATTAGCCAGGCACGGG - Intergenic
1146421609 17:32691559-32691581 TACAAAAATTAACCGGGCATAGG - Intronic
1146851172 17:36222953-36222975 TACAAAAATTAGCCAGGCATAGG + Intronic
1146867089 17:36346821-36346843 TACAAAAATTAGCCAGGCATAGG + Intronic
1146995236 17:37314793-37314815 TACAAAACTTACCCGGGCATGGG - Intronic
1147069959 17:37947430-37947452 TACAAAAATTAGCCAGGCATAGG + Intergenic
1147081482 17:38026950-38026972 TACAAAAATTAGCCAGGCATAGG + Intronic
1147097433 17:38150925-38150947 TACAAAAATTAGCCAGGCATAGG + Intergenic
1147145342 17:38481445-38481467 TACAAAAATTAGCCGGGCGTGGG - Intronic
1147220840 17:38929660-38929682 TACAAAAATTAGCCAGGCATGGG - Intergenic
1147226783 17:38985348-38985370 CACAAAAATTAGCCGGGTGTGGG - Intergenic
1147279377 17:39346019-39346041 CACAAAAATTAACCAGGCATTGG + Intronic
1147483206 17:40786802-40786824 TACAAAAATTAGCTGGGCCATGG + Intergenic
1147615701 17:41825998-41826020 TACAAAAATTGGCCGGGCATGGG + Intronic
1147731549 17:42606839-42606861 TACAAAAATTAGCCAGGCATTGG + Intronic
1147771276 17:42869079-42869101 TACAAAAATTAGCTGGGCATGGG + Intergenic
1147852700 17:43454278-43454300 TACAAAAATTAGCTGGGCATGGG + Intergenic
1147881676 17:43658350-43658372 TACAAAAATTAGCCGGGAGAGGG + Intronic
1147932752 17:43993158-43993180 TACAAAAATTAGCCAGGCATGGG + Intronic
1147975292 17:44244284-44244306 CACAAAAATTAGGCGGGGCACGG - Intergenic
1148031630 17:44625689-44625711 TACAAAAATTAGCCAGGCATGGG - Intergenic
1148039623 17:44696507-44696529 TACAAAAATTAGCCGAGCAATGG + Intergenic
1148096818 17:45058158-45058180 TACAAAAATTAGCCAGGCATGGG + Intronic
1148281893 17:46354797-46354819 CACAAAGATTAGCCAGGCATTGG + Intronic
1148304118 17:46572736-46572758 CACAAAGATTAGCCAGGCATTGG + Intronic
1148504311 17:48115214-48115236 CACAAAAATTAGCTGGGCGTGGG - Intronic
1148604608 17:48919630-48919652 TACAAAAATTAGCTGGGCATTGG - Intronic
1148648461 17:49232679-49232701 CACAAAAATTAGCTGGGCATGGG - Intergenic
1148697454 17:49569867-49569889 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1148897972 17:50851374-50851396 CAAAAAAATTAGCCGGGCTTGGG + Intergenic
1149238257 17:54618219-54618241 TACAAAAATTAGCCAGGCATGGG - Intergenic
1149267239 17:54940048-54940070 CACAAAAATTAGTTGGGCATTGG - Intronic
1149509098 17:57223127-57223149 CAAAAAAATTAGCCGGGCGCGGG + Intergenic
1149594542 17:57856725-57856747 TACAAAAATTAGCTGGGCATGGG - Intergenic
1149609014 17:57945863-57945885 TACAAAAATTAGCTGGGCATGGG + Intronic
1149697031 17:58624127-58624149 CAAAAAAATTAGCCGGGCGTAGG + Intronic
1149698212 17:58633670-58633692 CACAAAAATTAGCCGGGGGCCGG + Intronic
1149741901 17:59054818-59054840 TACAAAAATTAGCCGGGCTGTGG - Intronic
1149815809 17:59722687-59722709 CAAAAAAATTAGCCGGGCATGGG + Intronic
1149894437 17:60418245-60418267 TACAAAAATTAGCCAGGCGAGGG - Intronic
1150045921 17:61913181-61913203 TACAAAAATTAGCCAGGCATGGG + Intronic
1150061936 17:62075997-62076019 TACAAAAATTAGCTGGGCAGTGG + Intergenic
1150067649 17:62124977-62124999 TACAAAAATTAGCCAGGCATGGG - Intergenic
1150073661 17:62173787-62173809 TACAAAAATTAGCTGGGCATGGG + Intergenic
1150079137 17:62221049-62221071 TACAAAAATTAGCCAGGCATAGG + Intergenic
1150152678 17:62823277-62823299 TACAAAAATTAGCTGGGCATGGG + Intergenic
1150166953 17:62952999-62953021 TACAAAAATTAGCCGGTCATGGG - Intergenic
1150210346 17:63438200-63438222 CAGAAAACAAAGCCGGGCACTGG - Intronic
1150270575 17:63861892-63861914 TACAAAAATTAGCTGGGCATGGG + Intergenic
1150454955 17:65299879-65299901 TACAAAAATTAGCCAGGCATTGG + Intergenic
1150530529 17:65976891-65976913 TACAAAAATTAGCTGGGCATGGG - Intronic
1150537473 17:66057936-66057958 TACAAAAATTAGCCAGGCAGTGG + Intronic
1150720565 17:67610764-67610786 TACAAAAATTAGCTGGGCACTGG + Intronic
1150777202 17:68090772-68090794 TACAAAACTTAGCCTGGCATGGG + Intergenic
1150885267 17:69078351-69078373 TACAAAAATTAGCCGGGCGTTGG - Intergenic
1150912244 17:69400397-69400419 AACAAAAATTAGCCAGGCATGGG + Intergenic
1151021199 17:70619421-70619443 AAAAAAAATTAGCCGGGCATGGG + Intergenic
1151118684 17:71767632-71767654 TACAAAAATTAGCCAGGCATGGG - Intergenic
1151258702 17:72899805-72899827 TACAAAAGTTAGCCGGGCGTGGG + Intronic
1151279179 17:73059510-73059532 TACAAAAATTAGCCGGGCATGGG + Intronic
1151522540 17:74640664-74640686 TACAAAAGTTAGCTGGGCATTGG + Intergenic
1151609301 17:75161427-75161449 TACAAAAATTAGCCAGGCACTGG - Intronic
1151613497 17:75192597-75192619 TACAAAAATTATCCGGGCATGGG - Intergenic
1151791834 17:76310620-76310642 TACAAAAATTAGCCAGGCATTGG - Exonic
1151886794 17:76927392-76927414 TATAAAAATTAGCCGGGCATGGG - Intronic
1151949770 17:77344815-77344837 TACAAAAATTAGCCAGGCATGGG + Intronic
1152001552 17:77648788-77648810 TACAAAAATTAGCTGGGCACAGG - Intergenic
1152611684 17:81318036-81318058 CACAAGAATTAGCCGGGCTCAGG + Intronic
1152764784 17:82130346-82130368 TACAAAACTTAGTCGGGCATGGG - Intronic
1152818518 17:82423656-82423678 TACAAAAATTAGCTGGGCATCGG + Intronic
1152882429 17:82826568-82826590 TACAAAAATTAGCTGAGCAATGG - Intronic
1152981300 18:279742-279764 CATAAAAATTAGCTGGGCATGGG + Intergenic
1153254469 18:3156760-3156782 AAAAAAAATTAGCCGGGCATAGG - Intronic
1153300516 18:3587979-3588001 CAAAAAACTTATCAGGGCAAAGG - Intronic
1153933305 18:9897981-9898003 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1153984890 18:10343176-10343198 TACAAAAATTAGCCGGGCAGTGG + Intergenic
1154067261 18:11119292-11119314 TACAAAAATTAGCTGGGCATGGG - Intronic
1154219575 18:12440451-12440473 TACAAAAATTAGCTGGGCATTGG + Intergenic
1154226952 18:12513996-12514018 TACAAAAATTAGCCAGGCATAGG - Intronic
1154243944 18:12678799-12678821 TACAAAAATTAGCTGGGCATGGG + Intronic
1154469006 18:14679977-14679999 TACAAAATTTAGCTGGGCATGGG + Intergenic
1155210460 18:23596192-23596214 TACAAAAATTAGCCGGGCACAGG - Intergenic
1156255831 18:35395429-35395451 CACAAAAGTTAGCCAGCCATGGG - Intergenic
1156416956 18:36905265-36905287 CATAAAACTTAGCCATGCCATGG - Intronic
1156467226 18:37355516-37355538 CACAAAAATTAGCTGGGCGCAGG + Intronic
1157098205 18:44706429-44706451 TACAAAAATTAGCCAGGCATGGG + Intronic
1157226112 18:45866273-45866295 TACAAAAATTAGCCGGGGAATGG - Intronic
1157251544 18:46100094-46100116 TACAAAAATTAGCCCGGCATGGG + Intronic
1157955788 18:52096072-52096094 CACAAAAATTAGCCGGGAGGTGG + Intergenic
1158190440 18:54821905-54821927 TACAAAAATTAGCCAGGCATGGG - Intronic
1158224925 18:55190920-55190942 TACAAAAATTAGCTGGGCATGGG - Intergenic
1158462438 18:57658202-57658224 TACAAAAATTAGCCGGGCATGGG - Intronic
1158729319 18:60004638-60004660 TACAAAAATTAGCCAGGCATGGG - Intergenic
1159046994 18:63378282-63378304 TACAAAAATTAGCCAGGCATGGG - Intergenic
1159582364 18:70247668-70247690 TACAAAAATTAGCCGGGCATAGG + Intergenic
1160167552 18:76527606-76527628 TACAAAAATTAGCCGGGCGCGGG + Intergenic
1160813673 19:1025744-1025766 TACAAAAATTAGCCGGGCATGGG - Intergenic
1160850757 19:1190740-1190762 AAAAAAAATTAGCCGGGCATGGG + Intronic
1161073154 19:2272315-2272337 CACAAAAATTAGCTGGGCATCGG - Intronic
1161093700 19:2376612-2376634 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1161098388 19:2407369-2407391 CAAAAAAATTAGTCGGGCATAGG + Intronic
1161131690 19:2593587-2593609 TACAAAAATTAGCCGGGCATGGG + Intronic
1161147699 19:2688908-2688930 AACAAAAATTAGCCAGGCACGGG + Intronic
1161265740 19:3363424-3363446 TACAAAAATTAGCCGGGCATGGG - Intronic
1161305934 19:3568028-3568050 CACAAAAATTAGCTGGGCATGGG - Intronic
1161416009 19:4146799-4146821 TACAAAAATTAGCTGGGCACAGG - Intergenic
1161437459 19:4272475-4272497 TACAAAAATTAGCCGGGCATGGG + Intergenic
1161462780 19:4408627-4408649 TACAAAAATTAGCCAGGCCATGG - Intronic
1161538317 19:4833612-4833634 TACAAAAATTAGCCAGGCATGGG - Intergenic
1161549540 19:4904144-4904166 AACAAAAATTAGCCGGGCACGGG - Intronic
1161831686 19:6609994-6610016 TACAAAAATTAGCCAGGCATGGG + Intergenic
1161901702 19:7124065-7124087 CAAAAAAATTAGCCAGGCACTGG + Intronic
1162146263 19:8613839-8613861 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1162154478 19:8667698-8667720 TACAAAAATTAGCCGGGTAGTGG - Intergenic
1162230783 19:9264291-9264313 CACAAAAATTAGCTGGGCATGGG - Intergenic
1162269434 19:9602062-9602084 TACAAAAATTAGCTGGGCAAAGG + Intergenic
1162368579 19:10264896-10264918 TACAAAAATTAGCCAGGCATGGG - Intergenic
1162399170 19:10434358-10434380 CAAAAAAATTAGCTGGGCTATGG - Intronic
1162422921 19:10576244-10576266 AAAAAAAATTAGCCGGGCATGGG - Intronic
1162442267 19:10700344-10700366 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1162576592 19:11502877-11502899 TACAAAAATTAGCCGGGCATGGG + Intronic
1162678600 19:12320652-12320674 TACAAAAGTTAGCTGGGCATGGG - Intronic
1162762202 19:12895413-12895435 TACAAAAATTAGCCAGGCACGGG - Intronic
1162774746 19:12972693-12972715 TACAAAACTTAGCCGGGCATGGG - Intronic
1162876695 19:13626042-13626064 TACAAAAATTAGCCGGGCATGGG - Intergenic
1162923048 19:13914795-13914817 TACAAAAATTAGCTGGGCATGGG - Intronic
1162956125 19:14099135-14099157 TACAAAAATTAGCCAGGCAAGGG + Intronic
1163047749 19:14657048-14657070 CACAAAAATTAGCCGGGCATGGG - Intronic
1163166680 19:15502935-15502957 TACAAAAATTAGCCGGGCATGGG - Intergenic
1163197925 19:15737438-15737460 TACAAAAATTAGCTGGGCATGGG - Intergenic
1163240665 19:16061438-16061460 CAAAAAAATTAGCCGGGCATAGG - Intergenic
1163317028 19:16547738-16547760 TACAAAAATTAGCCGGGCGTGGG + Intronic
1163407215 19:17130314-17130336 TACAGAAATTAGCCGGGCATTGG + Intronic
1163607723 19:18284368-18284390 TACAAAAATTAGCCAGGCATGGG + Intergenic
1163693878 19:18752790-18752812 TACAAAAATTGGCCGGGCATAGG - Intronic
1163709172 19:18835495-18835517 TACAAAAATTAGCCGGGGCATGG - Intronic
