ID: 1196686370

View in Genome Browser
Species Human (GRCh38)
Location X:118513860-118513882
Sequence GATGCTGCTGCTCCCCCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196686370_1196686373 9 Left 1196686370 X:118513860-118513882 CCTTATGGGGGAGCAGCAGCATC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1196686373 X:118513892-118513914 GTTACCAGGTGCAGTTGAGTAGG 0: 1
1: 0
2: 0
3: 10
4: 107
1196686370_1196686371 -5 Left 1196686370 X:118513860-118513882 CCTTATGGGGGAGCAGCAGCATC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1196686371 X:118513878-118513900 GCATCATTCCAGTTGTTACCAGG 0: 1
1: 0
2: 0
3: 23
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196686370 Original CRISPR GATGCTGCTGCTCCCCCATA AGG (reversed) Intronic
900474198 1:2868673-2868695 GGCGATGCTGCTCCCCCATGGGG - Intergenic
902168945 1:14595210-14595232 TTTGATGCTGCCCCCCCATAAGG - Intergenic
902884508 1:19395145-19395167 GATGCTGCTGCACCCTCGAAGGG - Intronic
904980722 1:34498881-34498903 GATGTTGCTGCTCACCCAGGTGG - Intergenic
906223839 1:44104632-44104654 GAAGCTGCTGCTGCCCAGTAGGG + Intergenic
906311044 1:44754670-44754692 GCTGTTGCTGCTGCCGCATAGGG + Intronic
909684294 1:78329179-78329201 GATGCTGCTGCAGACCCCTATGG - Intronic
915040341 1:152963090-152963112 GATGCAGCTGATTCCCCAGAAGG + Intergenic
915674209 1:157515604-157515626 AATGCTGCTTCTCCCCCAAGGGG + Exonic
917314472 1:173710254-173710276 GAGGCTGCTGCAGACCCATATGG - Intergenic
920524134 1:206653741-206653763 GATTCTGCTTCTGCCCCACAGGG + Intronic
921187869 1:212685352-212685374 GGTTCTGCTGCTCACCCACAGGG + Intergenic
923065699 1:230515348-230515370 GATGCTGCTGCTGAGGCATAAGG + Intergenic
1066084365 10:31962110-31962132 GAGGCTGCTGCAGACCCATAAGG - Intergenic
1067108967 10:43385080-43385102 GATGCTGCTGCCCTCACATCAGG + Intergenic
1067893945 10:50159906-50159928 GAGGTTGCTGCTGGCCCATATGG + Intergenic
1067954901 10:50780358-50780380 GAGGCTGCTGCTGGCCCATATGG - Intronic
1068724010 10:60280433-60280455 TCTGCTGCTGCTCCTACATATGG - Intronic
1076637291 10:131890936-131890958 GAAGCTCCTGCTCCCCTATGTGG - Intergenic
1077652404 11:3985092-3985114 GAGGCAGCAGCTCCCCCAGATGG + Intronic
1080251627 11:30240156-30240178 GATGCTGCTGCTTCTCACTAGGG - Intergenic
1084961071 11:72716994-72717016 GATGCTGCCCCTGCCCCAAAGGG - Intronic
1089002632 11:115064798-115064820 GAGGCTGCTGCTAGCCCATATGG - Intergenic
1089116678 11:116100821-116100843 TATGGGGCAGCTCCCCCATACGG + Intergenic
1089765911 11:120765518-120765540 AATGCTGCTTCTCCTCCAAAGGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096504235 12:52082559-52082581 GGTGCTGCTGTTACCCCATCAGG + Intergenic
1098848237 12:75564240-75564262 AAAGCTGCTGCTTCCCCATAAGG - Intergenic
