ID: 1196685862

View in Genome Browser
Species Human (GRCh38)
Location X:118509798-118509820
Sequence CACTTCCTCCAGAAGCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196685856_1196685862 23 Left 1196685856 X:118509752-118509774 CCAAAATTGGTTTCACTGAGCTA 0: 1
1: 2
2: 31
3: 123
4: 445
Right 1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG 0: 1
1: 0
2: 4
3: 42
4: 317
1196685858_1196685862 -3 Left 1196685858 X:118509778-118509800 CCAAGGTGTCCAAAAAGCCTCAC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG 0: 1
1: 0
2: 4
3: 42
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196685862 Original CRISPR CACTTCCTCCAGAAGCTGTA GGG Intronic
902347040 1:15825864-15825886 CAATTCCTCCAGAAGCCCTAAGG + Intergenic
902677832 1:18021113-18021135 CACTTCCCCCAGAAACTCGATGG - Intergenic
903603117 1:24556316-24556338 CACTTCCTCCAACAGATGTGGGG - Intronic
904104776 1:28069995-28070017 AACTTGCTCCAGAGGCTTTAGGG - Intronic
904205627 1:28853241-28853263 CACTTCCACCTGAAGCTGACTGG - Intronic
905933633 1:41806925-41806947 CCCATCCTCCTGAAGGTGTAGGG - Intronic
909477959 1:76103661-76103683 CACTCCCTCCAAAGGCTCTAGGG + Intronic
910828067 1:91430148-91430170 CACTGCCTCCAGAAGCTATAAGG - Intergenic
911543719 1:99190120-99190142 CACTCCCACCAGAAGCCCTATGG - Intergenic
912201310 1:107461353-107461375 CAATTCCTGCAAAAGCTGAAAGG + Intronic
912624471 1:111196042-111196064 CACTTCATCCAGGATCTGCAGGG + Exonic
913339869 1:117747733-117747755 CACTTCCTTCAGAGGGTGTGTGG + Intergenic
914254936 1:145954199-145954221 TGCTCCCTCCAGAAGCTCTAGGG - Intronic
915254405 1:154615096-154615118 TGCTCCCTCCAGAGGCTGTAGGG - Intronic
915874727 1:159600543-159600565 GGCTTCCTACAGAAGCTGTTGGG + Intergenic
916231090 1:162541997-162542019 CTCTTCCTCCAGGAGCTGACAGG - Intergenic
916263594 1:162868494-162868516 CACTTCCTCCAGAGGGTCTGTGG - Intronic
916358190 1:163936740-163936762 CGCTGCCTACAGAAGCTCTAGGG + Intergenic
916979372 1:170116619-170116641 CAGTTCCTCCACAATCTGAATGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918007341 1:180554272-180554294 CTCTCCCTCCAAATGCTGTAGGG - Intergenic
918009045 1:180569470-180569492 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
919032809 1:192266676-192266698 CACTTCCACCAGAAACTTTTGGG - Intergenic
920760292 1:208777253-208777275 CTCTTCCTCCAGAGGTTCTAGGG - Intergenic
921354945 1:214277104-214277126 CACTCCCTCCCGAGGCTCTAGGG + Intergenic
921634525 1:217476971-217476993 CATCTCCTCCAGAAGATGAAAGG - Intronic
921845585 1:219876225-219876247 CACTTCCTCCAGAATGGGCAAGG + Intronic
923312393 1:232747602-232747624 CGCTCCCTCCAGAGGCTCTAGGG + Intergenic
924045989 1:240031116-240031138 CACTGCCTCCAAAAGCAGAAGGG - Intronic
924432164 1:244006352-244006374 CACATCCTCCAGAATCTTTCTGG - Intergenic
1063868960 10:10397712-10397734 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1064549731 10:16487289-16487311 CGCTTCCTCCAAAGGCTGCAGGG + Intronic
1065004031 10:21363098-21363120 CACTCCCTTCAGAGGCTCTAGGG - Intergenic
1065634396 10:27715814-27715836 CACTTACTCCAGAAGATCGAAGG + Intronic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1067099672 10:43325512-43325534 CACTTCCTCCAGAGCCTCTAGGG + Intergenic
1067730940 10:48811073-48811095 CACTTCCTCCAGGAGATGAGGGG + Intronic