1163725013 19:18918032-18918054 TACAAAAATTAGCCGGGCCATGG + Intronic
1163770981 19:19191198-19191220 CAAAAAAATTAGCTGGGCATGGG + Intronic
1163801638 19:19369235-19369257 TACAAAAATTAGCCGGGCATTGG + Intergenic
1163823767 19:19511429-19511451 TACAAAATTTAGTCGGGCATGGG - Intergenic
1163873782 19:19848342-19848364 TACAAAAATTAGCGGGGCATGGG + Intergenic
1163954487 19:20623642-20623664 TACAAAAGTTAGCTGGGCATGGG + Exonic
1164630857 19:29760665-29760687 TACAAAAATTAGCTGGGCAGGGG - Intergenic
1164641342 19:29828255-29828277 AAAAAAAATTAGCCGGGCATGGG - Intergenic
1164770908 19:30808244-30808266 CACAAAAATTAGCTGGGCGTGGG - Intergenic
1164942106 19:32258690-32258712 TACAAAAATTAGCCGGGCATGGG + Intergenic
1164974648 19:32563282-32563304 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1164988967 19:32670835-32670857 TACAAAAATTAGCCAGGCATGGG + Intronic
1165036608 19:33038192-33038214 TACAAAAATTAGCTGGGCATGGG + Intronic
1165049336 19:33131811-33131833 AACAAAAATTAGCCAGGCATGGG - Intergenic
1165131731 19:33636744-33636766 TACAAAAATTAGCCGGGCATGGG + Intronic
1165536886 19:36455585-36455607 TACAAAAATTAGCCGGGCAATGG + Intronic
1165589320 19:36953755-36953777 TACAAAAATTAGCCAGGCATGGG + Intronic
1165683296 19:37796223-37796245 TACAAAAATTAGCTGGGCATGGG + Intronic
1165750819 19:38258471-38258493 TACAAAAATTAGCTGGGCATGGG + Intronic
1165889610 19:39102990-39103012 TATAAAACTTAACCGGGCATGGG - Intronic
1166071180 19:40389025-40389047 TACAAAAATTAGCCGGGCATGGG + Intronic
1166115258 19:40649418-40649440 TACAAAAATTAGCCAGGAAATGG + Intergenic
1166335779 19:42106263-42106285 TACAAAAATTAGCTGGGCATGGG - Intronic
1166386448 19:42384681-42384703 CTTAAAAATTAGCTGGGCAAGGG - Intergenic
1166618325 19:44271662-44271684 CAGAAAAATTAGCCAGGCATGGG - Intronic
1166697742 19:44863311-44863333 AACAAAAATTAGCCGGGCACTGG + Intronic
1166735785 19:45083752-45083774 TAGAAAAATTAGCTGGGCAAAGG - Intronic
1166755587 19:45188962-45188984 TACAAAAATTAGCTGGGCAGAGG - Intronic
1166767093 19:45258136-45258158 TACAAAAATTAGCCAGGCATTGG - Intronic
1166837414 19:45676047-45676069 TACAAAAATTAGCTGGGCATGGG + Intronic
1166850046 19:45755601-45755623 TACAAAAATTAGCCGGGCATGGG - Intronic
1167060265 19:47140404-47140426 TACAAAAATTAGCCGGGCGTGGG - Intronic
1167152990 19:47720319-47720341 TACAAAAATTAGCCGGACATGGG - Intronic
1167171099 19:47832638-47832660 TACAAAAATTAGCTGGGCACAGG - Intronic
1167179853 19:47894601-47894623 AAAAAAAATTAGCCGGGCATAGG - Intergenic
1167181031 19:47903602-47903624 TACAAAAATTACCCGGGCATGGG - Intergenic
1167181699 19:47908961-47908983 TACAAAAATTACCCGGGCATGGG - Intergenic
1167182349 19:47914351-47914373 TACAAAAATTACCCGGGCATGGG - Intergenic
1167183018 19:47919702-47919724 TACAAAAATTACCCGGGCATGGG - Intergenic
1167183686 19:47925053-47925075 TACAAAAATTACCCGGGCATGGG - Intergenic
1167184314 19:47930103-47930125 TACAAAAATTACCCGGGCATGGG - Intergenic
1167184986 19:47935454-47935476 TACAAAAATTACCCGGGCATGGG - Intergenic
1167185638 19:47940843-47940865 TACAAAAATTACCCGGGCATGGG - Intergenic
1167186305 19:47946201-47946223 TACAAAAATTACCCGGGCATGGG - Intergenic
1167186956 19:47951589-47951611 TACAAAAATTACCCGGGCATGGG - Intergenic
1167187606 19:47956972-47956994 TACAAAAATTACCCGGGCATGGG - Intergenic
1167268737 19:48496601-48496623 TACAAAAGTTAGCCAGGCATGGG - Intronic
1167337189 19:48894185-48894207 TACAAAAATTAGCCAGGCAAGGG - Intronic
1167396210 19:49231099-49231121 TACAAAAATTAGCCGGGCTGTGG - Intergenic
1167447666 19:49547884-49547906 CAAAAAAATTAGCCGGGCAGTGG - Intergenic
1167484663 19:49754941-49754963 TACAAAAATTAGCCGGGGATGGG + Intronic
1167541563 19:50091315-50091337 TACAAAAATTACCCGGGCATGGG + Intergenic
1167542235 19:50096660-50096682 TACAAAAATTACCCGGGCATGGG + Intergenic
1167542671 19:50099725-50099747 TACAAAAATTACCCGGGCATGGG + Intergenic
1167543107 19:50102790-50102812 TACAAAAATTACCCGGGCATGGG + Intergenic
1167543543 19:50105853-50105875 TACAAAAATTACCCGGGCATGGG + Intergenic
1167544215 19:50111198-50111220 TACAAAAATTACCCGGGCATGGG + Intergenic
1167544890 19:50116551-50116573 TACAAAAATTACCCGGGCATGGG + Intergenic
1167545565 19:50121903-50121925 TACAAAAATTACCCGGGCATGGG + Intergenic
1167546242 19:50127230-50127252 TACAAAAATTACCCGGGCATGGG + Intergenic
1167546919 19:50132565-50132587 TACAAAAATTACCCGGGCATGGG + Intergenic
1167547577 19:50137938-50137960 TACAAAAATTACCCGGGCATGGG + Intergenic
1167712543 19:51121323-51121345 CTCAAAGCTGAGCCAGGCAAGGG - Intergenic
1167785774 19:51635037-51635059 CACAAAAATTAGCTGGGCATGGG + Intronic
1167835298 19:52063499-52063521 TACAAAAATTAGCTGGGCAGTGG - Intronic
1167856856 19:52248858-52248880 TACAAAAATTAGCAGGGCATGGG + Intergenic
1167878061 19:52430700-52430722 TACAAAATTTAGCTGGGTAATGG - Intronic
1167946790 19:52994588-52994610 TACAAAACTTAGCCGGGCATGGG - Intergenic
1168009171 19:53516294-53516316 TACAAAAATTAGCTGGGCATGGG + Intergenic
1168014781 19:53563878-53563900 TACAAAAATTAGCCGGGCGTGGG + Intronic
1168142054 19:54394863-54394885 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1168161329 19:54512235-54512257 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1168220326 19:54955872-54955894 TACAAAAATTAGCCAGGCATGGG - Intronic
1168310469 19:55457380-55457402 TACAAAAATTAGCCAGGCAGTGG + Intronic
1168318870 19:55496912-55496934 TACAAAAATTAGCCAGGCATGGG - Intronic
1168386014 19:55963703-55963725 AAAAAAAATTAGCCGGGCAATGG - Intronic
1168425823 19:56237763-56237785 TATAAAAATTAGCCGGGCATGGG + Intronic
1168532551 19:57141238-57141260 TACAAAAATTAGCCGGGCGTGGG + Intronic
925193556 2:1905041-1905063 TACAAAACTTAGCCAGGCGGTGG - Intronic
925473217 2:4185010-4185032 TACAAAACTTAGCCTGGCATGGG - Intergenic
925757484 2:7147672-7147694 CACAAAAATTACCTGGGCATGGG - Intergenic
926169686 2:10544757-10544779 CACAAAAATTAGCCGGGCGTGGG + Intergenic
926186645 2:10696060-10696082 CACAAAAATTAGCCAGGTAGTGG - Intergenic
926460119 2:13118627-13118649 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
926460543 2:13124562-13124584 TACAAAAATTAGCCTAGCAAAGG + Intergenic
926818548 2:16826841-16826863 TACAAAAATTAGCCAGGCATGGG - Intergenic
926905076 2:17798077-17798099 TACAAAAATTAGCCGGGCGGTGG + Intronic
927536888 2:23870051-23870073 TACAAAAATTAGCCAGGCACGGG + Intronic
927641210 2:24846731-24846753 TACAAAAATTAGCCGGGCATGGG - Intronic
927805725 2:26144851-26144873 TACAAAAATTAGCCAGGCATGGG + Intergenic
927831858 2:26358246-26358268 TACAAAATTTAGCCAGGCTATGG + Intronic
928000993 2:27523051-27523073 TACAAAAATTAGCCAGGCATTGG - Intronic
928307448 2:30181864-30181886 CAAAAAAATTAGCCAGGCATGGG - Intergenic
928449135 2:31363155-31363177 TACAAAAATTAGCCAGGCATAGG + Intronic
928521812 2:32096278-32096300 TACAAAAATTAGCTGGGCATGGG + Intronic
929126889 2:38530270-38530292 TACAAAAATTAGCAGGGCATGGG - Intergenic
929193258 2:39159685-39159707 TACAAAAATTAGCTGGGCATGGG + Intergenic
929500048 2:42482566-42482588 TACAAAAATTAGCCGGGCCTGGG + Intronic
929679830 2:43981502-43981524 TACAAAAATTAGCTGGGCAGTGG + Intronic
929800014 2:45091998-45092020 CACAAAAATTAGCCAGGTATGGG - Intergenic
929997582 2:46838460-46838482 CACAAAAATCAGCCAGGCCATGG - Intronic
930181267 2:48360856-48360878 TACAAAAATTAGCTGGGCATGGG + Intronic
930670890 2:54149094-54149116 CACAAAAATTAGCTGGGCATGGG + Intronic
930734774 2:54765612-54765634 CAGAAAACTTAGCCGGACATAGG - Intronic
930788474 2:55297563-55297585 TACAAAAATTAGCCTGGCATGGG - Intronic
930805567 2:55485800-55485822 TACAAAAATTAGCCAGGTAATGG + Intergenic
930857665 2:56036465-56036487 CACAAAAATTAGCCATGCCAAGG - Intergenic
930876862 2:56228685-56228707 CAAAAAAATTAGCCAGGCATGGG - Intronic
931017268 2:57997737-57997759 TACAAAAATTAGCCAGGCAATGG + Intronic
931262570 2:60632835-60632857 TACAAAAGTTAGCCGGGTATGGG + Intergenic
931336211 2:61346667-61346689 TACAAAAATTAGCCAGGCATGGG + Intronic
931456466 2:62413389-62413411 TACAAAAATTAGTCGGGCATGGG - Intergenic
931485718 2:62689486-62689508 TACAAAAATTAGCCGGGCATTGG + Intronic
931575709 2:63716367-63716389 CGCAAAACTTAGCTGGGGTAGGG - Intronic
931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG + Intergenic
932147491 2:69335865-69335887 TACAAAAATTAGCCAGGCATGGG + Intronic
932551682 2:72776460-72776482 TACAAAAATTAGCCAGGCATGGG + Intronic
932833339 2:75011409-75011431 CAAATAAATTAGCCGGGCATGGG - Intergenic
933707532 2:85303189-85303211 TACAAAAATTAGCTGGGCAAGGG - Intronic
933821274 2:86114442-86114464 TACAAAAATTAGCCGGGCGTGGG - Intronic
933825116 2:86152604-86152626 TACAAAAATTAGCCAGGCATGGG + Intronic
934081497 2:88472295-88472317 TACAAGAATTAGCCGGGCATGGG - Intergenic
934291408 2:91695780-91695802 TACAAAAATTAGCCAGGCATGGG + Intergenic
934618883 2:95792144-95792166 CAGAAACCTGAGCCGGGGAAAGG - Intergenic
934642010 2:96032413-96032435 CAGAAACCTGAGCCGGGGAAAGG + Intronic
935119593 2:100172151-100172173 TACAAAAATTAGCCGGGCGCAGG - Intergenic
935154537 2:100471381-100471403 CACAAAACTGGGCCTTGCAAAGG + Intronic
935379993 2:102441731-102441753 TACAAAAATTAGCCGGGCGTGGG + Intronic
936132845 2:109861586-109861608 AAAAAAAATTAGCCGGGCATGGG - Intergenic
936211852 2:110509899-110509921 AAAAAAAATTAGCCGGGCATGGG + Intergenic
936420991 2:112364478-112364500 AAAAAAAATTAGCCGGGCATGGG + Intergenic
936585922 2:113757454-113757476 TATAAAAATTAGCCGGGCATTGG - Intergenic
936685943 2:114826683-114826705 TACAAAAATTAGCCAGGCATGGG - Intronic
936787220 2:116108055-116108077 TACAAAAAATAGCCGGGCATGGG - Intergenic
937021722 2:118663356-118663378 TACAAAAATTAGCTGGGCATGGG - Intergenic
937404592 2:121615183-121615205 TACAAAAATTAGCCGGGCATAGG + Intronic