1101013363 12:100473849-100473871 GATGCTGCTGCTAGCCCAGAAGG + Intronic
1102164825 12:110797787-110797809 GAAGCTGCTGTTCTCCCCTAAGG + Intergenic
1104256428 12:127143270-127143292 GCTGCTGCCCCTCCCCCATGAGG + Intergenic
1104383137 12:128325763-128325785 GATCCTGCTGTTCCCCCATTTGG + Intronic
1105705673 13:22966211-22966233 TCTGCTGCAGCACCCCCATACGG - Intergenic
1105858576 13:24391196-24391218 TCTGCTGCAGCACCCCCATACGG - Intergenic
1106218828 13:27727617-27727639 AATGGTGCTGCTCCTTCATAGGG + Intergenic
1110914090 13:80999602-80999624 GTTGCTGCTGCTCCCTCTTTGGG + Intergenic
1120642025 14:87026710-87026732 GATGCTGATCCTTCACCATAGGG - Intergenic
1120822731 14:88928056-88928078 GATGCTGCTTCTCACCAAAATGG + Intergenic
1120827810 14:88970885-88970907 GATGCTGCTGCTCCTCCAATAGG - Intergenic
1121238806 14:92413186-92413208 TCTGCTGCTGCTCTCCAATAAGG + Intronic
1121742533 14:96264249-96264271 CATCCTGCTCCTCCCCCATGAGG + Exonic
1122144659 14:99682535-99682557 GAGGCTGCTGCAGACCCATATGG + Intergenic
1124500568 15:30224022-30224044 GATGCTGCTGCTCTGCCACTGGG + Intergenic
1124743005 15:32314645-32314667 GATGCTGCTGCTCTGCCACTGGG - Intergenic
1125208074 15:37177743-37177765 GATCCTGCTACTCCTCCATGTGG + Intergenic
1127365143 15:58282527-58282549 GCTGCTCCTCCTCCCCCATCAGG - Intronic
1127826543 15:62708846-62708868 GATGGTGGTGCTAACCCATAGGG + Intronic
1129104564 15:73297151-73297173 GGTGCTGCTTCTGCCCCACAGGG + Intronic
1129194174 15:73954407-73954429 GATGCAGCTGCTCCCACCTCAGG + Intergenic
1129650401 15:77483125-77483147 CATGTTGCTGCTCCCTCATTTGG - Exonic
1132771177 16:1564421-1564443 GATTCTTCTGGGCCCCCATAAGG - Intronic
1133740559 16:8647980-8648002 GATGCTGCTGCTGCTCCAGCGGG - Exonic
1140649496 16:77071687-77071709 GCTGCTGTAACTCCCCCATATGG + Intergenic
1141761081 16:86029086-86029108 GGTGCTGCTCCTCACCCATTTGG - Intergenic
1142265394 16:89062037-89062059 GGCCCTGCTGCTCCCCCACAAGG + Intergenic
1147229308 17:39005528-39005550 GATGCTGCTGATGGCCCTTATGG - Intergenic
1147543657 17:41381863-41381885 GCTGCTGCTGGCCCCCCATATGG + Intronic
1151651846 17:75475137-75475159 GATGCTGCTGCTCTGCAATCTGG - Intronic
1154275979 18:12960817-12960839 GAGGCTGCTGCAGACCCATATGG - Intronic
1159246683 18:65814514-65814536 GATGCTGATGATCCTACATATGG + Exonic
1159841911 18:73407761-73407783 GCTGCTTCTTCTCCCCCATAAGG - Intergenic
1160722921 19:605123-605145 GATGCTGCTGCTCTGCCACTGGG + Exonic
1162609250 19:11736986-11737008 CATCCAGCTGCTCCCCTATAAGG + Intronic
1164072171 19:21778194-21778216 GCTGCTGCTGGTCCCTGATATGG - Intergenic
1164603571 19:29579818-29579840 GATGGTGCTGCTGCCCTAAATGG - Intergenic
