ID: 1196686488

View in Genome Browser
Species Human (GRCh38)
Location X:118514666-118514688
Sequence ATGTGTTTGAAAAAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 374}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196686488_1196686492 29 Left 1196686488 X:118514666-118514688 CCATCACACTTTTTCAAACACAT 0: 1
1: 0
2: 3
3: 28
4: 374
Right 1196686492 X:118514718-118514740 TGCATGCTGACTCCTCATCCGGG 0: 1
1: 0
2: 1
3: 18
4: 179
1196686488_1196686491 28 Left 1196686488 X:118514666-118514688 CCATCACACTTTTTCAAACACAT 0: 1
1: 0
2: 3
3: 28
4: 374
Right 1196686491 X:118514717-118514739 GTGCATGCTGACTCCTCATCCGG 0: 1
1: 0
2: 0
3: 12
4: 92
1196686488_1196686493 30 Left 1196686488 X:118514666-118514688 CCATCACACTTTTTCAAACACAT 0: 1
1: 0
2: 3
3: 28
4: 374
Right 1196686493 X:118514719-118514741 GCATGCTGACTCCTCATCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196686488 Original CRISPR ATGTGTTTGAAAAAGTGTGA TGG (reversed) Intronic
901856395 1:12046936-12046958 TTGTGTGTGCAAATGTGTGACGG - Intergenic
905533976 1:38704382-38704404 ATGTGATTGAAAATTTGAGAAGG + Intergenic
905545605 1:38796813-38796835 ATGTGTTTTAAAAGGTGGTAGGG - Intergenic
906240867 1:44241412-44241434 ATGTGTTTGAGTGTGTGTGAGGG - Intronic
906470939 1:46130747-46130769 ATGTATTTTAAAACGTGTTATGG - Intronic
907325004 1:53631954-53631976 AGGTGTGTGAATGAGTGTGAGGG + Intronic
907932344 1:59012297-59012319 ATAAGGTTGAAAAAGTATGAAGG - Intergenic
908480234 1:64532507-64532529 ATGTGTTTCAGAAAGTGGAATGG + Intronic
910051414 1:82978391-82978413 ATTTCTTTGAAAACATGTGAGGG + Intergenic
910382269 1:86640972-86640994 ATGTATTTGCCAAAGTGAGAAGG + Intergenic
911065655 1:93785773-93785795 ATTTGATAGAAAAAGTGTCATGG - Intronic
911744220 1:101421771-101421793 ATGTGTGTCAAGAATTGTGAAGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
913030037 1:114892568-114892590 GGGTGTTTGCAAATGTGTGATGG + Intronic
913486779 1:119339125-119339147 ATGTGTGTGAAAATATGTGTGGG - Intergenic
914260374 1:145994218-145994240 CTGGGTTTGTAAAATTGTGATGG - Intronic
914826174 1:151139314-151139336 CTGGGATGGAAAAAGTGTGAAGG + Intronic
916750315 1:167717646-167717668 ATGTGTTTGTCAACGTGTTAGGG - Intergenic
918575562 1:186054967-186054989 ATGAGTTGGAAAAACTGAGATGG - Intronic
919249512 1:195034429-195034451 ATGTGTTTGCAAAGTTTTGAGGG + Intergenic
920713719 1:208319538-208319560 ATGTGTTTGGTAAGGGGTGAAGG + Intergenic
921231189 1:213073496-213073518 ATTTGTTTAAAAAAGGGTGAGGG - Intronic
921601508 1:217111198-217111220 ATGTGTTGGAAGAAGTGATAAGG - Intronic
921723387 1:218498454-218498476 ATGGGTGTGAGAAAATGTGAGGG + Intergenic
923086196 1:230705268-230705290 TTATGTTTTAAAAATTGTGATGG - Intronic
923509284 1:234635625-234635647 ATGTGTTTTATAAAGTGTAAAGG + Intergenic
1063397794 10:5707713-5707735 GTGTGTGTGAAAATGAGTGAGGG - Intronic
1063463368 10:6228385-6228407 ATGTTTTTGGAAAAGCGTGCAGG + Intronic
1063649880 10:7924183-7924205 GGGTATTTGAGAAAGTGTGAGGG + Intronic
1064502805 10:15993163-15993185 ATGTGATTGATAATGTGGGAAGG - Intergenic
1066751413 10:38660896-38660918 AAGTGTAGGAAAAAGTGTTAAGG + Intergenic
1066965625 10:42262195-42262217 AAGTGTAGGAAAAAGTGTTAAGG - Intergenic
1067135360 10:43602775-43602797 GTGGGATGGAAAAAGTGTGATGG + Intergenic
1067880125 10:50035770-50035792 CAGTGTTTGAAAAAGTGGCAGGG + Intergenic
1068560501 10:58510260-58510282 ATGAATTAGAAATAGTGTGATGG - Intergenic