937814278 2:126233849-126233871 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
937951384 2:127390514-127390536 TACAAAACTTAGCTGGGCGTGGG - Intergenic
938271313 2:129974673-129974695 CAAAAAAATTAGCCGGGCGAGGG + Intergenic
938417292 2:131114278-131114300 TACAAAAATTAGCCGGGCGTGGG - Intronic
938849315 2:135244314-135244336 CACAAAAATTAGCTAGGCATTGG + Intronic
938907651 2:135854070-135854092 TACAAAAGTTAGCTGGGCATGGG + Intronic
939674582 2:145056168-145056190 CACAAAAATTAGCTGGGCTTGGG + Intergenic
940359633 2:152783382-152783404 TACAAAAATTAGCTGGGCATGGG - Intergenic
940863883 2:158797635-158797657 TACAAAAATTAGCCGGGCGTGGG + Intronic
940868874 2:158843333-158843355 TACAAAAATTAGCTGGGCATGGG - Intronic
940999700 2:160188756-160188778 CAAAAAAATTAGCCAGGCATGGG - Intronic
941004338 2:160232379-160232401 TACAAAAATTAGCTGGGCATGGG + Intronic
941026597 2:160462749-160462771 TACAAAAATTAGCTGGGCATGGG - Intronic
941102450 2:161311152-161311174 TACAAAAATTAGCCGGGCATGGG + Intronic
941760323 2:169235063-169235085 TACAAAAATTAGCTGGGCATGGG - Intronic
941794887 2:169588007-169588029 TACAAAAATTAGCTGGGCATTGG + Intronic
941989452 2:171540917-171540939 TACAAAAATTAGCCAGGCATGGG - Intronic
942058400 2:172206167-172206189 TACAAAAATTAGCCGGGGCATGG + Intergenic
942565372 2:177261019-177261041 TACAAAAATTAGCCGGGCAGTGG + Intronic
942658514 2:178239778-178239800 AAAAAAAATTAGCCGGGCATGGG - Intronic
943127591 2:183814761-183814783 TACAAAAATTAGCCAGGCATGGG + Intergenic
943340081 2:186670453-186670475 TACAAAACTTAGCTGGGCATGGG - Intronic
943814504 2:192235618-192235640 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
943932767 2:193876146-193876168 TACAAAACTTAGCCGGGCCGTGG + Intergenic
944293568 2:198035880-198035902 CAAAAAAATTAGCCGGGCATGGG + Intronic
944309412 2:198216562-198216584 TACAAAAATTAGCCAGGCATGGG + Intronic
944554383 2:200873342-200873364 CACAAAAATTAGCTGGGCATGGG - Intronic
944710453 2:202330536-202330558 TACAAAAATTAGCTGGGCATTGG + Intergenic
944718121 2:202395779-202395801 TACAAAAATTAGCCAGGCATGGG + Intronic
944788631 2:203100700-203100722 TACAAAAATTAGCCGGGCTGTGG - Intronic
944809833 2:203317202-203317224 TACAAAAATTAGCCAGGCATTGG - Intergenic
944844304 2:203653617-203653639 TACAAAAATTAGCGGGGCATAGG + Intergenic
945049851 2:205813279-205813301 TACAAAAATTAGCCAGGCATGGG - Intergenic
945081126 2:206086605-206086627 CACAGAACTTAGCCCTGTAATGG - Intergenic
945226493 2:207536398-207536420 TACAAAAATTAGCTGGGCATGGG + Intronic
945448391 2:209965280-209965302 TACAAAAATTAGCCGGGCATGGG + Intronic
945591212 2:211733924-211733946 TACAAAAATTAGCCAGGCAGAGG + Intronic
945771921 2:214054162-214054184 TACAAAAATTAGCCGGGTATGGG - Intronic
945785899 2:214236495-214236517 TACAAAAATTAGCCGGGCATGGG + Intronic
945963735 2:216163442-216163464 TACAAAAATTAGCCGGGCGTGGG - Intronic
945994694 2:216426014-216426036 TACAAAAATTAGCCGGCCATGGG - Intronic
946061611 2:216946580-216946602 TACAAAAGTTAGCTGGGCAGTGG - Intergenic
946296815 2:218790988-218791010 TACAAAACTTGGCTGGGCACAGG - Intronic
946645314 2:221827033-221827055 TACAAAAATTAGCCGGGCATGGG + Intergenic
946685132 2:222260743-222260765 TAGAAAAATTAGCCGGGCATGGG - Intronic
946744768 2:222834516-222834538 TACAAAAATTAGCCGGGCGTAGG + Intergenic
946835027 2:223764071-223764093 CACAAAAATTAGCCGGGCATGGG - Intronic
946899891 2:224362055-224362077 TACAAAAATTAGCCAGGCATGGG + Intergenic
947185695 2:227453357-227453379 TACAAAAATTAGCCAGGCATGGG - Intergenic
947317678 2:228879296-228879318 TACAAAAATTAGCCAGGCATTGG + Intronic
947477580 2:230464935-230464957 TACAAAAATTAGCCAGGCATGGG + Intronic
947539684 2:230967552-230967574 CACAAAAATTAGCCGGGCATGGG - Intergenic
947557858 2:231113008-231113030 TACAAAAATTAGCCAGGCATGGG + Intronic
947613481 2:231538817-231538839 TACAAAAATTAGCCGGGCGTCGG - Intergenic
947678494 2:232007488-232007510 TACAAAAATTAGCCAGGCACAGG - Intronic
947858587 2:233341966-233341988 TACAAAAATTAGCCAGGCCATGG + Intronic
948144178 2:235696198-235696220 TACAAAAATTAGCTGGGCATGGG - Intronic
948507857 2:238442264-238442286 CACAAAAATTAGCCGGGTGTGGG - Intronic
948548697 2:238752952-238752974 CAAAAAAATCAGCCGGGCATGGG - Intergenic
1168743468 20:215120-215142 AAAAAAAATTAGCCGGGCATGGG - Intergenic
1168994212 20:2120630-2120652 TACAAAACTTGGCAGGGGAAAGG - Intronic
1169014614 20:2281541-2281563 TACAAAAATTAGCCGGGCATGGG - Intergenic
1169102912 20:2967704-2967726 TACAAAAATTAGCTGGGCATGGG + Intronic
1169151373 20:3292152-3292174 TACAAAAATTAGCCAGGCATTGG - Intronic
1169181647 20:3574355-3574377 CACAAAAATTAGCCAGGCATGGG + Intronic
1169361724 20:4955634-4955656 CAAAAAAATTAGCCGGGTATGGG + Intronic
1169407876 20:5338883-5338905 TACAAAAATTAGCCAGGCATGGG - Intergenic
1169705269 20:8496350-8496372 TACAAAAATTAGCCAGGCAGGGG + Intronic
1169709890 20:8549724-8549746 TACAAAAGTTAGCCAGGCATTGG - Intronic
1170189950 20:13635540-13635562 TACAAAAATTAGCCAGGCATGGG - Intronic
1170197267 20:13702248-13702270 TACAAAAATTAGCCAGGCCATGG + Intergenic
1170244653 20:14207250-14207272 CACAAAAATTAGCTGGGCGTAGG - Intronic
1170588982 20:17756849-17756871 CCCAAAACTTAGCCAAGCAGAGG - Intergenic
1170862558 20:20121647-20121669 TACAAAAATTAGCTGGGCACAGG - Intronic
1171049469 20:21841852-21841874 CACAAAAATTAACCAGGCATGGG - Intergenic
1171507136 20:25646675-25646697 TACAAAAATTAGCTGGGCATGGG - Intergenic
1171510351 20:25677704-25677726 TATAAAAATTAGCCAGGCAATGG - Intronic
1172016139 20:31874562-31874584 TACAAAAATTAGCCAGGCATGGG - Intronic
1172201195 20:33127239-33127261 TACAAAAATTAGCTGGGCATTGG + Intergenic
1172242312 20:33421454-33421476 TACAAAAATTAGCCAGGCCATGG + Intronic
1172245078 20:33440299-33440321 TACAAACATTAGCCGGGCATGGG + Intronic
1172249331 20:33467829-33467851 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1172259148 20:33547044-33547066 TACAAAAATTAGCCAGGCATGGG + Intronic
1172302054 20:33857286-33857308 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1172383129 20:34513682-34513704 TACAAAAATTAGCCGTGCATTGG - Intergenic
1172741477 20:37171444-37171466 TACAAAAATTAGCTGGGCAATGG + Intronic
1172821290 20:37737067-37737089 CAAAAAAATTAGCCGGGCATGGG + Intronic
1172861428 20:38056234-38056256 TACAAAAATTAGCCAGGCATGGG + Intronic
1172919267 20:38467803-38467825 AACAAAAATTAGCCAGGCATGGG - Intergenic
1173264726 20:41468858-41468880 TACAAAAATTAGCCAGGCATGGG + Intronic
1173455728 20:43199738-43199760 AAAAAAACTTAGCCGGGCGGTGG + Intergenic
1173606108 20:44332932-44332954 TACAAAAATTAGCCAGGCCACGG + Intergenic
1173967000 20:47120050-47120072 TACAAAAATTAGCCGGGGCATGG + Intronic
1173978913 20:47207993-47208015 TACAAAAATTAGCTGGGCATGGG + Intergenic
1174031602 20:47632835-47632857 TACAAAAATTAGCTGGGCATGGG - Intronic
1174118868 20:48247483-48247505 TACAAAAATTAGCCGGGCATGGG - Intergenic
1174274845 20:49396191-49396213 TACAAAAATTAGCCGGGCACGGG + Intronic
1174463423 20:50699136-50699158 TATAAAAATTAGCCGGGCAGTGG + Intergenic
1174556148 20:51397045-51397067 TACAAAAATTAGCCGGGCCATGG - Intronic
1174615618 20:51833151-51833173 TACAAAAATTAGCCGGGCTTGGG - Intergenic
1174644038 20:52070440-52070462 TACAAAAATTAGCCGGGCATTGG + Intronic
1174793482 20:53502219-53502241 TACAAAAATTAGCCGAGCATGGG - Intergenic
1175059417 20:56228237-56228259 CTCAAAAGTGAGCCAGGCAAAGG + Intergenic
1175070357 20:56328044-56328066 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1175107187 20:56623939-56623961 TACAAAAATTAGCCGGGCTCGGG + Intergenic
1175351535 20:58324710-58324732 TACAAAAATTAGCTGGGCATGGG + Intronic
1175452292 20:59079788-59079810 TACAAAACTTAGCTGGGCATTGG - Intergenic
1175455258 20:59107740-59107762 TACAAAAATTAGCCAGGCATGGG - Intergenic
1175957730 20:62620135-62620157 TACAAAAATTAGCTGGGCATGGG - Intergenic
1176627623 21:9106751-9106773 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1176725738 21:10431165-10431187 CACAAAAATTAGCTGAGCATGGG - Intergenic
1176805515 21:13477694-13477716 TACAAAACTTAGCTGGGCATGGG - Intergenic
1177152986 21:17473331-17473353 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1177562016 21:22768219-22768241 TACAAAAATTAGCCGGGCATGGG - Intergenic
1177636789 21:23797755-23797777 TACAAAAATTAGCCAGGCAGGGG + Intergenic
1177657846 21:24042175-24042197 TACAAAAATTAGCTGGGCATGGG + Intergenic
1177694055 21:24549415-24549437 GACAAAAATTAGCCAGGCATGGG - Intergenic
1177971590 21:27796810-27796832 TACAAAAATTAGCTGGGCATGGG + Intergenic
1178264219 21:31127570-31127592 TACAAAAATTAGCCGGGCGTGGG - Intronic
1178301636 21:31458262-31458284 TACAAAAATTAGCTGGGCATAGG + Intronic
1178606892 21:34045423-34045445 TACAAAAATTAGCCGGGTGATGG - Intergenic
1178608679 21:34060932-34060954 TACAAAAATTAGCTGGGCATGGG + Intergenic
1178954506 21:37010335-37010357 TACAAAAGTTAGCCAGGCAGTGG + Intronic
1179333134 21:40424941-40424963 CAAAAAAATTAGCTGGGCATGGG + Intronic
1179795621 21:43781246-43781268 TACAAAAATTAGCCAGGCATGGG - Intergenic
1179892472 21:44343543-44343565 CAAAAAAATTAGCTGGGCATGGG + Intergenic
1179919756 21:44501293-44501315 TACAAAAATTAGCCAGGCATGGG + Intronic
1180228092 21:46409746-46409768 TACAAAAATTAGCCGGGCGTGGG - Intronic
1180379522 22:12126554-12126576 TACAATAATTAGCCGGGCATGGG - Intergenic
1180681116 22:17627665-17627687 TACAAAAATTAGCCGGGCTTGGG + Intronic
1181010557 22:20037932-20037954 CAAAAAAATTAGCTGGGCATGGG + Intronic
1181062547 22:20288681-20288703 TACAAAAATTAGCTGGGCATAGG - Intergenic
1181101354 22:20541946-20541968 TACAAAAGTTAGCCGGGCATTGG - Intronic
1181221636 22:21367640-21367662 TACAAAAATTAGCTGGGCATGGG - Intergenic
1181259463 22:21587038-21587060 TACAAAAATTAGCCAGGCATAGG - Intronic