1067808621 10:49410128-49410150 CACTTCCTCCTGGGGCTGTCTGG - Intergenic
1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG + Intergenic
1069557471 10:69407546-69407568 CACTTCCTACAAAAGGTGTCTGG + Intronic
1069581499 10:69569851-69569873 AACTACCCCCAGAAGCTGGAGGG - Intergenic
1069934589 10:71906405-71906427 TGCTTCCAGCAGAAGCTGTAAGG + Intergenic
1070406955 10:76105660-76105682 CACTCCCTCCAAAGGCTCTAGGG - Intronic
1070516460 10:77212718-77212740 CTCTTCCTCATTAAGCTGTATGG + Intronic
1071404598 10:85317984-85318006 CACTCTCTCCAGAGGCTCTAGGG + Intergenic
1072088330 10:92102168-92102190 CACTACCCCCAGAAGATGCAGGG - Intronic
1072889501 10:99309992-99310014 CACTCCCTCCAAAAGCCCTAGGG + Intergenic
1073052764 10:100679535-100679557 CACTTCTTACACATGCTGTAAGG + Intergenic
1074311070 10:112323815-112323837 TGCTCCCTCCAGAAGCTCTAGGG - Intergenic
1074851508 10:117443008-117443030 CACTTCCTCCAGCAGCTGGGGGG - Intergenic
1075245484 10:120818505-120818527 CGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1075463827 10:122636642-122636664 CACTTCCAGCAGAGCCTGTATGG + Intronic
1076651688 10:131994015-131994037 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1076706318 10:132303813-132303835 CACTTGCTCCAGGAGCGGGAGGG - Intronic
1077552903 11:3209652-3209674 CACTCCCTCTGGAAGCTCTAGGG + Intergenic
1078107543 11:8368163-8368185 CACTTCCTCCATCAGCTATGGGG + Intergenic
1078587577 11:12606809-12606831 AACAGCCTCCAGAAGCTGGAAGG - Intergenic
1079732006 11:23945056-23945078 CATTTCCTCCAAAGGCTCTAGGG + Intergenic
1080185671 11:29482582-29482604 CACTTCCTCCTGAGGATATACGG + Intergenic
1080685715 11:34513352-34513374 CCCTTCCTAAAGAAGCTTTAGGG + Intronic
1082665121 11:55966575-55966597 CACTTCCTTCAAAGGCTTTAAGG + Intergenic
1084052621 11:66610284-66610306 TGCTTCCTCCAGAAACTATAGGG + Intergenic
1087815659 11:102655630-102655652 TACTCCCTCTAGAAGCTCTAGGG + Intergenic
1087910953 11:103752836-103752858 CACTTACTGCAGAGGCTCTATGG - Intergenic
1088536123 11:110863635-110863657 CACTACCTCCATAGGCTCTAGGG + Intergenic
1088712627 11:112522226-112522248 TGCTTTCTCCAGAAGCTCTAGGG - Intergenic
1089220342 11:116865746-116865768 CATTTCCTCCAGAAAATGAAAGG + Intronic
1089284086 11:117394587-117394609 CTCTCACTCCAGAAGCTGTCAGG - Intronic
1092129306 12:6097610-6097632 AACTCCCTCCAGAAGCTCTCGGG - Intronic
1093064213 12:14639703-14639725 CACTTCCTCCAGAAGAGCTAAGG - Intronic
1093533387 12:20194353-20194375 TGCTCCCTCCAGAGGCTGTAGGG + Intergenic
1095729673 12:45492989-45493011 CACTTTCTCCAGAGGCTCTAGGG + Intergenic
1096399283 12:51291776-51291798 AACCCCCTCCAGAGGCTGTAGGG + Exonic
1099064256 12:77953996-77954018 TACGTCTTCCAGAGGCTGTAGGG + Intronic
1100484770 12:95014736-95014758 CACTTCCTCCAGCAGCCACATGG + Intergenic
1100930123 12:99598933-99598955 CGCTCCCTCCAGAGGCTCTAGGG + Intronic
1103067695 12:117913692-117913714 TGCTTCCTCCGAAAGCTGTAGGG - Intronic
1103730761 12:123026365-123026387 CACTTCCTCCAAAGGTTCTACGG - Intronic
1103943245 12:124512281-124512303 TACTCCCTCCAGAAGCTCAAAGG + Intronic
1104177702 12:126348997-126349019 CAGTTCCTCCAAATGATGTATGG - Intergenic
1106350955 13:28930335-28930357 CACCTTCCCCAGAAGCTGCATGG + Intronic
1107022212 13:35763982-35764004 GACTTCCTCCAGATGGTGTCTGG + Intergenic
1107756135 13:43623609-43623631 CACTTCCTTCAGAGGGTGTGTGG + Intronic