1068741420 10:60476584-60476606 ATGTTTTTGATAAAGTTTAAGGG + Intronic
1069129677 10:64683130-64683152 TTGTTTTTGAAAAATTGTGCAGG + Intergenic
1069334930 10:67337247-67337269 ACCTGCTTGAAAAACTGTGAGGG + Intronic
1070079583 10:73172180-73172202 TTGTCTTTGAAAAAGTGGAAAGG - Intronic
1070225498 10:74499907-74499929 ATGTGTATGAAAGAGTGAGCAGG + Intronic
1070443494 10:76469611-76469633 CTGTCTTTGAAACAGAGTGAGGG + Intronic
1072829575 10:98643466-98643488 ATGTATTTGAAAATTTTTGATGG + Intronic
1073790534 10:106935856-106935878 TTGTCTTTGCAAAAGTTTGAGGG + Intronic
1073967360 10:109006630-109006652 ATGAGTTTGACATAGGGTGATGG + Intergenic
1074296795 10:112196881-112196903 ATGTGATTGATAAAGGGGGAAGG - Intronic
1075472565 10:122703915-122703937 ATGGCTATCAAAAAGTGTGACGG + Intergenic
1077281038 11:1746027-1746049 ATGTGTGTGCACAAGTGTGTGGG - Intronic
1077846400 11:6029688-6029710 ATGTGTTCGAGAAAATGAGAGGG - Intergenic
1078275456 11:9840823-9840845 CTGTGATTGTAAAACTGTGAGGG - Intronic
1078437415 11:11337014-11337036 GTGGGTTTGAAAAAATGAGAAGG + Intronic
1078978706 11:16506559-16506581 TTGTGTTTTAAAATGTGAGAAGG + Intronic
1079896107 11:26120277-26120299 ATGCGTTTAACTAAGTGTGATGG - Intergenic
1080290291 11:30663550-30663572 ATGTCTTTTAAAAAATGTGATGG + Intergenic
1080952600 11:37052612-37052634 AGGTATTTGAAAAATTATGAAGG + Intergenic
1082091439 11:48093010-48093032 ATGTATTTAAAAAAATCTGATGG + Intronic
1082717819 11:56636812-56636834 ATGGCTTTGAAAAACTGTGCAGG + Intergenic
1085542187 11:77282045-77282067 ATGTGGTTGGAAAAGTATGTAGG + Intronic
1085869119 11:80328479-80328501 ATGTGGTTGAAAGAGTAAGATGG - Intergenic
1086379314 11:86235781-86235803 GTTTGTGTGAAAAAGTGTGTGGG - Intergenic
1086622519 11:88904369-88904391 ATGGCTTTGAAAAAATATGATGG - Intronic
1087519832 11:99217829-99217851 ATGCCTTTGAGAAAGTGAGAGGG - Intronic
1089112102 11:116065190-116065212 GAGTGTTTGAGAAGGTGTGAAGG + Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1090858527 11:130632605-130632627 ATGTGTCTGTAAGAATGTGAAGG + Intergenic
1091117665 11:133029707-133029729 TAGGGTTTCAAAAAGTGTGAGGG + Intronic
1092547973 12:9468005-9468027 GTGTGTGTGAAAAAGAGAGATGG - Intergenic
1092547986 12:9468091-9468113 GTGTGTGTGAAAAAGAGAGATGG - Intergenic
1092726832 12:11495059-11495081 AAGAGTTTGTAAAAATGTGAAGG + Intronic
1092955298 12:13543938-13543960 ATGTCTTTGATGAAGTGAGAGGG - Exonic
1093089775 12:14908292-14908314 ACGTGTTTGCCAAAGTGTGGTGG + Intergenic
1093611808 12:21169975-21169997 ATCTGTTTGAAAAGGTTTGTTGG + Intronic
1093612326 12:21176612-21176634 ATGTGTTTTAAGAGATGTGATGG - Intronic
1093626724 12:21358352-21358374 ATGTGTTTTAAAATCTGTGCTGG - Intronic
1094505014 12:31054361-31054383 GTGTGTGTGAAAAAGAGAGATGG + Intergenic
1095665961 12:44798872-44798894 AGCTGTTTAAAAAACTGTGAGGG + Intronic
1096565729 12:52476877-52476899 ATGTTTTAGATAAAGTCTGAGGG - Intergenic
1097101035 12:56589648-56589670 ATGTGTTTTAAAAAGTATGCAGG + Exonic
1098018112 12:66127744-66127766 AAGTGTTTCAAAAAGTTTCAAGG + Intronic
1098735441 12:74096639-74096661 CTGAGTTTTAAAAAGTGTAAGGG - Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1099127837 12:78788116-78788138 TTGTGTATGAAAAATTGTTAAGG - Intergenic
1099334179 12:81332431-81332453 ACGTATTTGAAAAGGTGTAAAGG - Intronic
1099618516 12:84971633-84971655 ATGTCTCTAAAAATGTGTGAAGG + Intergenic
1099725332 12:86419765-86419787 ATGTGTTTGTGATAATGTGAAGG + Intronic
1099920221 12:88948263-88948285 ATGTGTTTGGAAAAGAAGGAAGG + Intergenic