1168547307 19:57264028-57264050 GATCCTGCTGCTTCCGCATGTGG + Intergenic
925203612 2:1988523-1988545 TATGCTGCTGCTGCCCCGCACGG - Intronic
925969812 2:9098465-9098487 GGTCCTACTGCTCCCCCAAAGGG - Intergenic
927458506 2:23277656-23277678 GAGGCTGCTGTTCCCTCATTGGG - Intergenic
927498129 2:23564203-23564225 GGTGCTGGGGCTCCCCCACAGGG + Intronic
927630695 2:24771497-24771519 GATGCTCCTGCTCTGTCATAAGG + Intergenic
928133805 2:28672971-28672993 AAGGCTGCTGCTAGCCCATAAGG - Intergenic
930157321 2:48118859-48118881 CATTCTGTTGCTCCCTCATATGG + Intergenic
933895784 2:86808655-86808677 GAGGCTGCTGGGCCCCCAGATGG - Intergenic
934946126 2:98543321-98543343 GATTCTGCGGCTCCCCTATCCGG + Intronic
936371764 2:111907663-111907685 GATTCTGCTGTTCCCCCTCAGGG - Intronic
937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG + Intergenic
937230089 2:120393163-120393185 AATGCTGCTTCTACCCCTTAAGG - Intergenic
938727327 2:134120267-134120289 GCTGCTGCTGCTGCCCAACAAGG + Exonic
941601795 2:167551757-167551779 AGGGCTGCTGCTACCCCATATGG - Intergenic
942699723 2:178692015-178692037 GAACCTGCTGCTCCCCCAAAAGG - Exonic
943189090 2:184653385-184653407 GATGTTGCTGCAGACCCATATGG - Intronic
947743598 2:232496536-232496558 GAAACTGCTGCTCCTCCATGGGG + Intergenic
948734836 2:239995362-239995384 GATGGTGCTGCTGCTCCATGGGG - Intronic
1169860004 20:10141279-10141301 GATGCTGCTGCTCCCTGAGTGGG - Intergenic
1173817471 20:45998963-45998985 GATGCTGGTACTTCCCCATGTGG - Intergenic
1174032341 20:47639960-47639982 GATGCTGCTGCTTGGCCATAGGG - Exonic
1174078100 20:47952339-47952361 GAGGCTGCTCCTTCCCCATCGGG - Intergenic
1174140023 20:48406148-48406170 GAGGCTGCTCCTTCCCCATTGGG + Intergenic
1176033931 20:63027164-63027186 GCTGGTCCTGCCCCCCCATACGG - Intergenic
1178960519 21:37060451-37060473 GCTGCTGCTGCTGCCCCAAGAGG - Intronic
1180841980 22:18963335-18963357 GATGCTGCCCCTCACCCACAGGG - Intergenic
1181059518 22:20275546-20275568 GATGCTGCCCCTCACCCACAGGG + Intronic
1183051488 22:35265487-35265509 GGTGCTGCTGCTCCAGCGTATGG - Exonic
1184069495 22:42139327-42139349 GCTGCTGCTGCTCCCTCATTGGG + Intergenic
949094930 3:74735-74757 CATGCTGCTGCTCTGCCCTATGG - Intergenic
950888930 3:16385982-16386004 AATGCTGCTGCACACCCACAAGG + Intronic
952748047 3:36800638-36800660 GATCCTGGTGCTTCCCCATATGG - Intergenic
955447074 3:59023883-59023905 GATGCCATTGCTCCCTCATAAGG - Intronic
957798556 3:85044208-85044230 CATGCTTCTTCTCACCCATATGG - Intronic
958168910 3:89914574-89914596 GATGCTGCTGCAGGCCCACAGGG - Intergenic
960697702 3:120412106-120412128 GATGGTGCTTCTACCCCATCAGG + Intronic
962044313 3:131739421-131739443 CATGCTGCTGCTTCCCCCTGTGG + Intronic
964395062 3:156236539-156236561 GCTGCTGCAGCACCCCCAAATGG - Intronic