1181384029 22:22530372-22530394 TACAAAAATTAGCCAGGCATGGG - Intergenic
1181689784 22:24552615-24552637 TACAAACATTAGCCGGGCAGGGG + Intronic
1181746100 22:24955869-24955891 CAAAAAAATTAGCCAGGCATGGG + Intronic
1181753016 22:25002933-25002955 TACAAAAATTAGCTGGGCACTGG - Intronic
1182233677 22:28858919-28858941 TACAAAAATTAGCTGGGCATGGG - Intergenic
1182339365 22:29606888-29606910 TACAAAAATTAGCTGGGCATGGG + Intronic
1182412808 22:30201570-30201592 TACAAAAATTAGCCGGGCGAGGG - Intergenic
1182488977 22:30657302-30657324 CACACAAATTAGCCGGGCGTGGG + Intronic
1182568439 22:31217241-31217263 TACAAAAATTAGCCGGGCATGGG + Intronic
1182778006 22:32845345-32845367 TACAAAAATTAGCTGGGCATGGG - Intronic
1182809033 22:33100191-33100213 AACAAAAATTAGCCAGGCATGGG + Intergenic
1182880437 22:33728382-33728404 TACAAAAATTAGCCAGGCACGGG + Intronic
1182903196 22:33916124-33916146 TACAAAAATTAGCCGGGCGTGGG + Intronic
1182973086 22:34595991-34596013 TACAAAAATTAGCTGGGCATGGG - Intergenic
1183085188 22:35482680-35482702 TACAAAACTTAGCCGGGCATTGG + Intergenic
1183226353 22:36552885-36552907 TACAAAAATTAGCCAGGCATGGG - Intergenic
1183363468 22:37394946-37394968 TACAAAAATTAGCTGGGAAAGGG + Intronic
1183393476 22:37559268-37559290 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1183609627 22:38890747-38890769 TACAAAAATTAGCTGGGCATGGG + Intergenic
1183611317 22:38908463-38908485 TACAAAAATTAGCCAGGCATGGG - Intergenic
1183686863 22:39366117-39366139 TACAAAAATTAGCCAGGCAGAGG - Intronic
1183699428 22:39442214-39442236 TACAAAAATTAGCCGGGTATGGG + Intergenic
1183728665 22:39604730-39604752 AAAAAAAATTAGCCGGGCATGGG - Intronic
1183790047 22:40059976-40059998 TACAAAACTTAGCTAGGCAATGG - Intronic
1183835875 22:40452653-40452675 TACAAAAATTAGCCGGGCGTGGG + Intronic
1183889568 22:40915418-40915440 TACAAAAATTAGCCTGGGAATGG + Intronic
1184019565 22:41811581-41811603 TACAAAAATTAGCCGGGCCTGGG - Intronic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
1184223657 22:43116611-43116633 TACAAAAATTAGCCGGGCGTGGG - Intronic
1184349077 22:43931668-43931690 TACAAAAATTAGCTGGGCATGGG - Intronic
949305053 3:2630282-2630304 AACAAAAATTAGCCAGGCATGGG + Intronic
949353552 3:3152305-3152327 TACAAAAATTAGCCGGGTATGGG - Intronic
949551005 3:5113046-5113068 TACAAAAATTAGCTGGGCATAGG - Intergenic
949758910 3:7446612-7446634 CACAAAAATTAGCCGGGCTGTGG - Intronic
949770576 3:7572665-7572687 CAAAAAAATTAGCCAGGCATGGG + Intronic
949770705 3:7574312-7574334 TACAAAAATTAGCCAGGCATGGG - Intronic
949978682 3:9484527-9484549 TACAAAAATTAGCCGGGCATAGG - Intergenic
949988988 3:9561922-9561944 CAAAAAAATTAGCCGGGCATGGG - Intergenic
950038095 3:9901820-9901842 TACAAAAATTAGCCAGGCATGGG + Intergenic
950086091 3:10259023-10259045 TACAAAAATTAGCTGGGCCATGG - Intronic
950435715 3:12978549-12978571 TACAAAAATTAGCCGGGCGTGGG + Intronic
951066507 3:18272940-18272962 CAAAAAAATTAGCCAGGCATGGG + Intronic
951103814 3:18719878-18719900 TACAAAAATTAGCCGGGCATGGG + Intergenic
952058924 3:29483152-29483174 CAAAAAAATTAGCCGGGCTTGGG + Intronic
952371236 3:32724711-32724733 CACAAAAATTAGCCAGGCATTGG - Intronic
952763661 3:36936945-36936967 TACAAAAATTAGCCAGGCATGGG + Intronic
952910431 3:38179961-38179983 TACAAAAATTAGCCGGGCATGGG - Intronic
953056693 3:39393128-39393150 TACAAAAATTAGCTGGGCATGGG + Intronic
953363676 3:42323449-42323471 CAAAAAAATTAGCCAGGCATGGG - Intergenic
953620270 3:44526910-44526932 TACAAAAATTAGCCAGGCATGGG + Intergenic
953633801 3:44644481-44644503 TACAAAAATTATCCGGGCATGGG + Exonic
953740163 3:45531530-45531552 TACAAAAATTAGCCGGGCGTAGG - Intronic
953961483 3:47269434-47269456 TACAAAAATTAGCCAGGCATGGG - Intronic
954208846 3:49082094-49082116 TACAAAAATTAGCCGGGTATGGG - Intronic
954233696 3:49239124-49239146 TACAAAAATTAGCTGGGCATGGG - Intronic
954247223 3:49341200-49341222 TACAAAAAATAGCCGGGCAGTGG + Intergenic
954670040 3:52285886-52285908 TACAAAAATTAGCTGGGCATGGG - Intronic
954726411 3:52614723-52614745 TACAAAAATTAGCCGGACATGGG - Intronic
954893549 3:53955294-53955316 TACAAAAATTAGCCAGGCGATGG + Intergenic
955337030 3:58095354-58095376 TACAAAAATTAGCCGGGCTGAGG - Intronic
955390178 3:58516681-58516703 TACAAAAATTAGCTGGGCATGGG + Intronic
955466289 3:59240603-59240625 TACAAAAATTAGCTGGGCATGGG + Intergenic
956423508 3:69109681-69109703 TACAAAAATTAGCTGGGCATTGG - Intronic
956473805 3:69597512-69597534 TACAAAAATTAGCTGGGCATGGG + Intergenic
956816041 3:72909221-72909243 TACAAAAATTAGCCAGGCATGGG - Intronic
956826642 3:73003365-73003387 CACAAAAATTAGCCAGGCAATGG - Intronic
957088098 3:75701512-75701534 TACAAAAATTAGCCAGGCATGGG + Intergenic
957628908 3:82693237-82693259 TACAAAAATTAGCAGGGCATGGG - Intergenic
957965134 3:87312518-87312540 TACAAAAATTAGCCAGGCATGGG - Intergenic
958916985 3:100060706-100060728 CACAAGATTTAGCCAGGCACAGG + Intronic
958941219 3:100316926-100316948 TACAAAAATTAGCTGGGCATGGG + Intronic
958997405 3:100920575-100920597 TGCAAAAATTAGCCGGGCATGGG - Intronic
959077990 3:101771287-101771309 CAAAAAGATTAGCCGGGCATTGG + Intergenic
959304323 3:104641440-104641462 TACAAAAATTAGCCAGGCAGTGG + Intergenic
959402264 3:105917414-105917436 TACAAAACTTAGCCCAGCATGGG - Intergenic
959706976 3:109347478-109347500 CACAAAAATTAGCCGGGCGTGGG + Intergenic
959729283 3:109582475-109582497 TACAAAAATTAGCCGGGCATGGG + Intergenic
959836532 3:110924805-110924827 TACAAAAATTAGCCAGGCCATGG - Intergenic
960672128 3:120164536-120164558 TACAAAAATTAGCCGGGCGTGGG - Intergenic
960876858 3:122305042-122305064 CACAAAAATTAGCCGGGCATGGG + Intergenic
961146324 3:124596891-124596913 TACAAAAATTAGCCAGGCATTGG + Intronic
961547921 3:127648761-127648783 TACAAAAATTAGCTGGGCATAGG - Intronic
961585558 3:127919382-127919404 CACAAAAATTAGCTGGGCATGGG - Intronic
961719762 3:128885544-128885566 CAAAAAAATTAGCTGGGCATGGG - Intronic
962068955 3:132013066-132013088 TACAAAAATTAGCCAGGCATAGG + Intronic
962296174 3:134189616-134189638 CAAAAAAATTAGCCGGGCGTGGG + Intronic
962469441 3:135692675-135692697 TACAAAAATTAGCCGGGCGTTGG + Intergenic
962484393 3:135828145-135828167 TACAAAAATTAGCCGGGCATTGG + Intergenic
962499656 3:135977853-135977875 CACAAATATTAGCCGGGCAGTGG - Intronic
963158599 3:142126790-142126812 TACAAAAATTAGCCAGGCAGTGG + Intronic
963170645 3:142247539-142247561 TACAAAAATTAGCCAGGCATTGG + Intergenic
963197615 3:142550939-142550961 TACAAAAATTAACCGGGCATGGG - Intronic
963207333 3:142650371-142650393 GACAAAGATTAGCCGGGCATGGG - Intronic
963480574 3:145868268-145868290 TACAAAAATTAGCCAGGCATGGG - Intergenic
963506429 3:146190628-146190650 TACAAAAATTAGCCGGGCGTGGG + Intergenic
963648576 3:147947608-147947630 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
964280923 3:155064133-155064155 TGCAAAAATTAGCCGGGCATGGG + Intronic
964314577 3:155429671-155429693 GACAAAAATTAGCCAGGCATTGG + Intronic
964353249 3:155823866-155823888 TACAAAAATTAGCCAGGCATAGG - Exonic
964466146 3:156995675-156995697 TACCAAAATTAGCCGGGCATGGG + Intronic
964852452 3:161109288-161109310 TACAAAAATTAGCCTGGCATGGG + Intronic
965157952 3:165088486-165088508 CACAAAAATTAGCTAGGCAGTGG + Intergenic
965356219 3:167676292-167676314 TACAAAAATTAGCCAGGCATGGG + Intergenic
965480010 3:169206596-169206618 TACAAAAATTAGCCAGGCATGGG + Intronic
965747075 3:171937016-171937038 TACAAAAATTAGCCGGGCGTGGG + Intronic
966385115 3:179388031-179388053 AAAAAAAATTAGCTGGGCAAGGG - Intronic
966430683 3:179828762-179828784 CACAAAAATTAGCCCACCAAAGG - Intronic
966516384 3:180825274-180825296 TACAAAAATTAGCTGGGCATGGG + Intronic
966611999 3:181876813-181876835 TACAAAAATTAGCCAGGCATGGG - Intergenic
966692771 3:182758589-182758611 AACAAAAATTAGCCGGGCGTGGG - Intergenic
967078514 3:186026933-186026955 TATAAAAATTAGCTGGGCAATGG - Intergenic
967253195 3:187564064-187564086 CACAAAAATTAGCTGGGCATGGG + Intergenic
967869094 3:194214830-194214852 TACAAAAATTAGCCAGGCATGGG + Intergenic
967938924 3:194751110-194751132 TACAAAAATTAGCCGGGCGTAGG + Intergenic
967974643 3:195026333-195026355 TACAAAAATTAGCCAGGCTATGG + Intergenic
968022710 3:195408306-195408328 TACAAAAATTAGCCGGGCATTGG + Intronic
968032349 3:195511192-195511214 TACAAAAATTAGCTGGGCAGTGG + Intergenic
968076583 3:195819096-195819118 TACAAAAATTAGCCAGGCATGGG - Intergenic
968166895 3:196473698-196473720 TACAAAAATTAGCCGGGCGTGGG + Intronic
968314090 3:197707808-197707830 TACAAAAATTAGCCGGGCATGGG + Intronic
968444873 4:647011-647033 TACAAAAATTAGCCGGGCCGCGG - Intronic
968494620 4:908506-908528 TACAAAACTTAGCCAGGCACAGG + Intronic
969270257 4:6094839-6094861 CAAAAAAATTAGCTGGGCATAGG + Intronic
969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG + Intergenic
969530240 4:7726416-7726438 TACAAAAATTAGCTGGGCATGGG + Intronic
970170212 4:13281771-13281793 TACAAAAGTTAGCCAGGCATGGG + Intergenic
970478897 4:16452925-16452947 TACAAAAATTAGCTGGGCATGGG - Intergenic
970585170 4:17508282-17508304 CAAAAAAGTTAGCTGGGCATTGG + Intronic
970609420 4:17711322-17711344 TACAAAAATTAGCCGGGCGTGGG + Intronic
970695515 4:18672302-18672324 CACAAAAATTAGCCCGGGTATGG - Intergenic
970720170 4:18977682-18977704 TACAAAAATTAGCCTGGCATGGG + Intergenic
971788323 4:31134303-31134325 CACACAAATTAGCTGGGCATGGG + Intronic
972122290 4:35719310-35719332 TACAAAAATTAGCCAGGCATTGG - Intergenic
972306882 4:37839265-37839287 CAAAAAAATTAGCCAGGCATGGG - Intronic
972457618 4:39269690-39269712 CACAAAAATTACCCAGGCATGGG + Intronic
972472645 4:39421898-39421920 TACAAAAATTAGCAGGGCAGTGG - Intronic
972500867 4:39676671-39676693 TACAAAAATTAGCTGGGCATCGG + Intergenic