1099947761 12:89264356-89264378 ATGTGTTTGTACAATTATGAAGG - Intergenic
1100616001 12:96232194-96232216 ATGTGGTTGGAAAAGTGAGTGGG + Intronic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1101675828 12:106915305-106915327 AGGTGTTTGCAGAAGTGTGGGGG - Intergenic
1101862652 12:108495561-108495583 ATGCGTTTGGAAACGTGTGGTGG + Intergenic
1102228079 12:111243419-111243441 ATCTGTTTCAAAAAATGGGAGGG - Intronic
1103416256 12:120743237-120743259 ATGATTTTTAAAAACTGTGACGG + Intergenic
1103668168 12:122588049-122588071 ATGAGTATGAAAATGTGTGCAGG - Intronic
1104193476 12:126507288-126507310 GTGTATTTGAAAAAGAGTGTGGG - Intergenic
1105440483 13:20411316-20411338 CTTTGTTTGAAAAATTGTTATGG + Intronic
1106068502 13:26382495-26382517 ATGTACTTGAAAGAGTGAGAAGG + Intronic
1106236892 13:27869989-27870011 ATGTTTTTTAAAAAGTGGGTAGG + Intergenic
1107292860 13:38876770-38876792 ATGTATTATAAAAAATGTGATGG + Intronic
1107731392 13:43352554-43352576 ATGGCTTTGAGAAAGTGGGAAGG - Intronic
1107778162 13:43870070-43870092 ATGTGTTTAAAAAAATTTAAAGG + Intronic
1108500721 13:51067341-51067363 ATGTGTTTGAAAAAGCGGGTTGG - Intergenic
1109430580 13:62229162-62229184 ATGTGTTTGACAAAGAGAGGAGG + Intergenic
1109690409 13:65880970-65880992 ATATATTTTAAAAAGTGAGAAGG - Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1111767877 13:92557515-92557537 ATGTGTTTGAAAATATGCCAGGG - Intronic
1113181968 13:107639306-107639328 ATGCGTTTGAAAAAGTTGGCAGG - Intronic
1113696529 13:112349996-112350018 ACGTGTTTGCATATGTGTGAGGG - Intergenic
1116759205 14:48989956-48989978 ATGTTTATGAAAAACTATGATGG - Intergenic
1118276132 14:64387790-64387812 AGGTGTGTGACAAAGTATGAGGG + Intergenic
1118772712 14:68952790-68952812 ATGTGATTGAGAGTGTGTGAGGG - Intronic
1118906404 14:70026929-70026951 ATGTGTGTGTATGAGTGTGATGG + Intronic
1120571062 14:86116966-86116988 ATGTATTTAAAAATGTGAGAAGG + Intergenic
1121357151 14:93224847-93224869 AGGTGTTTCAAATAGTGTGCAGG + Intronic
1121401789 14:93685893-93685915 GTGTGTTTGAAAAGTTTTGAAGG - Intronic
1121913628 14:97816021-97816043 ATGAATGTGGAAAAGTGTGATGG + Intergenic
1122850609 14:104527679-104527701 AAGTGTGTGCAAAAGTGTGTGGG - Intronic
1131129385 15:89886593-89886615 ATGTATTTTAAAAATTGGGATGG - Intronic
1131522725 15:93128338-93128360 ATGTTTTTGAAAAGGGGTGATGG + Intergenic
1131726723 15:95234628-95234650 TTGTGTTTGAAAATGTGAGAGGG - Intergenic
1132116415 15:99139282-99139304 ATGAGATAGAGAAAGTGTGAGGG + Intronic
1133627422 16:7584194-7584216 ATTTCTCTGAAAAACTGTGAGGG - Intronic
1135930236 16:26730131-26730153 ATGTGTTTGAGAGAGTGAGAAGG - Intergenic
1136731313 16:32416211-32416233 AAGTGTAGGAAAAAGTGTTAAGG - Intergenic
1137451236 16:48576719-48576741 ATGACTTTGAAAAAGTAGGAAGG - Intronic
1138772778 16:59685729-59685751 ATTTGTTTTAAAATGTGAGAAGG - Intergenic
1138851062 16:60630376-60630398 ATGTGTTTATAAAAGTTTTATGG - Intergenic
1138999899 16:62497065-62497087 TTGTTTTTGAAAAAGTATTAAGG + Intergenic
1140225156 16:73071069-73071091 AGGTGTTTTTAAAAGAGTGAGGG - Intergenic
1140783470 16:78317358-78317380 TTGTGTTTGTTACAGTGTGATGG + Intronic
1202995080 16_KI270728v1_random:101062-101084 AAGTGTAGGAAAAAGTGTTAAGG + Intergenic
1203021767 16_KI270728v1_random:413404-413426 AAGTGTAGGAAAAAGTGTTAAGG + Intergenic
1144946201 17:18970858-18970880 CAGTGTTTGGAAAGGTGTGAGGG - Exonic