967835213 3:193956640-193956662 GTTGCTGCTCCTCCACCATGTGG + Intergenic
970905361 4:21209651-21209673 TATGCTGTGGCTCCCCAATATGG + Intronic
972580878 4:40394763-40394785 GCTGCTGCTGCTCTCCATTAGGG - Intergenic
977928807 4:102730034-102730056 GAAGCTGCTGCTGCCCACTAGGG + Intronic
980963403 4:139498519-139498541 GATCCTGGTGCTTCCCCATGTGG + Intronic
984880378 4:184405405-184405427 TTTGCAGCTGCTCCACCATAAGG + Intronic
992160499 5:73996184-73996206 TATGTTGCTCCTCTCCCATAAGG - Intergenic
992254014 5:74903589-74903611 GACCCTGCCGCTCCCCCATGTGG + Intergenic
995482905 5:112610451-112610473 GAGGTTGCTGCTGACCCATATGG + Intergenic
1001268504 5:170292996-170293018 GAAGCTTCTGTTCACCCATATGG + Intronic
1003168575 6:3702392-3702414 GAGGCTGCTGCAGACCCATATGG + Intergenic
1004086183 6:12451789-12451811 GATGCTGATGGTTCCTCATAGGG + Intergenic
1005084503 6:21991351-21991373 AATGCTGCTGATCGACCATATGG + Intergenic
1006013706 6:31063771-31063793 GATGCTGCAGAACACCCATAAGG + Intergenic
1007501476 6:42301136-42301158 GCTGCTGTAGCTCCCCCATGAGG - Intronic
1007932670 6:45706557-45706579 GCTGCTGCTGCTTCCTCACAAGG - Intergenic
1010105945 6:72168202-72168224 GAGGTTGCTGCACACCCATAAGG - Intronic
1011250036 6:85361578-85361600 GATGCTGCTGGTGACCAATAGGG + Intergenic
1011941486 6:92848502-92848524 GATGCTGCTGCTCCTGGAAAAGG + Intergenic
1019085264 6:169469466-169469488 GATGCTGCTGCCACCCCAGTGGG - Intronic
1019700865 7:2474568-2474590 GATGCTGAAGCTCTCGCATACGG - Intergenic
1027435947 7:78164409-78164431 TAGGCTGCTCCTGCCCCATAAGG - Intronic
1032344914 7:131108304-131108326 GATGCTGTGGCTCCCCGATCGGG - Intergenic
1032950208 7:136900440-136900462 GATGCTGCTGCTCCAAGCTAAGG - Intronic
1040758051 8:50804769-50804791 GGAGCTGCTGCTCGCCCATCTGG - Intergenic
1042484343 8:69334270-69334292 CACTCTGCTGCTCCCCCATAGGG + Intergenic
1047544614 8:125803621-125803643 GAGGCTGCTGCAGACCCATATGG - Intergenic
1048884512 8:138898896-138898918 GATGATGCTGCTTCCTCATAGGG - Intronic
1052140746 9:24979829-24979851 GTTCCTGGTGCTCCCACATATGG - Intergenic
1052664398 9:31476033-31476055 GATGCTGCAGCTCTCACAAAGGG - Intergenic
1053280183 9:36815598-36815620 GATCCAATTGCTCCCCCATAGGG + Intergenic
1058032544 9:100215722-100215744 GGTGTTGCTGCTCCACCATATGG - Intronic
1061878818 9:133558208-133558230 GATGCCGCTGCTCCCCCGGCCGG + Intronic
1186063049 X:5731373-5731395 AATGCTGGTGCTCTCCCATGTGG + Intergenic
1189197002 X:39161372-39161394 GATGCTGCTGGTCCCTCACCTGG - Intergenic
1196686370 X:118513860-118513882 GATGCTGCTGCTCCCCCATAAGG - Intronic
1198757909 X:140000571-140000593 GATGTTGCTGCAGACCCATATGG + Intergenic
1199164046 X:144648759-144648781 CATGCTGCTGCTGCCACATATGG + Intergenic