972694798 4:41434669-41434691 TACAAAAGTTAGCCGGGCATGGG - Intronic
972731903 4:41802991-41803013 TACAAAAATTAGCCAGGCATCGG + Intergenic
973197011 4:47456090-47456112 TACAAAAATTAGCCGGGCATGGG + Intronic
973247394 4:48024131-48024153 TACAAAAATTAGCGGGGCATGGG - Intronic
973701332 4:53540226-53540248 TACAAAAATTAGCCAGGCATGGG + Intronic
973887490 4:55337693-55337715 TACAAAAATTAGCTGGGCATGGG + Intergenic
973927694 4:55756236-55756258 CAAAAAAATTAGCCGAGCATGGG + Intergenic
974374047 4:61054017-61054039 TACAAAAATTAGCCGGGGTATGG - Intergenic
974422285 4:61692596-61692618 TACAAAAATTAGCCAGGCATGGG - Intronic
975156372 4:71077313-71077335 TACAAAAATTAGCCGAGCATGGG - Intergenic
975294653 4:72719409-72719431 CAAAAAAATTAGCTGGGCATGGG + Intergenic
975635557 4:76444648-76444670 TACAAAAATTAGCCAGGCATGGG - Intronic
975654578 4:76628994-76629016 GAAAAAACTTAGCTGGGTAATGG - Intronic
976191612 4:82492281-82492303 TACAAAAATTAGCTGGGCATGGG - Intronic
976249329 4:83034496-83034518 CAAAAAAATTAGCCGGGCGTAGG - Intronic
976425158 4:84894630-84894652 TACAAAAATTAGCCGGGCATGGG + Intronic
976561779 4:86510265-86510287 TACAAAAATTAGCCAGGCATGGG - Intronic
976747754 4:88421599-88421621 TACAAAAATTAGCCAGGCATGGG - Intronic
976789869 4:88866200-88866222 TACAAAAATTAGCTGGGCCATGG - Intronic
976865565 4:89722155-89722177 TACAAAAATTAGTCGGGCTAAGG + Intergenic
977035863 4:91952335-91952357 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
977253561 4:94715302-94715324 TACAAAAATTAGTCGGGCATGGG - Intergenic
977535044 4:98248020-98248042 CACAAAAGTTAGCCGGGGCATGG - Intergenic
978526334 4:109670559-109670581 TACAAAAATTAGCTGGGCATGGG + Intronic
978529021 4:109695599-109695621 TACAAAAATTAGCTGGGCATGGG + Intronic
979163158 4:117490164-117490186 TACAAAAATTAGCTGGGCAATGG - Intergenic
979287557 4:118942950-118942972 TACAAAAATTAGCTGGGCATGGG + Intronic
979463247 4:121007025-121007047 TACAAAAATTAGCTGGGCATGGG - Intergenic
980031778 4:127840063-127840085 TACAAAAATTAGCGGGGCCATGG + Exonic
980293631 4:130879097-130879119 AAAAAAAATTAGCTGGGCAATGG - Intergenic
980307460 4:131081563-131081585 CTCAAAACTTAGTGAGGCAAAGG - Intergenic
980854193 4:138419653-138419675 TACAAAAATTAGCTGGGCCATGG - Intergenic
980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG + Intergenic
981015302 4:139968122-139968144 TACAAAAATTAGCCAGGCATGGG + Intronic
981023658 4:140054213-140054235 TACAAAAACTAGCCGGGCATGGG + Intronic
981524355 4:145694737-145694759 CTAAAAACTTGGCCGGGCAGAGG - Intronic
981778721 4:148400622-148400644 TACAAAAATTAGCCAGGCATTGG + Intronic
981988187 4:150883303-150883325 TACAAAAATTAGCCAGGCATGGG + Intronic
982012190 4:151116630-151116652 TACAAAAATTAGCCAGGCTATGG - Intronic
982180411 4:152744421-152744443 CACAAAAGTTATGGGGGCAAGGG + Intronic
982268013 4:153557923-153557945 TACAAAAATTAGCCAGGCAGTGG - Intronic
982747700 4:159121880-159121902 AAAAAAAATTAGCCGGGCATAGG + Intronic
982797569 4:159664082-159664104 TACAAAAATTAGCTGGGCATGGG - Intergenic
983209224 4:164941581-164941603 TACAAAAATTAGCCAGGCATGGG + Intergenic
983551283 4:169019866-169019888 TACAAAAATTAGCCGGGCATGGG + Intergenic
983822620 4:172214667-172214689 TACAAAAATTAGCTGGGCATGGG - Intronic
984030325 4:174596366-174596388 TACAAAAATTAGCTGGGCATGGG + Intergenic
984357378 4:178680070-178680092 TACAAAAATTAGCCAGGCATGGG + Intergenic
984719090 4:182953495-182953517 TACAAAAATTAGCTGGGCATGGG - Intergenic
984735606 4:183105061-183105083 TACAAAAATTAGCCGGGTACAGG - Intronic
985002854 4:185503073-185503095 CAAAAAAATTAGCCGGGCGTGGG + Intronic
985102631 4:186473802-186473824 TACAAAAATTAGCCAGGCATGGG + Intronic
985233566 4:187848735-187848757 CACAAAAATTAGGTGGGCATGGG - Intergenic
985238117 4:187899094-187899116 TACAAAAATTAGCTGGGCATGGG - Intergenic
985274291 4:188222757-188222779 TACAAAAATTAGCTGGGCAGTGG + Intergenic
985424272 4:189813080-189813102 CAGAAAACTTAGCAGGGAAGAGG - Intergenic
1202761143 4_GL000008v2_random:112039-112061 TACAATAATTAGCCGGGCATGGG - Intergenic
985862980 5:2488751-2488773 CACAATTCTTACCTGGGCAACGG + Intergenic
986128178 5:4902952-4902974 TGCAAAAATTAGCCGGGCATGGG + Intergenic
986336198 5:6757859-6757881 TACAAAAATCAGCCGGGCATGGG - Intergenic
986901584 5:12440927-12440949 TACAAAAATTAGCCGGGCGTTGG - Intergenic
986930950 5:12820393-12820415 TACAAAAATTAGCTGGGCATGGG - Intergenic
987312853 5:16697543-16697565 TACAAAAATTAGCTGGGCATTGG + Intronic
987763436 5:22194484-22194506 TACAAAAATTAGGCGGGCATGGG - Intronic
987971003 5:24944775-24944797 TACAAAACTTAGCTGGGCATGGG - Intergenic
988106565 5:26757661-26757683 GACAAAAATTAGTCTGGCAAAGG + Intergenic
988573566 5:32396581-32396603 TACAAAAATTAGCTGGGCATGGG + Intronic
988730913 5:33971779-33971801 CACAAAAATTAGCCAGGCATGGG - Intronic
988951591 5:36267350-36267372 TACAAAAATTAGCTGGGCATGGG + Intronic
989049841 5:37308396-37308418 TACAAAAATTAGCTGGGCAATGG + Intronic
989199032 5:38745002-38745024 CACAAAAATTAGCCGAGCATGGG - Intergenic
990388099 5:55288086-55288108 TACAAAAACTAGCCGGGCATGGG + Intronic
990435934 5:55791967-55791989 CACAAAAATTAGCCAGGCATGGG + Intronic
990468377 5:56090498-56090520 TACAAAAATTAGCCAGGCATTGG + Intergenic
990584860 5:57200976-57200998 TACAAAAATTAGCCAGGCATGGG - Intronic
990591073 5:57265661-57265683 TACAAAAATTAGCCGGGCGTGGG + Intergenic
990824070 5:59877661-59877683 TACAAAAATTAGCTGGGCATTGG + Intronic
991363527 5:65844856-65844878 AAAAAAAATTAGCCGGGCATGGG + Intronic
991466216 5:66915107-66915129 TACAAAAATTAGCCGGGCATGGG + Intronic
991898151 5:71427575-71427597 TACAAAAATTAGCCGGGCATGGG - Intergenic
991900098 5:71452208-71452230 TACAAAAATTAGCCGGGGCAGGG - Intergenic
992241685 5:74776349-74776371 CAAAAAAATTAGCCAGGCAGTGG + Intronic
992417998 5:76571327-76571349 AACAAAAATTAGCTGGGCATGGG - Intronic
992527002 5:77621335-77621357 AAAAAAAATTAGCCGGGCATAGG + Intergenic
992813282 5:80410723-80410745 TACAAAAATTAGCTGGGCATGGG - Intronic
992871498 5:81009999-81010021 TGCAAAAATTAGCCGGGCATGGG + Intronic
993389723 5:87304620-87304642 CACAAAAATTAGCTGGGTATGGG - Intronic
993864965 5:93182754-93182776 AACAAAATTTAGGCTGGCAATGG - Intergenic
994047779 5:95328823-95328845 AACAAAAATTAGCTGGGCAGTGG + Intergenic
994512273 5:100719615-100719637 TACAAAAATTAGCCGGGCATTGG - Intergenic
994716173 5:103324060-103324082 TACAAAAATTAGCTGGGCATGGG - Intergenic
996067989 5:119100930-119100952 AAAAAAAATTAGCCGGGCGATGG - Intronic
996802125 5:127415747-127415769 TACAAAAATTAGCTGGGCATGGG + Intronic
997076503 5:130685010-130685032 CACAAAAATTAGCCGGGCAGTGG + Intergenic
997120951 5:131172257-131172279 TACAAAAATTAGCTGGGCATAGG + Intronic
997122260 5:131187638-131187660 TACAAAAATTAGCTGGGCATGGG - Intronic
997162597 5:131624966-131624988 TACAAAAAGTAGCCGGGCATGGG + Intronic
997314263 5:132919040-132919062 CACAAAAATTAGTTGGGCACGGG - Intronic
997932839 5:138086370-138086392 TACAAAAATTAGCCGGGCATGGG - Intronic
997961448 5:138324912-138324934 CACAAAAATTAGCTGGGCCGTGG + Intronic
998015680 5:138730201-138730223 TACAAAAATTAGCCAGGCCATGG + Intronic
998071236 5:139199305-139199327 AAAAAAAATTAGCCTGGCAACGG - Intronic
998085820 5:139321626-139321648 TACAAAAATTAGCCAGGCATTGG + Intronic
998089408 5:139355322-139355344 CAAAAAATTTAGCTGGGCATGGG - Intronic
998306078 5:141078401-141078423 TACAAAAATTAGCCGGGCCGTGG - Intergenic
998414089 5:141932938-141932960 TACAAAAGTTAGCCAGGCATGGG + Intronic
998505215 5:142667123-142667145 TACAAAAATTAGCTGGGCAACGG + Intronic
998642556 5:144027769-144027791 TACAAAAATTAGCTGGGCATGGG + Intergenic
998823976 5:146082646-146082668 CACAAAACTTAGCCAGGTGTGGG + Intergenic
998835780 5:146201816-146201838 TACAAAAATTAACCGGGCATGGG - Intergenic
999729857 5:154468575-154468597 TACAAAAATTAGCCGGGCATGGG - Intergenic
999920811 5:156318748-156318770 TACAAAACTGAGCCAGGCGAGGG - Intronic
999994354 5:157077912-157077934 TACAAAAATTAGCTGGGCATGGG + Intergenic
1000314315 5:160073908-160073930 TACAAAAATTAGCCGGGCATGGG + Intronic
1000608812 5:163353617-163353639 TACAAAAATTAGCCGGGCATGGG - Intergenic
1001495667 5:172186467-172186489 TACAAAAATTAGCCGGGCTGTGG + Intronic
1001660189 5:173385378-173385400 TACAAAAATTAGCTGGGCATGGG - Intergenic
1001943459 5:175757200-175757222 TACAAAAATTAGCTGGGCATGGG + Intergenic
1002037364 5:176482365-176482387 TACAAAAATTAGCCGGGCATGGG - Intronic
1002137636 5:177117647-177117669 AACAAAAATTAGCCGGGGATGGG + Intergenic
1002204092 5:177550980-177551002 ATCAAAACTTAGCTGGGCATGGG - Intronic
1002273089 5:178085712-178085734 TATAAAAATTAGCCGGGCAGAGG + Intergenic
1002544393 5:179929591-179929613 TACAAAAATTAGCTGGGCATGGG + Intronic
1002624156 5:180513049-180513071 CAAAAAAATTATCCGGGCATTGG - Intronic
1002738606 5:181416766-181416788 TACAAAAATTAGCTGGGCATGGG - Intergenic
1002900837 6:1408352-1408374 CAAAAGACTGAGCAGGGCAAGGG + Intergenic
1002991117 6:2239838-2239860 CAAAAAAATTAGCTGGGCATGGG - Intronic
1003216494 6:4118184-4118206 TACAAAAATTAGCCGGGGCATGG - Intronic
1003282848 6:4709350-4709372 TACAAAAATTAGCCGGGCATGGG - Intronic
1003315973 6:5012126-5012148 TACAAAAATTAGCCGGGCATGGG + Intergenic
1003362949 6:5446046-5446068 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1003375088 6:5569389-5569411 TACAAAAATTAGCCGGGCATGGG - Intronic
1003517311 6:6827735-6827757 CACAAAAATTAGCCAGGCATGGG + Intergenic
1003790039 6:9536019-9536041 CACAAAAATTAGCCGGGCTTTGG - Intergenic
1003805043 6:9718662-9718684 CAAAAAAATTAGCCAGGCAGTGG - Intronic
1003928076 6:10895996-10896018 TACAAAAATTAGCTGGGCAGTGG + Intronic
1003932202 6:10935647-10935669 TACAAAAATTAGCCGGGCATGGG - Intronic