1149761423 17:59234074-59234096 AAGTGTTTTAAAGAGTGTAATGG - Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1149831987 17:59880387-59880409 ATCTGTTTGGAAAAGTTTAAGGG + Intronic
1150901669 17:69284925-69284947 ATTTCTTTGAAAAATTGTCACGG - Intronic
1151486230 17:74402658-74402680 TTGTGATTGAAAAAGTTTGTAGG + Intergenic
1153587244 18:6635070-6635092 GTGTGGTTGAAATAGAGTGAGGG - Intergenic
1154008061 18:10550808-10550830 ATGAGTTTGAAAAATTTTGAAGG + Exonic
1154059295 18:11044584-11044606 ATGTGTTGCAAAAAGTATGATGG + Intronic
1154392584 18:13953100-13953122 ATGTGTTTGTACAGGTATGAGGG + Intergenic
1154973411 18:21433001-21433023 ATGTGTTTGAAAATGTCAGCTGG - Intronic
1155361623 18:25008923-25008945 GTGTGTTAGAAAAAGGGTCAAGG + Intergenic
1155649434 18:28122716-28122738 TTGTGTTTAAGAAAGTTTGATGG - Intronic
1155924859 18:31644724-31644746 TTTTGTTTGAAAAACTGTAAGGG - Intronic
1157696342 18:49726661-49726683 ATGTGACTGAAAAAGTGTGAAGG + Intergenic
1158307569 18:56123641-56123663 AACTGTTTTAAAAACTGTGATGG + Intergenic
1159510384 18:69390948-69390970 TTGTGTTTTCAAAGGTGTGATGG - Intergenic
1162926848 19:13934704-13934726 ATGTGATTGTAAGAGTGTGTGGG + Intronic
1164314860 19:24078461-24078483 GTCTTTTTGAAAAAGTGAGAAGG - Intronic
1167603997 19:50470542-50470564 ATATGTCTGAAAGAGTGTGGTGG + Intronic
1167871076 19:52370612-52370634 ATATGTTTCAAAAATTGAGATGG - Intronic
1168374494 19:55864906-55864928 AAGTTTTTAAAAATGTGTGAAGG - Intronic
925983484 2:9195918-9195940 TAGTGTTTAAAAAAGTGTTAAGG - Intergenic
926938732 2:18113492-18113514 AGGGCTTTGAAAAAGTGTTATGG + Intronic
928676611 2:33657379-33657401 ATTTTTTTGAAAGAGTGTTATGG + Intergenic
928988116 2:37200532-37200554 ATCAGTTTTAAAAAGTGTCATGG + Intronic
929675106 2:43918632-43918654 AAGTGTGTAATAAAGTGTGATGG - Intronic
929893807 2:45940701-45940723 ATGTGTTTGAAAGCATGTGTGGG - Intronic
930299308 2:49594732-49594754 ATGTGTTTTGAAATGTGAGAAGG + Intergenic
930593627 2:53358096-53358118 TTGAGGTTGAAAAATTGTGACGG + Intergenic
931417307 2:62093194-62093216 ATGTATTTGAAATTTTGTGATGG + Intronic
933118954 2:78511378-78511400 GTGTGTATGAAAAATTCTGAGGG - Intergenic
934314402 2:91903049-91903071 AAGTGTAGGAAAAAGTGTTAAGG + Intergenic
935017995 2:99202287-99202309 ATGGGGTGGAAAAAGTGTGGTGG - Intronic
935026433 2:99281666-99281688 AGGTATTTGAAAATATGTGAGGG - Intronic
935109763 2:100081672-100081694 CTGTGTGTCAGAAAGTGTGAAGG - Intronic
935368773 2:102322793-102322815 ATTTGATTGGAAAGGTGTGAGGG - Intronic
935900803 2:107790655-107790677 AGGTGAGAGAAAAAGTGTGAAGG + Intergenic
937054357 2:118920070-118920092 ATGTGTTGGCAAAAATGTGTAGG + Intergenic
937904158 2:127044323-127044345 ATGTGTGTGAATGTGTGTGAAGG - Intergenic
939101884 2:137904645-137904667 GTGTGTCTTAAAAAGAGTGAAGG - Intergenic
939597783 2:144148652-144148674 ATGTGGTAGAAATAGAGTGAAGG - Intronic
939626524 2:144484251-144484273 ATGTGTTTAAAATACTGTGTGGG + Intronic
939754517 2:146093552-146093574 ATGTGTTTTGAAATGTGAGAAGG - Intergenic
941677105 2:168355543-168355565 ATGTATTTTAAAATGAGTGAGGG + Intergenic
942667676 2:178337766-178337788 TTCTGTTAGAAAAAGGGTGATGG + Intronic
942718624 2:178923449-178923471 ATATTTTTTAAATAGTGTGATGG - Intronic
944112300 2:196145617-196145639 ATGTGGTTGTAAGAGTGGGATGG + Intronic
944290915 2:198003832-198003854 TTGTGGTTGAAAAAGGTTGATGG + Intronic
944783600 2:203045293-203045315 ATGTTTTTGGAAAAGTGAGGAGG + Intronic
947104257 2:226651759-226651781 ATGTTTTTGATAAAGGATGAAGG + Intergenic