1108364470 13:49696075-49696097 GAATTCCTCAAGAAGGTGTATGG + Intergenic
1110068098 13:71134558-71134580 CGCTTCCTCCAAAACATGTAGGG + Intergenic
1110998482 13:82144783-82144805 CACTTCCTGAAGCAGATGTAAGG - Intergenic
1111685063 13:91491643-91491665 CCCTTGCTCCTGAAGCTCTAGGG + Intronic
1112207203 13:97336645-97336667 CCCTCCCTCCAGAGGCTCTAGGG - Intronic
1112569452 13:100580473-100580495 CCCTCCCTCCAAAGGCTGTATGG - Intronic
1112801219 13:103111575-103111597 CAATTCATCCAGAACCTGGAAGG - Intergenic
1113084193 13:106550713-106550735 CACTTCCTCCAGAGGTTCTATGG + Intronic
1114155108 14:20093615-20093637 CACTTCCTCATGGGGCTGTATGG + Intergenic
1114329132 14:21618272-21618294 CACTTCCTCCAAAAGGTCTGTGG + Intergenic
1114737124 14:25053242-25053264 CACTTCCTTCAACAGCCGTAGGG - Intergenic
1116716089 14:48429233-48429255 CTCCTCCTGCAGAAGCCGTAGGG - Intergenic
1119678651 14:76575427-76575449 CACTCCCTCCAGAAGCTCTAGGG + Intergenic
1121560046 14:94867911-94867933 CATTTCCTCAAAAATCTGTATGG + Intergenic
1122903589 14:104792045-104792067 CACCTCCTCCATAGGCTGCAAGG + Intronic
1123479109 15:20614779-20614801 CACTCCCTTCAGAATCTGCAGGG + Intergenic
1123638904 15:22385606-22385628 CACTCCCTTCAGAATCTGCAGGG - Intergenic
1124007540 15:25806908-25806930 CCCTTTCTCCAGAAACTGAAGGG + Intronic
1126556340 15:49992144-49992166 CTCTTCCTTCAAGAGCTGTAAGG + Intronic
1126786603 15:52182129-52182151 CACCTCCTTCAGACTCTGTATGG + Intronic
1126878028 15:53065151-53065173 CGCTTCCTCCAGAGGCTCTTGGG - Intergenic
1128820315 15:70646428-70646450 CACTTCCTCTAGAGGCTCTGGGG - Intergenic
1128952412 15:71899990-71900012 TAATTCCTCCAGAATCTCTATGG + Exonic
1131191911 15:90323695-90323717 CACTGCCTCCAGTAGTTTTAGGG - Intergenic
1132590691 16:725131-725153 CACTTCCCCCTGCAGCTGTGGGG + Exonic
1133447917 16:5878000-5878022 CACTTGCTCTAGAACCAGTAAGG + Intergenic
1133549916 16:6844164-6844186 AGATTCCTCCAGAAGCTATAAGG - Intronic
1133626587 16:7575596-7575618 CACTTCCTCTAGAGGCTCTAGGG - Intronic
1133852215 16:9516183-9516205 CACTTCCTCCAGGGGCTCTAGGG - Intergenic
1134080762 16:11323467-11323489 TGCTTCCTCCAGAAGATGGAAGG - Intronic
1134215153 16:12311499-12311521 CATTTCCTCCAGGAGATGCAGGG + Intronic
1135854305 16:25992831-25992853 CACTTGCTCCAGCACTTGTATGG + Intronic
1136470869 16:30479154-30479176 CTCTTCCGCCAGAATCTGCAGGG + Exonic
1137077691 16:35994535-35994557 CACTTTTTGCAGAATCTGTATGG + Intergenic
1140070501 16:71645174-71645196 CACTTCTCCCAGATGCTATAGGG - Exonic
1140555555 16:75917001-75917023 TGCTTCCTCCAGAAGCTCCACGG + Intergenic
1141184032 16:81774425-81774447 CCCTACCTCCAGAAGCAGTGAGG + Intronic
1141311852 16:82921265-82921287 CACTCTCTCCAGAAGCTCTCGGG + Intronic
1141762172 16:86035836-86035858 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1141763678 16:86045098-86045120 CAATCCCTCCAGAGGCTCTAGGG - Intergenic
1141773892 16:86109502-86109524 TACTCCCTCCAGAGGCTGTAGGG - Intergenic
1141803043 16:86323919-86323941 CACTCGCTCCTGAACCTGTAGGG - Intergenic
1141897897 16:86970360-86970382 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1142558779 17:797503-797525 CATTTCCTCCCTAAGCTGCACGG + Intergenic
1142717328 17:1754421-1754443 GACTTCCTCCAGAGCCTGAAAGG + Exonic
1143261633 17:5603566-5603588 CACTTGGTCCAGAATTTGTAGGG + Intronic