1004346524 6:14854349-14854371 TACAAAAATTAGCCAGGCATAGG + Intergenic
1004509337 6:16272054-16272076 TACAAAAATTAGCCAGGCAGTGG + Intronic
1005485813 6:26298279-26298301 TACAAAAATTAGCCAGGCATTGG + Intergenic
1005497579 6:26401686-26401708 TACAAAAAGTAGCCGGGCATGGG + Intergenic
1005557629 6:27003790-27003812 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1005648483 6:27864892-27864914 TACAAAAATTAGCCGGGCTATGG + Intronic
1005649749 6:27875621-27875643 TACAAAAATTAGCCGGGAATGGG - Intergenic
1005729267 6:28681130-28681152 TACAAAAATTAGCTGGGCATGGG + Intergenic
1006103823 6:31703834-31703856 TACAAAAATTAGCCTGGCATGGG + Intronic
1006126031 6:31838852-31838874 TACAAAAATTAGCTGGGCATGGG + Intronic
1006178233 6:32136821-32136843 TACAAAAGTTAGCCGGGCGTGGG - Intergenic
1006330423 6:33386351-33386373 TACAAAATTTAGCTGGGCATGGG + Intergenic
1006537678 6:34713087-34713109 AACAAAACTTAGCTCGGCATGGG + Intergenic
1006550146 6:34815796-34815818 CAAAAAAATTAGCCGGGCCATGG - Intronic
1006619379 6:35352336-35352358 TACAAAAATTAGCCGGGCATTGG - Intronic
1006661598 6:35650627-35650649 TACAAAAATTAGCCGGGCATTGG - Intronic
1006839096 6:37016686-37016708 TACAAAAATTGGCCGGGCATGGG - Intronic
1006891767 6:37434761-37434783 CACAAAAATTAGCCGGGTGGTGG - Intronic
1006938351 6:37734102-37734124 CACAAATATTAGCTGGGCCATGG + Intergenic
1007487594 6:42192555-42192577 TACAAAAATTAGCCAGGCATGGG + Intronic
1007793032 6:44324534-44324556 TACAAAAATTAGCCGGGCATTGG - Intronic
1007796665 6:44354177-44354199 TACAAAAATTAGCCGGGCCTGGG + Intronic
1007799934 6:44383792-44383814 TACAAAACTTAGCCAGGCATGGG + Intergenic
1007900329 6:45405632-45405654 TACAAAAATTAGCCGGGCGGTGG + Intronic
1008151755 6:47961445-47961467 TACAAAAATTAGCCAGGCATGGG - Intronic
1008277937 6:49562763-49562785 TACAAAAATTAGCCAGGCATGGG - Intergenic
1008360866 6:50617012-50617034 AACAAAAATTAGCCAGGCATTGG + Intergenic
1008507320 6:52243914-52243936 TACAAAAATTAGCTGGGCATGGG - Intronic
1008594505 6:53027849-53027871 CACAAAAATTAGCCGGGCGCCGG + Intronic
1008615414 6:53221431-53221453 CACAAAAATTAGCTGGGCATGGG - Intergenic
1008734186 6:54521963-54521985 TACAAAAATTAACCAGGCAATGG - Intergenic
1008765371 6:54906537-54906559 TACAAAAATTAGCTGGGCATAGG - Intronic
1008957268 6:57229644-57229666 TACAAAAATTAGCTGGGCATGGG - Intergenic
1009419202 6:63446092-63446114 TACAAAAATTAGCCGGGCCATGG + Intergenic
1009541885 6:64970350-64970372 TATAAAAATTAGCCGGGCATAGG - Intronic
1009567051 6:65322638-65322660 TACAAAACTTAGCTGGGCCTGGG + Intronic
1009705440 6:67244458-67244480 CACAAAAATTAGCCGGGCAGTGG - Intergenic
1010138051 6:72578120-72578142 TACAAAAATTAGTCGGGCCATGG + Intergenic
1010201897 6:73289493-73289515 TACAAAAATTAGCCAGGCCATGG + Intronic
1010428423 6:75750732-75750754 TACAAAAATTAGCTGGGCAGTGG - Intronic
1011268405 6:85550651-85550673 TACAAAAATTAGCCGGGCACAGG - Intronic
1011694728 6:89902103-89902125 TACAAAAATTAGCTGGGCATGGG - Intergenic
1011959356 6:93068531-93068553 ACAAAAAATTAGCCGGGCAATGG - Intergenic
1012164413 6:95930264-95930286 TACAAAAATTAGCAGGGCATGGG - Intergenic
1012296622 6:97532550-97532572 TACAAAAATTAGCCGGGTATGGG - Intergenic
1012445594 6:99304129-99304151 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1012952879 6:105537879-105537901 TACAAAAATTAGCCAGGCAAGGG + Intergenic
1013000430 6:106016806-106016828 TACAAAAATTAGCTGGGCATGGG - Intergenic
1013247446 6:108300302-108300324 CAAAAAAATTAGCTGGGCAGTGG - Intronic
1013477931 6:110526543-110526565 TACAAAACTTAGCTGGACATGGG + Intergenic
1013509077 6:110828274-110828296 TACAAAAATTAGCCGGGTATGGG + Intronic
1013591328 6:111621589-111621611 TACAAAAATTAGCCAGGCATTGG + Intergenic
1013686701 6:112593230-112593252 CACAAAAATTGGCAGGGCAGTGG - Intergenic
1014129225 6:117811647-117811669 TACAAAAATTAGCTGGGCCATGG - Intergenic
1014264586 6:119261958-119261980 GAAAAAACATAGGCGGGCAAGGG + Intronic
1014353733 6:120377302-120377324 TACAAAAATTAGCCGGGCATGGG - Intergenic
1014516497 6:122385172-122385194 TACAAAAATTAGCCAGGCATGGG + Intergenic
1015216301 6:130754357-130754379 CATAAAAATTAGCCAGGCATTGG - Intergenic
1015322119 6:131888014-131888036 TACAAAAATTAGCTGGGCATGGG - Intronic
1015331028 6:131979416-131979438 TACAAAAATTAGCCGGGCATGGG - Intergenic
1015576873 6:134681148-134681170 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1015964858 6:138688104-138688126 TACAAAAATTAGCTGGGCATAGG - Intronic
1016082373 6:139871590-139871612 TACAAAAATTAGCTGGGCATTGG - Intergenic
1016123182 6:140368761-140368783 TACAAAAATTAGCCAGGCATGGG + Intergenic
1016442986 6:144103550-144103572 CAAAAAAATTAGCCAGGCATGGG - Intergenic
1016494405 6:144643640-144643662 TACAAAAATTAGCCAGGCATGGG + Intronic
1016636242 6:146295376-146295398 AAAAAAAATTAGCCGGGCATGGG - Intronic
1016740280 6:147520270-147520292 TACAAAAATTAGCCAGGCAATGG - Intronic
1016812332 6:148273446-148273468 TACAAAAATTAGCCGGGCATGGG - Intronic
1017427770 6:154340404-154340426 CACAAAAATTAACTGGGCATTGG - Intronic
1017488958 6:154927433-154927455 CACAAAAATTAGCTAGGCATGGG - Intronic
1017560644 6:155624797-155624819 TACAAAAATTAGCCAGGCATGGG - Intergenic
1017744632 6:157435692-157435714 TACAAAAATTAGGCGGGCATGGG - Intronic
1017783291 6:157733323-157733345 CAAAAAAATTAGCCGGACATGGG + Intronic
1017817173 6:158024268-158024290 TACAAAAATTAGCTGGGCATGGG + Intronic
1017861603 6:158403492-158403514 TACAAAAATTAGCCGGGCATAGG - Intronic
1017894107 6:158664388-158664410 TACAAAAATTAGCCGGGCGGTGG + Intronic
1018002663 6:159593406-159593428 TACAAAAGTTAGCTGGGCATGGG + Intergenic
1018254858 6:161907921-161907943 CACAAAAATTAGCCGGGTGTGGG + Intronic
1018385520 6:163299722-163299744 TACAAAAATTAGCTGGGCATGGG + Intronic
1018446791 6:163865925-163865947 TACAAAAATTAGCGGGGCGAGGG - Intergenic
1019243709 6:170692318-170692340 TACAAAAATTAGCTGGGCATGGG - Intergenic
1019794180 7:3037721-3037743 TACAAAAATTAGCCAGGCATGGG - Intronic
1019806776 7:3132491-3132513 TACAAAAATTAGCCAGGCAGGGG - Intergenic
1019994384 7:4714431-4714453 AACAAAAATTAGCCGGGCATGGG - Intronic
1020028770 7:4918640-4918662 TACAAAAATTAGCCAGGCACTGG - Intronic
1020121483 7:5506407-5506429 TACAAAAATTAGCCGGGCGTGGG - Intronic
1020133610 7:5573848-5573870 CACAAAATTAGGCCGGGCATGGG - Intergenic
1020144634 7:5633131-5633153 TACAAAAATTAGCTGGGCATGGG - Intronic
1020185632 7:5957330-5957352 AAAAAAAATTAGCCGGGCCATGG + Intronic
1020268859 7:6579979-6580001 TACAAAAATTAGCCAGGCATGGG + Intronic
1020297284 7:6767426-6767448 AAAAAAAATTAGCCGGGCCATGG - Intronic
1020495969 7:8853634-8853656 TACAAAAATTAGCCAGGCATGGG - Intergenic
1020777540 7:12473523-12473545 TACAAAAATTAGCTGGGCATGGG - Intergenic
1021128880 7:16886877-16886899 CACAAAAATTAGCTGGGTATGGG - Intergenic
1021325807 7:19266158-19266180 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
1021456007 7:20830334-20830356 TACAAAAATTAGCCGGGACATGG - Intergenic
1021714300 7:23447469-23447491 CAAAAAAATTAGCCAGGCATGGG + Intronic
1021745650 7:23738539-23738561 CACAAAAATTAGCCAGGAATGGG - Intronic
1021999717 7:26214751-26214773 TACAAAAATTAGCCAGGCATGGG + Intergenic
1022395670 7:29986078-29986100 TACAAAAGTTAGCCGGGCTGTGG + Intronic
1022420341 7:30214988-30215010 TACAAAAATTAGCTGGGCAGTGG + Intergenic
1022991122 7:35708342-35708364 AAAAAAAATTAGCCGGGCATGGG - Intergenic
1023020170 7:36004732-36004754 TACAAAAATTAGCCAGGCATGGG + Intergenic
1023102991 7:36737830-36737852 TACAAAAATTAGCCAGGCATGGG - Intergenic
1023456337 7:40342795-40342817 TACAAAAATTAGCCAGGCATGGG - Intronic
1023482388 7:40647694-40647716 TACAAAAATTAGCCAGGCATGGG + Intronic
1023647223 7:42330540-42330562 TACAAAAATTAGCCTGGCATAGG - Intergenic
1023720428 7:43088047-43088069 TACAAAAATTAGCTGGGCATGGG + Intergenic
1023935184 7:44734621-44734643 TACAAAAATTAGCCAGGCATGGG + Intergenic
1023951424 7:44848884-44848906 TACAAAAGTTAGCTGGGCATTGG - Intergenic
1023973329 7:45008192-45008214 TAAAAAAATTAGCCGGGCATGGG - Intronic
1023973994 7:45014293-45014315 TACAAAAATTAGCCGGGTATGGG - Intronic
1024182069 7:46906649-46906671 TACAAAAATTAGCTGGGCATGGG + Intergenic
1024217916 7:47263516-47263538 AACAAAAATTAGCCAGGTAATGG + Intergenic
1024535752 7:50430796-50430818 TACAAAAATTAGCTGGGCATGGG + Intergenic
1024690254 7:51793381-51793403 TACAAAAATTAGCTGGGCATGGG + Intergenic
1024814106 7:53247643-53247665 CAAAAAACTTAGCCAGGCATGGG + Intergenic
1024937948 7:54730983-54731005 TACAAAAATTAGCTGGGCATGGG + Intergenic
1025083038 7:56000911-56000933 CACAGAAATTAGCTGGGCATGGG + Intergenic
1025166187 7:56714393-56714415 TACAAAAATTAGCCAGGCATGGG + Intergenic
1025899790 7:65734598-65734620 TACAAAAATTAGCCAGGCATGGG - Intergenic
1025941532 7:66079065-66079087 CAAAAAAATTAGCCAGGCATGGG - Intronic
1026235889 7:68527155-68527177 TACAAAAATTAGCAGGGCAGTGG - Intergenic
1026283254 7:68940773-68940795 TACAAAAATTAGCTGGGCATGGG - Intergenic
1026491410 7:70867219-70867241 TACAAAAATTAGCCAGGCCATGG - Intergenic
1026609603 7:71845897-71845919 TACAAAAATTAGCTGGGCATGGG + Intronic
1026839175 7:73659463-73659485 TACAAAAATTAGCTGGGCATTGG - Intergenic
1026996504 7:74620214-74620236 CAAAAAAATTAGCCAGGCATGGG + Intergenic
1027049243 7:75011272-75011294 TACAAAAATTACCCGGGCATGGG + Intronic
1027227020 7:76250197-76250219 AACAAAAATTAGCTGGGCCATGG - Intronic
1027372593 7:77521899-77521921 TACAAAAATTAGCTGGGCATGGG + Intergenic
1027465907 7:78514619-78514641 CACAAAAATAAGCAGGGCATTGG + Intronic
1027557115 7:79678983-79679005 TACAAAACTTAGCTGGGCATGGG - Intergenic
1027600814 7:80238159-80238181 AACAAAAATTAGCCGGGCACTGG + Intergenic
1028016086 7:85714773-85714795 TACAAAAATTAGCCGGGTACAGG - Intergenic