947557807 2:231112453-231112475 ATCTCTTTGAAAAAGTTTGGAGG - Intronic
948229756 2:236341415-236341437 GTGTGTTTGTAAAAGTGGCAGGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1171109779 20:22469929-22469951 ATTTGTTTTAAAAGGTGTGATGG - Intergenic
1171769876 20:29314092-29314114 ATGTGTTGGGAGAAGTGTCAAGG + Intergenic
1173273831 20:41560770-41560792 ATGTATTTGAAAAGGTGTGAAGG - Intronic
1175338467 20:58212000-58212022 ATGTTCTGGAAATAGTGTGATGG + Intergenic
1175355361 20:58361795-58361817 GTGTGGTGGAAAAAATGTGAAGG - Exonic
1175645647 20:60668678-60668700 ATGAGTTAGAAAAACTCTGAAGG - Intergenic
1175659025 20:60796401-60796423 ATGTATTTGTAATAGTGTTAAGG + Intergenic
1177213617 21:18100992-18101014 GTGTGTTTGAAATAGTGATATGG + Intronic
1177500317 21:21946505-21946527 AAGTGTCTGAAAAAGAGAGAGGG - Intergenic
1178306894 21:31498599-31498621 TTGTATTTGAAAAAGGGTGTGGG + Intronic
1180541169 22:16448932-16448954 AAGTGTAGGAAAAAGTGTTAAGG + Intergenic
1181914519 22:26268866-26268888 ATGTGTCTGAAGAAGGGTTAGGG + Intronic
949120958 3:383059-383081 ATGCGTTTGAAAAAATCTCAAGG + Intronic
950613878 3:14143944-14143966 ATGTGCTAGAAAAAGTGGAAGGG + Intronic
950727299 3:14924717-14924739 AAGGGTTTAAAAAAGTGTTAGGG + Intronic
951254829 3:20436593-20436615 ATGTATTTGAAAAAGTTTGAGGG + Intergenic
951500370 3:23379930-23379952 ATAAGTTTGGAAAAGTGAGAAGG + Intronic
952593304 3:34984284-34984306 ATGTTTTAGAAAAAATATGAAGG + Intergenic
953590585 3:44249015-44249037 ATGTGCTTGGAAATGTGTAATGG + Intronic
953626004 3:44571884-44571906 ATGGATTTCAAAAATTGTGAGGG - Exonic
953893750 3:46777584-46777606 ATGTCTTTGATAAATTGTGTTGG + Intronic
954460010 3:50620991-50621013 ATGTATGTGATAAAGTTTGAAGG - Intronic
955569171 3:60285540-60285562 CTGTGTTTGAACAAGTGGGGAGG - Intronic
955881939 3:63556124-63556146 ATGTAGTTGAAACAGGGTGATGG + Intronic
956682386 3:71793066-71793088 ATGCGTTTGAAATAATATGAGGG + Intergenic
956693217 3:71896784-71896806 GTGTGTTTGAGAAAGAGTGAAGG - Intergenic
956833406 3:73075545-73075567 ATGTGTATGAGAAAGAGAGATGG - Intergenic
957013519 3:75035988-75036010 ATATGTTTTAAAGAGTGCGAGGG - Intergenic
957291055 3:78278643-78278665 ATGTGACTGAAATAGTGTGAAGG + Intergenic
957316261 3:78580471-78580493 ATGTTTTTGAAATAGGATGATGG - Intergenic
957566919 3:81895994-81896016 ATGTATTTGAAGAAGTGTTGTGG + Intergenic
957594895 3:82251127-82251149 ATGTTAATGAAAAAGAGTGAAGG - Intergenic
957607535 3:82421969-82421991 TTCTGTTTCAAGAAGTGTGAAGG + Intergenic
958177417 3:90014116-90014138 ATGTCTTTGAAAAAGTAGGCTGG + Intergenic
958518595 3:95155742-95155764 TTGTGTTTTAAAATGTGTGAAGG - Intergenic
958535153 3:95392128-95392150 AAGTGTTTGAAAAACTGGAAAGG + Intergenic
959195358 3:103173666-103173688 ATTTGTTTTAAAAGGTATGATGG - Intergenic
959487202 3:106940582-106940604 ATGCCTTTGAAAATGTGGGAAGG - Intergenic
959805865 3:110553044-110553066 ATATGTTTGAGAAAATGTCAGGG - Intergenic
960127752 3:114018955-114018977 ATTTGTTTTTAAAAGTGTGAGGG - Intronic
960347778 3:116556208-116556230 ATTTGGGTGAAAAAGTTTGATGG + Intronic
960525355 3:118703788-118703810 ATGTGATTGAGAACGTGTGGAGG - Intergenic
961396614 3:126597401-126597423 AAATGTTTGAAAAAATTTGACGG + Intronic
961913389 3:130344946-130344968 ATGTGTTAGAAAGAGTGGGTTGG - Intergenic
962328720 3:134458267-134458289 ATGTGTTTCATAAAATTTGAAGG - Intergenic
963499912 3:146113108-146113130 AGTTGTTTGAAAAAGAGTTATGG + Intronic
963969011 3:151408343-151408365 ATGTGTTTGAAAAGTAGTGTAGG - Intronic