1143613209 17:8032604-8032626 CATTTTCTCCAGAAGCTTTTAGG - Intergenic
1144583120 17:16471225-16471247 CACAACCACCAGAAGCTGGAAGG + Intronic
1144671427 17:17134702-17134724 CACGTGCTCCAGAAGCAGGAAGG - Intronic
1144752256 17:17657235-17657257 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1145452401 17:23267573-23267595 CACTTTCTGCAGAATCTGCAAGG + Intergenic
1145826386 17:27880120-27880142 TCCCTCCTCCAGAAGCTGAAAGG - Intronic
1145940679 17:28741914-28741936 CACTGCCCTCAGAAGCTGCAAGG + Intronic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1147851765 17:43449239-43449261 CACCTCCTCCAGGAGGTGGAGGG - Intergenic
1148198343 17:45730846-45730868 CACTTCCTCCAGAAGGCCCATGG + Intergenic
1148893925 17:50829014-50829036 CGCTCCCTCCAGAGGCTTTAGGG + Intergenic
1149553395 17:57556348-57556370 CCCTTCCTCCAGGATCTGCAGGG + Intronic
1149658061 17:58320525-58320547 CCCTACCTCCAGCAGCTGCACGG + Exonic
1150613009 17:66748894-66748916 CCCTTCCTCCTGAAGCTGAGAGG - Intronic
1150701424 17:67450342-67450364 CTCTTCCTCCTGAAGGTGCACGG + Intronic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1151604007 17:75124905-75124927 CCCTTCCACCAGGAGCTATAAGG - Intronic
1153692408 18:7606825-7606847 AGCTTCCTCCAGCATCTGTAAGG - Intronic
1153869370 18:9303064-9303086 CACTTCCTTCAGAAGGTCTGTGG - Intergenic
1157210523 18:45738226-45738248 CACTGCCTCCAGAAGGTCTTTGG + Intronic
1157546679 18:48551375-48551397 CACTCCCTCCACAAGCTGCAGGG - Intronic
1159786961 18:72726475-72726497 CACTTCCTTCAGAAGGTCTGTGG - Intergenic
1160906409 19:1453578-1453600 CAGTTCCTCCAGCAGCCGGATGG - Exonic
1162133210 19:8539990-8540012 CTCTTCCCCGAGAAGCTGGATGG - Exonic
1163158595 19:15452156-15452178 CACTCCCACCAGGAGCTGGAAGG - Intronic
1163682563 19:18691674-18691696 TGCTTCCTCCAGAGGCTCTAGGG - Intronic
1166303347 19:41924049-41924071 CACCTCCCCCACAAGCTGTTTGG - Intronic
1167506922 19:49875873-49875895 GACCTCCTCTAGAAGCTGAAGGG - Intronic
1167510045 19:49891048-49891070 CACGTCTCCCAGAAGCTGCACGG + Exonic
1168634129 19:57982166-57982188 TGCTCCCTCCAGAAGCTCTAAGG + Intronic
926502081 2:13668186-13668208 CACTTCCTCCAAAGGCTCTAGGG - Intergenic
928447955 2:31349770-31349792 CACTTCAACCAGAAGCTTGAGGG - Exonic
928448613 2:31356609-31356631 CACATCCTCTGGAAGCTCTAGGG - Intronic
929029547 2:37637680-37637702 TACTCCCTCCAGAGGCTCTAGGG + Intergenic
929628312 2:43433062-43433084 ATCTTCCTCTAGAAGCTTTATGG + Intronic
930417372 2:51105518-51105540 CACTTCCCCCAAAAGCTTTTAGG - Intergenic
934153606 2:89173672-89173694 CACTTCCTGGAGAATCTGTGGGG + Intergenic
934213631 2:90008260-90008282 CACTTCCTGGAGAGTCTGTAGGG - Intergenic
936405292 2:112197437-112197459 CACTTCCTCCAAAGGCTGCAGGG - Intergenic
936962983 2:118096078-118096100 CACTTCCACTAGAATCTGGAGGG - Intronic
937319633 2:120953371-120953393 CACTCCCTCCAGAGGCTCAAGGG - Intronic
937599167 2:123708485-123708507 CAATTCCTCCAGGATCAGTAAGG + Intergenic
941573655 2:167202857-167202879 AGCTTCCTCCAGAAGCTCCAGGG + Intronic
943452358 2:188059298-188059320 CACTTCCTCTAAAAGCTCCAAGG - Intergenic
943621284 2:190150587-190150609 CACTTCCTTCAGAGGGTGTGTGG + Intronic
943848595 2:192686730-192686752 CACTTTCTCCAGAGGCTTTAGGG + Intergenic
944832587 2:203547982-203548004 CATTTCTTCTAGAAGCTCTAGGG + Intergenic
945579359 2:211573261-211573283 CATTCCCTCCAGAAGCTCTAGGG - Intronic