1028539538 7:91926825-91926847 TACAAAAATTAGCCGGGCTGTGG + Intergenic
1028543465 7:91971721-91971743 CAAAAAAATTAGCCCGGCAGTGG - Intronic
1028769281 7:94597850-94597872 TACAAAAATTAGCTGGGCATGGG + Intronic
1029117274 7:98243748-98243770 TACAAAAATTAGCCGGGCAGGGG - Intronic
1029136035 7:98372249-98372271 TACAAAAATTAGCTGGGCATGGG + Intronic
1029178035 7:98678916-98678938 CTCAAAACTTAGACTGGGAATGG + Intergenic
1029369148 7:100136759-100136781 TACAAAAATTAGCTGGGCATGGG + Intergenic
1029566197 7:101339831-101339853 TACAAAAATTAGCCGGGCATTGG - Intergenic
1029644444 7:101844768-101844790 TACAAAAATTAGCCGGGCATGGG - Intronic
1029912273 7:104165909-104165931 CATAAAACTTAGCCAGGCGTGGG + Intronic
1030025663 7:105322260-105322282 TCCAAAAATTAGCCGGGCATAGG + Intronic
1030027024 7:105334376-105334398 TACAAAAATTAGCCAGGCATTGG - Intronic
1030052064 7:105546719-105546741 CAAAAAATTTAGCCAGGCATGGG + Intronic
1030185201 7:106754872-106754894 TACAAAAATTAGCCGGGGCATGG + Intergenic
1030196130 7:106855517-106855539 TACAAAAATTAGCCGGGCATGGG + Intergenic
1030263006 7:107585834-107585856 TACAAAAATTAGCCGGGCATGGG + Intronic
1030271208 7:107670261-107670283 TACAAAAATTAGCCAGGCATGGG - Intronic
1030514835 7:110526453-110526475 CAAAAACATTAGCCGGGCATAGG + Intergenic
1030818885 7:114072652-114072674 TTTAAAAATTAGCCGGGCAATGG - Intronic
1030822498 7:114112451-114112473 CACAAAAATTAGCCAGGCATTGG - Intronic
1030925465 7:115448219-115448241 TACAAAAATTAGCTGGGCATGGG - Intergenic
1031153057 7:118076495-118076517 TACAAAAATTAGCCGGGTGATGG + Intergenic
1031277749 7:119752027-119752049 CACAAAAATTAGCTGGGCATGGG + Intergenic
1031377634 7:121047857-121047879 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1031975170 7:128089206-128089228 CACAAAAATTAGCTGGGCATGGG - Intronic
1032166525 7:129549496-129549518 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1032168478 7:129564502-129564524 CACAAAAATTGGCTGGGCATCGG + Intergenic
1032293672 7:130614765-130614787 TACAAAAATTAGCTGGGCATCGG + Intronic
1032297305 7:130651470-130651492 CAAAAAAATTAGCCAGGCATTGG - Intronic
1032316441 7:130842846-130842868 TACAAAATTTAGCCGGGCGTGGG - Intergenic
1032320278 7:130880129-130880151 CAAAAAAATTAGCCGGGTATGGG + Intergenic
1032688297 7:134257649-134257671 TACAAAAATTAGCCAGGCAATGG + Intronic
1032717976 7:134527227-134527249 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1032873537 7:136012072-136012094 TACAAAAATTAGCAGGGCATGGG - Intergenic
1032890795 7:136192715-136192737 CACGAAACTTAGTCAGGCATGGG - Intergenic
1033277241 7:139981268-139981290 TACAAAAATTAGCCGGGCATGGG - Intronic
1033460936 7:141546953-141546975 TACAAAAATTAGCTGGGCACAGG - Intergenic
1033561605 7:142537198-142537220 AAAAAAAATTAGCCAGGCAAGGG - Intergenic
1033910502 7:146258044-146258066 TACAAAAATTAGTCAGGCAATGG - Intronic
1033925904 7:146459813-146459835 TACAAAAATTAGCCTGGCATGGG + Intronic
1033993610 7:147318285-147318307 TACAAAAATTAGCTGGGCATGGG + Intronic
1034162526 7:149003805-149003827 CACAAAACTGAGCAGGACCAAGG - Exonic
1034183002 7:149153011-149153033 TACAAAAATTAGCCGGGTGATGG - Intronic
1034209596 7:149351592-149351614 TACAAAAATTAGCCAGGCATGGG + Intergenic
1034244339 7:149633348-149633370 CAGAAGCCTTAGCTGGGCAAAGG - Intergenic
1034287424 7:149896904-149896926 TACAAAAATTAGCCAGGCATGGG + Intergenic
1034523635 7:151640154-151640176 AACAAAAATTAGCCGGGTATGGG + Intronic
1034612129 7:152380411-152380433 CACAAAAATTAGCTGAGCATGGG + Intronic
1034631053 7:152530761-152530783 TACAAAAGTTAGCCGGGCATGGG + Intergenic
1034663701 7:152795996-152796018 TACAAAAATTAGCCAGGCATGGG - Intronic
1034834592 7:154339916-154339938 TACAAAAATTAGCTGGGCATGGG + Intronic
1035504413 8:115842-115864 TACAAAAATTAGCTGGGCATGGG + Intergenic
1035674385 8:1444924-1444946 TACAAAAATTAGCTGGGCATGGG - Intergenic
1035842481 8:2827464-2827486 TACAAAAATTAGCTGGGCATAGG + Intergenic
1035979219 8:4350605-4350627 AACAAAACTGACCTGGGCAATGG + Intronic
1036383532 8:8257106-8257128 TACAAAAATTAGCTGGGCATGGG + Intergenic
1036552558 8:9828143-9828165 AAAAAAACGTAGCCGGGCCATGG - Intergenic
1037068674 8:14616126-14616148 TACAAAATTTAGCCGGGCGTGGG + Intronic
1037381304 8:18287967-18287989 TACAAAAATTAGCTGGGCATGGG + Intergenic
1037431236 8:18815461-18815483 CAAAAAAATTAGCCAGGCATGGG - Intronic
1037476229 8:19260441-19260463 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1037639979 8:20733622-20733644 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1037846304 8:22285794-22285816 TACAAAAATTAGCCAGGCATGGG - Intronic
1038015810 8:23513783-23513805 TACAAAAATTAGCCGGGCCTGGG - Intergenic
1038120995 8:24615072-24615094 AAAAAAAATTAGCCGGGCATGGG + Intergenic
1038138610 8:24818279-24818301 CACAGGACTTAGCCTGGCAAAGG + Intergenic
1038366992 8:26946560-26946582 TACAAAAATTAGCTGGGCATGGG - Intergenic
1038557575 8:28536551-28536573 TACAAAAATTAGCCGGGCTGTGG + Intronic
1038886565 8:31669219-31669241 TACAAAAATTAGCTGGGCATTGG - Intronic
1038957875 8:32486777-32486799 TACAAAAATTAGCCAGGCATGGG - Intronic
1039221277 8:35333632-35333654 TACAAAAATTAGCCGGGCGTGGG - Intronic
1039299511 8:36194370-36194392 TACAAAACTTAGTCGGGCATGGG + Intergenic
1039412415 8:37365894-37365916 TACAAAAATTGGCCGGGCCATGG + Intergenic
1039516383 8:38137244-38137266 TACAAAAATTAGCCGGGCATCGG + Intronic
1039572286 8:38596999-38597021 TACAAAAATTAGCCAGGCAGTGG - Intergenic
1039978760 8:42389097-42389119 TACAAAAATTAGCCAGGCATGGG - Intergenic
1040498239 8:47985343-47985365 TACAAAAATTAGCCGGGCATGGG - Intergenic
1040663155 8:49598511-49598533 CACAGATATTAGCCGGGCTAGGG - Intergenic
1041262097 8:56030204-56030226 TACAAAAATTAGCTGGGCATGGG + Intergenic
1041520911 8:58755450-58755472 TACAAAAATTAGCTGGGCATGGG - Intergenic
1041695061 8:60727280-60727302 TACAAAAATTAGCCGGGCAGGGG - Intronic
1041828966 8:62130840-62130862 AAAAAAACTTAGCCAGGCATGGG + Intergenic
1041925177 8:63228890-63228912 CAAAAAAATTAGCCAGGCATGGG - Intergenic
1042122712 8:65506265-65506287 TACAAAAATTAGCCGGGCATGGG - Intergenic
1042246713 8:66715410-66715432 CACAAAAATTAGCCAGGTATGGG - Intronic
1042268291 8:66930850-66930872 TACAAAAATTAGCCAGGCAGTGG - Intergenic
1042311092 8:67380035-67380057 CACAAAAATCAGCCAGGCATTGG - Intergenic
1042313105 8:67398235-67398257 TACAAAAATTAGCTGGGCATGGG - Intergenic
1042805656 8:72768327-72768349 TACAAAAATTAGCTGGGCAATGG - Intronic
1042848628 8:73193057-73193079 TACAAAAATTAGCTGGGCATGGG + Intergenic
1043022557 8:75022432-75022454 AACAAAAATTAGCCGGGCGTGGG + Intronic
1043050050 8:75375542-75375564 AATAAAAATTAGCCGGGCATGGG + Intergenic
1043457398 8:80426161-80426183 CACAAAAATTAGCCAGTCCATGG + Intergenic
1043531875 8:81160268-81160290 TACAAAAATTAGCCGGGCATGGG - Intergenic
1043580589 8:81708092-81708114 TACAAAAATTAGCCGGGCCATGG + Intronic
1043635942 8:82381940-82381962 CAGAAAACATTGCCTGGCAAAGG - Intergenic
1043688586 8:83120660-83120682 CACAAAAGTTAGCCAGGCGTGGG + Intergenic
1043854839 8:85253417-85253439 TACAAAAATTAGCTGGGCATGGG - Intronic
1044195135 8:89367147-89367169 CAAAAAAATTAGCCAGGCATGGG + Intergenic
1044238121 8:89855405-89855427 TACAAAAATTAGCCGGGCATGGG + Intergenic
1044257663 8:90084232-90084254 TACAAAAATTAGCTGGGCATGGG + Intronic
1044653535 8:94523946-94523968 CACAAAAACTAGCCGGGCTTTGG - Intronic
1044665023 8:94625702-94625724 CACAAAAATTAGCTGGGCATTGG + Intergenic
1044686591 8:94831634-94831656 TACAAAAATTAGCCGGGCATGGG - Intronic
1044703222 8:94983418-94983440 TACAAAAATTAGCCAGGCAGTGG - Intronic
1044994222 8:97823527-97823549 TACAAAAATTAGCCGGGCATTGG - Intronic
1045123011 8:99059290-99059312 TACAAAAATTAGCCGGGCATTGG - Intronic
1045504045 8:102766125-102766147 TACAAAAATTAGCCAGGCATGGG - Intergenic
1046356008 8:113086091-113086113 CACAAAAATTAGCCAGGCGTGGG + Intronic
1046485008 8:114875800-114875822 TACAAAAATTAGCCGGGCATTGG - Intergenic
1046756628 8:117979196-117979218 CACAAAAATTGGCCGGGCACTGG + Intronic
1046919180 8:119709594-119709616 TACAAAAATTAGCCGGGCATGGG - Intergenic
1047094553 8:121609987-121610009 TGCAAAAATTAGCCGGGCATGGG - Intergenic
1047230063 8:122989446-122989468 TACAAAAATTAGCCAGGCATGGG + Intergenic
1047296343 8:123573670-123573692 TACAAAAATTAGCCAGGCATGGG - Intergenic
1047376811 8:124306792-124306814 TACAAAAATTAGCTGGGCATGGG + Intergenic
1047412972 8:124639180-124639202 TACAAAAATTAGCCGGGCTTTGG + Intronic
1047413145 8:124640696-124640718 TACAAAAATTAGCCGGGCATGGG - Intronic
1047432450 8:124804710-124804732 TACAAAAATTATCCGGGCATGGG + Intergenic
1047484031 8:125312467-125312489 TACAAAAATTAGCCGGGCGTGGG + Intronic
1047492189 8:125384187-125384209 TACAAAAATTGGCCGGGCATGGG + Intergenic
1047529656 8:125663503-125663525 AACAAAAATTAGCCTGGCATGGG + Intergenic
1047616636 8:126568050-126568072 TACAAAAATTAGCTGGGCATGGG - Intergenic
1047725711 8:127682457-127682479 CACAAAAATTAGCCAGGCATAGG - Intergenic
1047792486 8:128218358-128218380 TACAAAAATTAGCTGGGCATGGG - Intergenic
1047905494 8:129468497-129468519 CACAAAAATTAGCCAGGTAGTGG - Intergenic
1048094046 8:131272065-131272087 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1048286205 8:133143524-133143546 TACAAAAATTAGCCAGGCATGGG + Intergenic
1048352552 8:133627775-133627797 TACAAAAATTAGCCAGGCATGGG - Intergenic
1048663653 8:136635553-136635575 TACAAAAATTAGCTGGGCATGGG - Intergenic
1048674806 8:136766841-136766863 TACAAAAATTAGCCAGGCATTGG - Intergenic
1049114021 8:140670299-140670321 TACAAAAATTAGCAGGGTAATGG + Intronic
1049169414 8:141149710-141149732 GAGAAAACCTAGCCGGGCACGGG + Intronic
1049313473 8:141946450-141946472 TACAAAAATTAGCTGGGCATGGG + Intergenic