965920408 3:173906531-173906553 ATTTGTTTACAAAAATGTGATGG - Intronic
966017172 3:175154986-175155008 AGGTGTGTGAAAAAGTGAAAAGG + Intronic
966547587 3:181168269-181168291 ATGTCTGTCAAAAACTGTGAAGG - Intergenic
967295645 3:187962227-187962249 AAGTGTTTAAAGAAGTATGAAGG + Intergenic
968032182 3:195509734-195509756 AAGTTTTTTAAAAAGTATGATGG + Intergenic
969698040 4:8746492-8746514 ATGAGTGTGCACAAGTGTGAGGG - Intergenic
969951819 4:10844664-10844686 ATGTGTTTGTTAAACTGTAATGG + Intergenic
971660175 4:29404069-29404091 ATGTGTGTGAAGTATTGTGAGGG + Intergenic
972406162 4:38748409-38748431 TTGTGTTTTAAAATGTGAGAAGG + Intergenic
972844310 4:42969789-42969811 CTGTGTTTTAAAATGTGAGAAGG - Intronic
973874488 4:55203092-55203114 ATTTATTTTAAAATGTGTGAAGG - Intergenic
974137545 4:57837234-57837256 ATGTGTTTGAATAAATGTGTGGG + Intergenic
974768241 4:66376977-66376999 GTGAATTTGAAAAAGTGTGTAGG + Intergenic
974810291 4:66937383-66937405 GTGTGTTTGAAAAAGTTAGCAGG + Intergenic
974856930 4:67472066-67472088 ATGTCTTTGAAAACCTGTAAGGG - Exonic
974986982 4:69040299-69040321 ATGTGTTGGCAACAGTGTGGAGG - Intronic
975042792 4:69764634-69764656 ATTTCTTTGAAAGAATGTGATGG - Intronic
977124140 4:93142782-93142804 ATGTGTATCAAGAACTGTGAAGG + Intronic
977179905 4:93860508-93860530 ATGTATTTGTATAATTGTGAAGG - Intergenic
978128355 4:105162240-105162262 ATGTGTTTGACCATGTGGGAAGG - Intronic
978723799 4:111946458-111946480 ATGTGTTTGATCAAGTATGTGGG - Intergenic
978725156 4:111960871-111960893 ATGTGTTTGATCAAGTATGTGGG + Intergenic
979035934 4:115717561-115717583 ATGTGTTTGAACCAATGTAAAGG + Intergenic
979588400 4:122448523-122448545 ATGTGTCTGAAATAGTGTAGAGG + Intergenic
981599811 4:146473958-146473980 ATGTGTTGCAAAAACTGTTAAGG - Intronic
981677767 4:147359609-147359631 ATATTTTTAAAAAAGTGTTATGG - Intergenic
982023174 4:151224463-151224485 ATATTTTTGAAAAAGTCTGAAGG - Intronic
982117606 4:152110670-152110692 GAGTGTTAGAAAAACTGTGAAGG + Intergenic
983031960 4:162814065-162814087 ATGTGTTCCACAAAGTGTGATGG + Intergenic
983066484 4:163215970-163215992 CTGTATTTTAAAAATTGTGAAGG + Intergenic
983550957 4:169017037-169017059 ATGTGTTTGTGAGAGTGTGTAGG + Intergenic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
984374787 4:178914424-178914446 ATGTATTTTAAAAAGTATGCAGG + Intergenic
984542942 4:181063398-181063420 ATGTGTTTGACTAAGAGTTATGG + Intergenic
985219168 4:187684514-187684536 ATGTGTAGGAAAAAGTGGTAGGG - Intergenic
985246384 4:187983483-187983505 ATGTGTTATAAAAAGGGTCATGG - Intergenic
985386294 4:189451578-189451600 CAGAGTTTGCAAAAGTGTGAAGG + Intergenic
986720043 5:10554416-10554438 AGGTGTTGGAGACAGTGTGAGGG + Intergenic
986873977 5:12083398-12083420 ATGTCTTTAAAAAGGTGAGATGG - Intergenic
987475864 5:18392026-18392048 AAGTGTTTGAAAACATATGAGGG + Intergenic
990077520 5:51868393-51868415 ATTTGCTTCAAAATGTGTGAAGG - Intergenic
990546809 5:56830389-56830411 ATGTGTTTAAGAAAGAGAGAGGG - Intronic
990811835 5:59734753-59734775 AAGAGTTTGGAAATGTGTGAGGG + Intronic
990939718 5:61189272-61189294 TTGTGTTTGGAAATGTGAGAAGG + Intergenic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
992189091 5:74273157-74273179 TTTTGTTTGAACAAGTGTGCTGG - Intergenic
992585454 5:78234228-78234250 TTGGGTTTGAAAAATTCTGAAGG - Intronic
992763571 5:79973691-79973713 ATGTGTTTGGAAATGTGTGGTGG - Intergenic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