945743351 2:213690382-213690404 CACTGCCTCCAGAGGCAGAAGGG + Intronic
948701251 2:239761850-239761872 CCCTTCCTCCAGGACCTGCAAGG - Intergenic
1168914323 20:1473952-1473974 CACTTCCTCCGGAGGCTCCAGGG + Intronic
1169898687 20:10531787-10531809 CACTTCCTCCAGACGCTAGGAGG - Intronic
1170115928 20:12859411-12859433 CAGTTCCACCATACGCTGTAGGG + Intergenic
1170210130 20:13839624-13839646 CACTCCCTTCAGAGGCTCTAAGG + Intergenic
1170367004 20:15609061-15609083 CTATTCCTCCAGAAGCAGAAAGG + Intronic
1172185326 20:33027910-33027932 CACTTCCCTCACAAGCTGTGTGG - Intergenic
1173000752 20:39103865-39103887 CACTCCCTCTGGAGGCTGTAGGG + Intergenic
1173239491 20:41281663-41281685 GACTTCCTCCAGGAACTGGAAGG + Intronic
1173561731 20:44010936-44010958 CACTTTCCCCAGAGGCTGTCGGG + Intronic
1174657808 20:52186262-52186284 CATTTCCTCCAGAACTTTTATGG + Intronic
1174871644 20:54188232-54188254 CACTAATTCCAGAAGCTGAAGGG + Intergenic
1174983748 20:55425876-55425898 CACCTCTCCCAGAAGTTGTAGGG - Intergenic
1175229319 20:57463600-57463622 CACTCCCTCCAGAGGCTATAGGG - Intergenic
1175669244 20:60887705-60887727 CACTTCCACCAGCAGCTGACAGG - Intergenic
1175848032 20:62069222-62069244 CACTCCCTCTAGAGGCTCTAGGG + Intergenic
1176524832 21:7858166-7858188 CACTGGCTCCAGAAGCTCTGAGG + Intergenic
1178658852 21:34488179-34488201 CACTGGCTCCAGAAGCTCTGAGG + Intergenic
1178668381 21:34568574-34568596 CAATTCCTCCAGTGGATGTAAGG - Intronic
1180953724 22:19731977-19731999 CACTACCTCCACAGGCTGAAGGG + Intergenic
1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG + Intronic
1181273611 22:21675052-21675074 TGCTTCTTCCAGAAGCTGGACGG + Exonic
1182040979 22:27238967-27238989 CACTTCCTCGAGTAGCCGTGAGG - Intergenic
1182573750 22:31258965-31258987 CACTTCCTTTGGAAGCTCTAGGG + Intronic
1182694483 22:32187456-32187478 GATGTCCTCCAGAAGTTGTAAGG + Intergenic
1182716816 22:32363651-32363673 GATGTCCTCCAGAAGTTGTAAGG - Intronic
1182950643 22:34372468-34372490 CACTTCCCTCAGAAGCTCTCTGG - Intergenic
1184299078 22:43544311-43544333 GACTTCCTCCTGTAGCTGTGGGG - Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
949720042 3:6978304-6978326 CACTCCCTCCAGAATCTCTAAGG - Intronic
949939017 3:9139546-9139568 CACTCCCTCCAGCGGCTCTAGGG - Intronic
950144680 3:10640618-10640640 CTCCTCCTCCAGAAGCTTTCTGG - Intronic
950603683 3:14058504-14058526 CACTTCCTCCAGAGGGTCTGTGG + Intronic
951534857 3:23731259-23731281 CACTCCCTCCAAAGGCTCTAAGG + Intergenic
952568127 3:34682284-34682306 GACTTGCTCCAGAAATTGTAAGG + Intergenic
952945580 3:38476311-38476333 CACTTCCTGCAGCAGGTGGAAGG + Intronic
955458537 3:59152617-59152639 TACTCCTTCCAGAAGCTTTAAGG + Intergenic
955936391 3:64106876-64106898 CAGATCCTCCAGAGGATGTAGGG - Intronic
956455606 3:69417827-69417849 TACTTCCTCCAGAGGTTGTAGGG + Intronic
956925458 3:73982401-73982423 CTCATCCTCCAACAGCTGTAAGG + Intergenic
957132061 3:76235416-76235438 CACTCCCTCCAAAGGCTTTAGGG - Intronic
960516418 3:118607595-118607617 CACTTCCTTCAGAGGGTGTGTGG - Intergenic
960646536 3:119891001-119891023 CTATTCCTCAAGAAGCTCTAGGG + Intronic
961174485 3:124822542-124822564 CACTTGCTCCAGAGGCGGCATGG + Intronic
961317375 3:126049830-126049852 CACTCCCTCTGGAAGCTCTAGGG + Intronic
961771645 3:129254501-129254523 AACTCCCTCCAGCAGCTGTGTGG + Intronic