1049830372 8:144697642-144697664 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1049834583 8:144726568-144726590 TAGAAAACTTAGCCAGGCATAGG + Intronic
1049926393 9:412247-412269 TACAAAAATTAGCTGGGCATTGG + Intronic
1049972205 9:831185-831207 TACAAAAATTAGCTGGGCAGTGG + Intergenic
1050207620 9:3213693-3213715 TACAAAAATTAGCTGGGCATGGG + Intergenic
1050464884 9:5911687-5911709 TACAAAAATTAGCTGGGCATGGG - Intronic
1050767270 9:9150631-9150653 TACAAAAATTAGCTGGGCATGGG - Intronic
1050966428 9:11809825-11809847 TACAAAAGTTAGCCGGGCTTGGG - Intergenic
1051274810 9:15388484-15388506 AAAAAAAATTAGCCAGGCAATGG + Intergenic
1051304299 9:15692219-15692241 CACAAAAATTAGCTGGGCATGGG + Intronic
1051623744 9:19078631-19078653 TACAAAAATTAGCCGGGCGTAGG + Intronic
1051627691 9:19113927-19113949 TACAAAAATTAGCTGGGCATGGG - Intronic
1051791901 9:20814509-20814531 CACAGAAATTAGCTGGGCATTGG - Intronic
1052147369 9:25066568-25066590 TACAAAAATTAGCTGGGCATGGG - Intergenic
1052164559 9:25309124-25309146 CAAAAAAATTAGCCGGGCTATGG - Intergenic
1052410850 9:28119280-28119302 TACAAAAATTAGCTGGGCATGGG - Intronic
1052713347 9:32085103-32085125 TACAAAAGTTAGCCGGGCATTGG - Intergenic
1052729593 9:32269545-32269567 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1052815026 9:33095944-33095966 TACAAAAATTAGCCAGGCAATGG - Intergenic
1052873973 9:33538579-33538601 TACAAAAATTAGCCAGGCATGGG + Intronic
1053049731 9:34950191-34950213 TACAAAAATTAGCTGGGCATGGG + Intergenic
1053119592 9:35536656-35536678 TAAAAAACTTAGCCGGGGCATGG + Intronic
1053245677 9:36532857-36532879 TACAAAAATTAGCCGAGCATGGG - Intergenic
1053260933 9:36663233-36663255 TACAAAAATTAGCTGGGCATGGG - Intronic
1053316888 9:37059534-37059556 CACAAACATTAGCTGGGCATGGG - Intergenic
1053348686 9:37396904-37396926 CAAAAAAATTAGCTGGGCATCGG + Intergenic
1053502073 9:38605766-38605788 TACAAAAATTAGCCAGGCATGGG - Intergenic
1055270172 9:74549287-74549309 TACAAAAATTAGCTGGGCATGGG + Intronic
1055323018 9:75100573-75100595 TACAAAAATTAGCCGGGCCGTGG + Intronic
1055584424 9:77743101-77743123 TACAAAAATTAGCCGGGCGTAGG + Intronic
1055774501 9:79752876-79752898 TACAAAAATTAGCTGGGCACGGG + Intergenic
1056563300 9:87751631-87751653 GACAATAATTAGCCTGGCAATGG + Intergenic
1056867822 9:90245411-90245433 CACAAAACTTAGAGAGACAAGGG - Intergenic
1056995529 9:91454076-91454098 TACAAAAATTAGCTGGGCATGGG + Intergenic
1057371167 9:94474513-94474535 TACAAAAATTAGTCGGGCAGTGG - Intergenic
1057427027 9:94960253-94960275 TACAAAAATTAGCCAGGCATTGG + Intronic
1057432915 9:95011355-95011377 AAAAAAAATTAGCCGGGCATGGG - Intronic
1057626436 9:96681773-96681795 TACAAAAATTAGCCAGGCAGGGG + Intergenic
1057681448 9:97190076-97190098 TACAAAAATTAGCCAGGCATGGG - Intergenic
1058022293 9:100102251-100102273 CACAAAAATTAGCTGGGCTGTGG - Intronic
1058050372 9:100400587-100400609 TACAAAAATTAGCTGGGCATTGG - Intergenic
1058242112 9:102577062-102577084 TACAAAAATTAGCCGGGCAGTGG + Intergenic
1058678469 9:107421572-107421594 CACAGGACTCAGCCAGGCAAGGG + Intergenic
1058691972 9:107527763-107527785 TACAAAAATTAGCTGGGCATGGG - Intergenic
1058733955 9:107877148-107877170 TACAAAAATTAGCCAGGCAGTGG + Intergenic
1059139007 9:111834515-111834537 TACAAAAATTAGCTGGGCATGGG - Intergenic
1059413088 9:114146005-114146027 TACAAAAGTTAGCCAGGCAATGG - Intergenic
1059781301 9:117530871-117530893 AAAAAAACTTAGCCAGGCATGGG + Intergenic
1059878587 9:118664289-118664311 TACAAAAATTAGCCGGGCAGTGG - Intergenic
1060095412 9:120784763-120784785 TACAAAAATTAGCCGGGCTGTGG + Intronic
1060249897 9:121977827-121977849 TACAAAAATTAGCTGGGCATGGG - Intronic
1060386553 9:123234803-123234825 TACAAAAATTAGCCAGGCATGGG + Intronic
1060427255 9:123516729-123516751 TACAAAAATTAGCTGGGCAGTGG + Intronic
1060485408 9:124043369-124043391 TACAAAAATTAGCCGGGCGTGGG - Intergenic
1060569668 9:124626777-124626799 TACAAAAATTAGCCGGGCGTAGG + Intronic
1060630846 9:125157138-125157160 TACAAAAATTAGCCGGGCACTGG - Intronic
1060853099 9:126893854-126893876 TACAAAAATTAGCTGGGCATTGG - Intergenic
1060906382 9:127310617-127310639 TACAAAAATTAGCCGGGCAAGGG + Intronic
1060943106 9:127554713-127554735 TACAAAAATTAGCCGGGCATGGG - Intronic
1061029547 9:128071865-128071887 TACAAAAATTAGCCGGGCCATGG - Intronic
1061120332 9:128638080-128638102 TACAAAAATTAGCTGGGCATGGG + Intronic
1061124567 9:128666219-128666241 TACAAAAGTTAGCCGGGCGTGGG + Intergenic
1061174855 9:128988878-128988900 AACAAAAATTAGCCGGGCGTGGG - Intronic
1061316266 9:129797996-129798018 TACAAAAATTAGCCAGGCATAGG - Intergenic
1061354908 9:130097307-130097329 TACAAAAATTAGCCCGGCATGGG - Intronic
1061359616 9:130132630-130132652 TACAAAAGTTAGCTGGGCATGGG + Intronic
1061519330 9:131108352-131108374 TCCAAAAATTAGCCGGGCATGGG - Intronic
1061584542 9:131557382-131557404 TACAAAAATTAGCCGGGCATGGG + Intergenic
1062155857 9:135048100-135048122 TACAAAATTTAGCCAGGCAGTGG - Intergenic
1062659752 9:137623573-137623595 TACAAAAATTAGCCAGGCACAGG - Intronic
1062678293 9:137761605-137761627 TACAAAAATTAGCTGGGCATGGG - Intronic
1203541911 Un_KI270743v1:96920-96942 TACAATAATTAGCCGGGCATGGG - Intergenic
1203603898 Un_KI270748v1:41541-41563 TACAAAAATTAGCTGGGCATGGG - Intergenic
1185536261 X:863711-863733 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1185580381 X:1207408-1207430 CAAAAAAATTAGCCGGGCGCGGG - Intronic
1185629358 X:1504830-1504852 TACAAAAATTAGCCGGGCATTGG + Intronic
1185640057 X:1585085-1585107 TACAAAAATTAGCCAGGCATGGG + Intergenic
1185710857 X:2302455-2302477 TACAAAAACTAGCCGGGCATGGG + Intronic
1185726074 X:2422955-2422977 CACAAAAATTAGCTGGGCTTGGG - Intronic
1185779582 X:2832687-2832709 TACAAAAGTGAGCCGGGCATGGG - Intronic
1185807894 X:3077482-3077504 TACAAAAATTAGCCGGACATGGG + Intronic
1186175226 X:6919732-6919754 TACAAAAGTTAGCCGGGCGTGGG + Intergenic
1186332331 X:8547869-8547891 TACAAAAATTAGCCGGGCATGGG - Intronic
1186418075 X:9400692-9400714 TACAAAAATTAGCTGGGCATGGG + Intergenic
1186731831 X:12418512-12418534 TACAAAAATTAGCCAGGCATTGG - Intronic
1187167311 X:16816148-16816170 TACAAAAATTAGCTGGGCAGAGG - Intronic
1187342979 X:18438218-18438240 TACAAAACTTAGCCGGGCGTGGG - Intronic
1187350730 X:18514550-18514572 TACAAAAATTAGCCGGGCGTGGG + Intronic
1187680306 X:21760721-21760743 TACAAAAATTAGCTGGGCATGGG + Intergenic
1187897706 X:23998115-23998137 TACAAAAATTAGCCAGGCCATGG - Intronic
1187918597 X:24178732-24178754 CACAAAAATTAGCCGGGCATGGG - Intronic
1187957923 X:24538622-24538644 TACAAAAATTAGCCGGGCGGTGG + Intronic
1188330509 X:28865281-28865303 TACAAAAATTAGCCGGGCTGTGG + Intronic
1188802459 X:34549055-34549077 TACAAAAATTAGCCAGGCATGGG - Intergenic
1189000398 X:36937972-36937994 TACAAAAATTAGCTGGGCATGGG + Intergenic
1189462936 X:41257045-41257067 TACGAAAATTAGCCGGGCATAGG - Intergenic
1189841346 X:45081931-45081953 CAAAAAAATTAGCCGGGCATGGG - Intronic
1190030989 X:46972752-46972774 TACAAAAATTAGCCAGGCATGGG - Intronic
1190190254 X:48271102-48271124 AAAAAAAATTAGCCGGGCATTGG + Intronic
1190213305 X:48464639-48464661 TACAAAAATTAGCCGAGCATGGG + Intronic
1190226305 X:48548268-48548290 TACAAAAATTAGCTGGGCATGGG - Intronic
1190297478 X:49036645-49036667 TACAAAAATTAGCCGGGCATGGG + Intronic
1190315936 X:49151032-49151054 TACAAAAATTAGCCGGGCGGTGG - Intergenic
1190656067 X:52613179-52613201 TACAAAAATTAGCCGGGCATAGG - Intergenic
1190658987 X:52637592-52637614 AAGAAAAATTAGCCGGGCATTGG + Intergenic
1190721774 X:53154658-53154680 TACAAAAATTATCTGGGCAATGG + Intergenic
1190834118 X:54084672-54084694 TACAAAAATTAGCCGGGCTGTGG + Intronic
1190882075 X:54498636-54498658 TACAAAAATTAGCCGGGCATGGG + Intergenic
1192093061 X:68181671-68181693 AAAAAAAATTAGCCGGGCATGGG + Intronic
1192476010 X:71443861-71443883 CAAAAAAATTAGCCGGGCATTGG - Intronic
1192581588 X:72287244-72287266 TACAAAAATTAGCCAGGCATGGG - Intronic
1193572636 X:83162373-83162395 TACAAAAATTAGCCAGGCATGGG - Intergenic
1194698519 X:97085569-97085591 TACAAAAATTAGCCGGGCGGTGG - Intronic
1195090964 X:101458639-101458661 CACAAAAATTAGCCGAGCGTGGG - Intronic
1195329412 X:103785229-103785251 TACAAAAATTAGCCGGGCATGGG - Intronic
1195642063 X:107186741-107186763 TACAAAAGTTAGCTGGGCATGGG + Intronic
1195695036 X:107660660-107660682 TACAAAAATTAGCTGGGCATGGG + Intergenic
1195777587 X:108424855-108424877 TACAAAAATTAGCTGGGCATGGG + Intronic
1195895089 X:109737913-109737935 TACAAAAGTTAGCTGGGCATGGG - Intergenic
1196079500 X:111616223-111616245 TACAAAAATTAGCCGGGCACAGG - Intergenic
1196346741 X:114670081-114670103 TACAGAAATTAGCTGGGCAAGGG + Intronic
1196685262 X:118505177-118505199 CACAAAACTTAGCCGGGCAATGG - Intronic
1196799358 X:119528815-119528837 TACAAAAATTAGCCGGGCATTGG + Intergenic
1196860299 X:120020856-120020878 TACAAAAATTAGCCAGGCATGGG - Intergenic
1196991335 X:121331952-121331974 TACAAAAATTAGCTGGGCATGGG + Intergenic
1197676125 X:129332554-129332576 CACAAAAATTAGCCGGGTAGTGG - Intergenic
1198321006 X:135519267-135519289 TACAAAAATTAGCCGGGCATGGG - Intergenic
1198399355 X:136254237-136254259 TACAAAAATTAGCCGGGCGTGGG - Intronic
1198465807 X:136903804-136903826 CGCAAAAATTAGCTGGGCATGGG - Intergenic
1198470827 X:136945322-136945344 TACAAAAATTAGCCAGGCATGGG - Intergenic
1199084010 X:143608403-143608425 TACAAAAATTAGCTGGGCATGGG + Intergenic
1200240642 X:154491297-154491319 TACAAAAATTAGCCGGGCGCGGG - Intergenic
1200769823 Y:7113295-7113317 CACAAAAATTAGCCGGGTGCCGG + Intergenic
1201164123 Y:11192094-11192116 TACAAAAATTAGCCGGGCGTGGG + Intergenic
1201258379 Y:12133068-12133090 TACAAAAATTAGCTGGGCATAGG - Intergenic
1202012569 Y:20360899-20360921 TACAAAAGTTAGCTGGGCCATGG + Intergenic