993339752 5:86708871-86708893 ATGTATTTGAACAATTTTGAAGG + Intergenic
993762778 5:91817535-91817557 AAGTGATTACAAAAGTGTGATGG + Intergenic
993785187 5:92123676-92123698 ATGTGTTTCACAAAGTTTGCTGG + Intergenic
994019386 5:95005389-95005411 TTGTGTTTTAAAATGTGAGAAGG + Intronic
994420208 5:99522385-99522407 TTGTGTTTGAAATTGTTTGAGGG - Intergenic
994687003 5:102968246-102968268 ATGTATAGGAAAAAGTGTAATGG + Intronic
994771985 5:103993729-103993751 ATGTGTATGCAAAGGTGTTAAGG - Intergenic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
995896983 5:117025902-117025924 ATGTGTTTGAAAATCAGTGAGGG + Intergenic
995985180 5:118162478-118162500 ATGTGTTTTAAAACATTTGAGGG - Intergenic
996093818 5:119377429-119377451 ATTTGTTGGAGAAAGAGTGAGGG + Intronic
996453604 5:123655599-123655621 TTGTGTTTTAAAATGTGAGAAGG - Intergenic
996460938 5:123742333-123742355 ATGTGTGTGGAAAGGTGTGTGGG + Intergenic
996966858 5:129316673-129316695 GTGTATTTGAAAAAGTAAGAGGG - Intergenic
997016129 5:129937505-129937527 TTGTGTTTTAAAATGTGAGAAGG - Intronic
997147147 5:131447771-131447793 ATATAGTTGAAAAAGTGTTATGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
1001633039 5:173190791-173190813 ATATGTGTGAAATAGTGTGTCGG - Intergenic
1001815123 5:174662113-174662135 ATTTGTTTGAAAAACTTTTAAGG + Intergenic
1001831694 5:174794386-174794408 ATGTCTTTGTAAAAGTAGGAGGG + Intergenic
1002995020 6:2274818-2274840 CTGTGTTTTAAAAGGTTTGATGG + Intergenic
1003069174 6:2931077-2931099 ATATTTTTGAAAAACTGTAATGG - Intergenic
1003237882 6:4314704-4314726 ATGTTTTTGAAAAATAATGATGG + Intergenic
1003776211 6:9368437-9368459 ATGTGTGTGAGAATGTGTGTGGG - Intergenic
1004285194 6:14315046-14315068 ATGCTTTTGAAAAATTGTGTGGG + Intergenic
1005242309 6:23845587-23845609 GTGTGTTGGCACAAGTGTGAAGG + Intergenic
1005528156 6:26672978-26673000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005530916 6:26704978-26705000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005539880 6:26796668-26796690 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1005542639 6:26828661-26828683 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1005634144 6:27737450-27737472 CTGTGTTTGAAAAATTTTCATGG - Intergenic
1006468662 6:34212662-34212684 ATGTGTAGGGAAAAGAGTGAAGG - Intergenic
1008014737 6:46505559-46505581 ATGTGTGTGAGAAAGAGAGAAGG - Intergenic
1008619291 6:53256138-53256160 ATGTGTATGAAAAAGATTGGAGG - Intergenic
1009010697 6:57838796-57838818 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009013456 6:57870774-57870796 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009733080 6:67635076-67635098 TTGTGTTTCAAAATGTGAGAGGG + Intergenic
1009841898 6:69088107-69088129 AGGTGTTGGAAAAAGTGAAATGG - Intronic
1010440324 6:75886575-75886597 GTCTCTTTGAAAAGGTGTGATGG - Intronic
1010636352 6:78263459-78263481 ATGTAATTGAAAATGTGTCAGGG - Intergenic
1011232540 6:85178868-85178890 ATGGGTAAGAAAAAGTGGGAAGG - Intergenic
1013805803 6:113994405-113994427 ATGTGTTAGAAATTCTGTGATGG - Intronic
1014090692 6:117400768-117400790 ATGTGGTTGAAAAAAGGAGAAGG - Intronic
1014407969 6:121075061-121075083 ATGTTTTTCTAAATGTGTGATGG - Intergenic
1015225629 6:130853772-130853794 ATGTGCCTGAAAAAGGGAGACGG + Intronic
1015319698 6:131858771-131858793 ATCTGTTTGAAGAAGTGAGATGG + Intronic
1015484259 6:133750265-133750287 AAGTGTTTGGAAAATTATGAAGG + Intergenic
1015869614 6:137762581-137762603 TTCTGGTTTAAAAAGTGTGATGG - Intergenic