962040982 3:131707236-131707258 CACTCTCTCCAGAGGCTTTAGGG + Intronic
963241494 3:143007409-143007431 CACTCCCTCCAGCAGCTTTTGGG + Intronic
964242609 3:154614736-154614758 CACTTCTTGCAGAAACTGGAGGG + Intergenic
964420113 3:156493229-156493251 CTCTTCCTAAACAAGCTGTAGGG + Intronic
964979140 3:162657502-162657524 CAATTTCTCCAGAATCTGGAAGG - Intergenic
965052825 3:163671980-163672002 TACTTCCTTCAGAAGTTCTATGG + Intergenic
965531107 3:169771834-169771856 TCCTTCCACCAGAAGCTGAAAGG + Intergenic
968482989 4:845014-845036 CACTACCTCCAGGAGCTCTGAGG - Intergenic
968631503 4:1654454-1654476 CACCTCCTGCAGAAACTGTCTGG - Intronic
970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG + Intergenic
970153378 4:13115405-13115427 GCCTTCCTCCAAATGCTGTATGG + Intergenic
973345434 4:49049715-49049737 CCATTCCTCCAGTATCTGTATGG + Intronic
973849721 4:54948990-54949012 CATTTCCTCCAAAGGCTCTAGGG + Intergenic
973956610 4:56069121-56069143 CAGTTCCTCCAAAGGCTCTAAGG - Intergenic
974770581 4:66406335-66406357 CACTTCCTCTAGAGGTTCTAGGG + Intergenic
978604966 4:110469549-110469571 ATCTTGATCCAGAAGCTGTAGGG + Intronic
981085257 4:140676692-140676714 CTCTTCTTCCAGAAGCTGCATGG - Intronic
981541503 4:145851130-145851152 CACTCCTTCCAGAGGCTCTAGGG - Intronic
981774900 4:148355215-148355237 CACTTTCCCCAGAAGATATATGG - Intronic
982786481 4:159543063-159543085 CACTCCCTCCCGTAGCTGTAGGG - Intergenic
983886197 4:172983247-172983269 TGCTTCCTCCAGAAGCTCTAGGG - Intronic
983931185 4:173454849-173454871 CACATCCTCAAGAAGACGTAGGG + Intergenic
984375639 4:178925327-178925349 CACATACTCCAGAAGCTGAAGGG + Intergenic
984513414 4:180708118-180708140 CACTTCTTCAAAAAGCTGGATGG - Intergenic
984843773 4:184092768-184092790 CATTTCCTTCAAAAGTTGTAGGG - Intronic
986671143 5:10144114-10144136 TACTTCCTCCAAAAGCTCTAAGG + Intergenic
986736605 5:10673105-10673127 CAGGTCCTCCAGAACCAGTAGGG - Intergenic
987371132 5:17194008-17194030 CACTGCCTCTAGAGGCTCTAGGG - Intronic
987667795 5:20967110-20967132 CACTCCCTCCAGATGATCTAGGG + Intergenic
987778071 5:22395343-22395365 CAATGCCTCCAGACGCTGAATGG - Intronic
990232215 5:53725696-53725718 CATTTCCTCCAGAGGCCCTAGGG + Intergenic
992591799 5:78303352-78303374 CCCTCCCTCCAGAAGCTCTAGGG + Intergenic
993410811 5:87571141-87571163 GACTTCCTCTAGAAGATGAAAGG + Intergenic
993539634 5:89132910-89132932 CACATATTCCAGAAACTGTACGG - Intergenic
993802700 5:92363456-92363478 CACTTTCTCCATATTCTGTATGG + Intergenic
994453249 5:99971041-99971063 CACTTCCTCCAAAGGCTGTAGGG - Intergenic
994648319 5:102497528-102497550 CACCTCCTCCAGAACCTGACTGG - Intronic
995772749 5:115690116-115690138 CACTGCCTCCAGACTCTGTAGGG - Intergenic
995846111 5:116495412-116495434 CCCTTCCTGCAGAAACTATAAGG - Exonic
996036347 5:118762818-118762840 CACTTCCTACAGAAGCGTTTGGG + Intergenic
999676968 5:154014413-154014435 CACTTCCTTCAGAGGGTATATGG - Intronic
1000025225 5:157353007-157353029 CATTCCCTCCAGAAACTGCAGGG - Intronic
1000442199 5:161277317-161277339 AATTTTCTCCTGAAGCTGTATGG - Intergenic
1001126558 5:169024711-169024733 CACATCCTCCAGAAGCGGGGTGG + Intronic
1001472680 5:172025987-172026009 CACTCTGTCCAGAAGCTCTAGGG + Intergenic
1002458775 5:179362069-179362091 CACTCCCTCCAGAGGCTTTGGGG + Intergenic
1005011537 6:21340501-21340523 CACTTCCTCCAGAATCCTTTTGG + Intergenic
1006620164 6:35358311-35358333 CACTTCCTCCAGAGGTTCTAAGG - Intronic
1007052105 6:38842378-38842400 AACTTGCTGCAGAAGCTGTATGG + Exonic
1010054656 6:71551369-71551391 CACTTGCTCCAGTAGCTCCAGGG - Intergenic
1010134396 6:72533246-72533268 AATTTCCTCTAGAAGCTGTGTGG + Intergenic
1010819019 6:80391555-80391577 CATTTCCTCTAGAGGCTCTAGGG - Intergenic
1011163408 6:84418746-84418768 CACTCCCTCCAGAGGCTCTCAGG + Intergenic
1011379371 6:86725953-86725975 CACTTCCTCCAGAGGTTCTTGGG + Intergenic
1011717575 6:90123315-90123337 CACTTCCTCCAAAGGCTTCAGGG - Intronic
1011754737 6:90486919-90486941 CAATCTCTCCAGAAGCTGGAAGG - Intergenic
1011833602 6:91403804-91403826 CACTTCCTTCAGAGGGTCTATGG - Intergenic
1012205832 6:96459190-96459212 CACTCCCTCCAAAAGCTCTAGGG - Intergenic
1012515326 6:100052934-100052956 CACTTCCTCTAGAAAGTGTGTGG - Intergenic
1013841866 6:114405817-114405839 TATTTCCTCCTGAAGCTGTGAGG + Intergenic
1013967076 6:115967630-115967652 CAATCGCTTCAGAAGCTGTATGG + Exonic
1015902595 6:138083191-138083213 CATTACCTCCTGCAGCTGTAGGG + Intergenic
1016786935 6:148021178-148021200 CCCCTCCTCCAGAATCTGGATGG - Intergenic
1018417969 6:163617729-163617751 CACTTCCTCCAAAGGCTCTGGGG - Intergenic
1018730274 6:166645003-166645025 CACTCCCTCTAAAGGCTGTAGGG - Intronic
1019869938 7:3751115-3751137 CTCTTCCTCCAGTCGCTGTGTGG + Intronic
1021774993 7:24044811-24044833 CACTCCCTCCAGTAGCTCTCAGG - Intergenic
1023201793 7:37706099-37706121 TTCTTCCTCCAGAAGCTCTCGGG + Intronic
1023891043 7:44392319-44392341 GACTACCACCAGAAGCTGCAGGG - Exonic
1027150707 7:75731604-75731626 CACCTGCTCCAGAAGCAGAAGGG + Intronic
1027599988 7:80228120-80228142 CACATCATCTAGAAGCTCTAGGG + Intergenic
1029035042 7:97510470-97510492 CACTTCACAGAGAAGCTGTAAGG + Intergenic
1031079817 7:117247478-117247500 CATTCCCTCCAAAGGCTGTAGGG + Intergenic
1031517113 7:122714991-122715013 TACTCCCTCTAGAAGCTCTAGGG - Intronic
1031967434 7:128037197-128037219 CACTCCCTCCAGAGGCCGTAGGG + Intronic
1032072282 7:128815606-128815628 CACTACCTCCAGACTCTGTGGGG - Exonic
1033412124 7:141127601-141127623 GACTCCTTCCAGAGGCTGTAGGG - Intronic
1034274643 7:149818680-149818702 CCCCTGCTCCAGAAGCTGCACGG + Intergenic
1035684893 8:1516875-1516897 CTCATCCTCTTGAAGCTGTAGGG - Intronic
1036544500 8:9753914-9753936 TACTCCCTACAGAGGCTGTAGGG + Intronic
1036696041 8:10975782-10975804 CACTTCCACCACATTCTGTAGGG + Intronic
1037691448 8:21184598-21184620 CCCTTCCTCCAGTCTCTGTAGGG + Intergenic
1040420868 8:47239378-47239400 CACACCCTCCAAAAGCTCTAGGG + Intergenic
1043151114 8:76717116-76717138 AACTTCCTCCAGTAGTTGTAAGG - Intronic
1043596351 8:81890619-81890641 CACTCCCTCTAGAGGCTCTAGGG + Intergenic
1045219276 8:100181580-100181602 TTCTTCCTCCAAAACCTGTAAGG + Intronic
1045323489 8:101099519-101099541 CATTTCCTCTGGAAGCTCTAGGG - Intergenic
1045714227 8:105022654-105022676 CACCTACTCCAGTAGCTGTTAGG - Intronic
1047108502 8:121761869-121761891 CACTCCTTCCAGAGACTGTAAGG - Intergenic
1047303443 8:123634570-123634592 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1048160465 8:132016213-132016235 CACTTCCTCAGGAAGCAGAAAGG - Intergenic
1048233027 8:132662484-132662506 CACATCCTACAGAAGATGTGAGG - Intronic
1048328566 8:133456821-133456843 CACTTTTTCCAGATGCTGAATGG + Exonic
1048977855 8:139683007-139683029 CACTTCAACCAGAGGCAGTAGGG + Intronic
1050547954 9:6724964-6724986 CACTCCCTCCAGAGGCTCTGGGG + Intronic
1050626509 9:7509986-7510008 AATTTCCTCCAGAAGTGGTAAGG + Intergenic
1050654515 9:7811923-7811945 CATTTCCTCCTGCAGCTCTAAGG - Intronic
1050838643 9:10117481-10117503 CACTCCCTACAAAAGCTCTAGGG + Intronic
1052612713 9:30796961-30796983 CACTACCTACAAAAGCTGCAAGG - Intergenic
1052708321 9:32020751-32020773 CATTTCTTCCAGAAGCTCTAAGG + Intergenic
1053463102 9:38285727-38285749 CAGTTACTCCAGAGGCTGAAAGG - Intergenic
1055385394 9:75756802-75756824 GGCTTCCTCCAGAGGCTATAGGG - Intergenic
1056306701 9:85297933-85297955 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1056633904 9:88316048-88316070 CACTTCCTCTGAAAGCTCTAGGG - Intergenic
1056855032 9:90119951-90119973 CACTTCCTCCAGAGCCTGCAAGG + Intergenic
1057082289 9:92181849-92181871 CACTACCTCCAAAGGCTCTAGGG + Intergenic
1057398295 9:94700025-94700047 CTCTTCCTCCAGAAGGTATAGGG - Intergenic
1057967455 9:99517967-99517989 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1058222842 9:102324434-102324456 TACTTCGTCCAGAGGCTCTATGG - Intergenic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1058999767 9:110336401-110336423 CACTTGCTTCTGAAGTTGTAAGG + Intronic
1060562326 9:124556398-124556420 CACTCCTTTCAGAAGCTCTAGGG - Intronic
1060817578 9:126643246-126643268 CAGTTCCTCCTGCAGCTGTCTGG - Intronic
1061160043 9:128888478-128888500 CACTTCCTCCAGATACAGCAAGG - Intronic
1061298830 9:129692787-129692809 CACGTCCTCCAGTAGGTGAATGG - Intronic
1062151271 9:135020408-135020430 TGCTCCCTCCAGAAGCTCTAGGG - Intergenic
1185452070 X:287971-287993 CACGTCCTCCTGAGGCTCTAGGG + Intronic
1185650476 X:1644145-1644167 CATTCCCTCCAGAGGCTCTAGGG - Intergenic
1185677086 X:1857893-1857915 TGCTCCCTCCAGAAGCTCTAGGG + Intergenic
1186023477 X:5283207-5283229 CACTCCCTCTAAAATCTGTAGGG + Intergenic
1186253246 X:7691824-7691846 CACTCACTCCAGCAGCGGTATGG + Intergenic
1191033241 X:55997754-55997776 CCCTTCATCCAGAATCTGCAAGG - Intergenic
1192014832 X:67317811-67317833 CACTTCCTTCAGAGGGTGTATGG + Intergenic
1192270920 X:69578550-69578572 CACTGCCTCCAGGACCTGGAGGG + Intergenic
1192498433 X:71632337-71632359 TGCTCCCTCCAGAAGCTCTAGGG + Intergenic
1192506906 X:71691929-71691951 CACATGCTCCAGAAGCTCTTTGG + Intergenic
1192519791 X:71789617-71789639 CACATGCTCCAGAAGCTCTTTGG - Intergenic
1193741625 X:85224165-85224187 CGCTCCCTCCAGAGGCTCTAGGG + Intergenic
1195238870 X:102931237-102931259 CACTGCCTCCAAAAGCTTTAGGG - Intergenic
1196120507 X:112045381-112045403 CACTACCTCCAGAGGCTCTAGGG - Intronic
1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG + Intronic
1197137929 X:123084343-123084365 CACTTCTTCCATCAGCAGTAGGG - Intergenic
1198236552 X:134740874-134740896 TGCTTCCTCCAGGGGCTGTAGGG - Intronic
1198488751 X:137116266-137116288 CACTTGCTCCTGAACCTGTGAGG - Intergenic
1198687671 X:139244752-139244774 CACTTCCTCCAGAGGCTCTAGGG - Intergenic
1200041660 X:153375312-153375334 CACTCCCCCCAGAGGCTCTAGGG - Intergenic
1200050982 X:153431602-153431624 CGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1200067861 X:153513130-153513152 CACTCCCCCCAGAAGCTCTAGGG + Intergenic
1201928564 Y:19316727-19316749 CAGTCCATCCAGAAGCTGCACGG + Intergenic
1202150487 Y:21839597-21839619 CTCTTTCTCCACAAGCTGCAGGG + Intergenic