1016187854 6:141220555-141220577 TTGTGTTTAAAAATGTGAGAAGG - Intergenic
1017157486 6:151335070-151335092 ATGTTTTTGACAAAGCGTGATGG + Intronic
1018709589 6:166488630-166488652 ATGTGTTTTAGAAGCTGTGAAGG + Intronic
1018980659 6:168599310-168599332 GTGTGTGTGAAACAGTGTGGGGG - Intronic
1019342687 7:516046-516068 ATGGGTTTGGAAAAGTGGGGGGG - Intronic
1020732488 7:11899339-11899361 ATGTTTTTTAAAAATTGAGAGGG + Intergenic
1021680259 7:23123383-23123405 CTGTGTTTGAAAAACTGTCAGGG + Intronic
1022417957 7:30194469-30194491 ATGTGTTTGTACAGGTGTGTAGG + Intergenic
1023182400 7:37498089-37498111 ATGTATTTGAAATAGTGTTGTGG + Intergenic
1023364353 7:39448894-39448916 ATTTGCTTAATAAAGTGTGATGG - Intronic
1024495085 7:50036598-50036620 ATTTGTTTAAAAATGTTTGAGGG - Intronic
1024802523 7:53097446-53097468 AGGAGTTTGAAAAAAAGTGATGG - Intergenic
1024915690 7:54497115-54497137 ATGGGTTTTAAAATGTGTGAAGG - Intergenic
1026337423 7:69406547-69406569 ATATGTTGGCAAGAGTGTGAAGG + Intergenic
1026366376 7:69652664-69652686 ATGTGTTTGTAAAACTTTGCAGG - Intronic
1027221147 7:76214673-76214695 ATGTGTTTCCCAAGGTGTGAGGG - Intronic
1027755573 7:82207150-82207172 AAGTTTTTGAAAATATGTGAGGG - Intronic
1028480982 7:91304243-91304265 ATGTGTTTGAAACTGAGGGAAGG - Intergenic
1028933825 7:96443453-96443475 TTGTGTTTCATAAAGTATGATGG + Intergenic
1029547772 7:101219724-101219746 ATGCCTTTGAAAAACTGAGAGGG - Intronic
1029805558 7:102992286-102992308 ATGTGTTTGGAAAGGTGGGTTGG - Intronic
1030890864 7:114997326-114997348 ATGTTTTTGAGAAGGTGAGAGGG + Intronic
1031097274 7:117435219-117435241 AAGTGTTTAGAAAAGTGTCAAGG - Intergenic
1031178359 7:118381382-118381404 ATGTTTTTGAATATGTGGGAAGG - Intergenic
1031671754 7:124555977-124555999 ATCTGTCTGAAAGAGTGTTATGG + Intergenic
1033101712 7:138479190-138479212 AAGCTTTTCAAAAAGTGTGAGGG + Intronic
1036786620 8:11692272-11692294 CTGTGCTTGAAAAGGTGTGATGG - Intronic
1036927338 8:12919859-12919881 ATGTGTCTCAAAAAATGAGATGG + Intergenic
1037133407 8:15433559-15433581 ATGTGTGTGTATACGTGTGAAGG - Intronic
1037511614 8:19588933-19588955 GGGTGTTTGAAAATGTGTGGGGG + Intronic
1038068415 8:23986972-23986994 AGGTGTGTGAGAGAGTGTGATGG + Intergenic
1038668363 8:29561412-29561434 GTGAGTTTGAAAAACTTTGAGGG + Intergenic
1040848470 8:51872425-51872447 ATATATTTTAAAAAGTGTTAAGG - Intronic
1042013722 8:64283324-64283346 ATGTTTTTGAAAAACTTTAAAGG + Intergenic
1042461522 8:69074590-69074612 GTGTGCTTGAAAGAGAGTGAAGG + Intergenic
1043051977 8:75395679-75395701 ATGTATTTGGAAAAATATGAGGG - Intergenic
1043717352 8:83504577-83504599 ATGTATTTGTAAAATTTTGAGGG + Intergenic
1045375793 8:101572807-101572829 ATGTTTTTTAAAAAATGTGAGGG + Intronic
1046289636 8:112139885-112139907 ATTTGTTTTAAAAAATGTAAAGG + Intergenic
1047279037 8:123429054-123429076 ATGTGTTTTACAAAATATGAAGG - Intronic
1048852188 8:138655851-138655873 ATGTGTTTTGAAAATGGTGATGG - Intronic
1048882534 8:138882687-138882709 GTGTGTTTGACAAAGTGTGTGGG - Intronic
1048963468 8:139598403-139598425 ATATGTTTGAAGCAGTGTCATGG - Intergenic
1051222826 9:14868676-14868698 AAGTGTATGAAAATGTGTGGGGG - Intronic
1051239857 9:15042669-15042691 ATTTGTATGTAAAACTGTGATGG + Intergenic
1052383724 9:27800771-27800793 ATGTGTTTGGAAAAGGATGGTGG + Intergenic
1053099144 9:35354745-35354767 TTGTGTTGGCAAAGGTGTGAGGG + Intronic
1053126029 9:35581452-35581474 TTGTGTTTCAAAATGTGAGAAGG + Intergenic
1054766153 9:69044353-69044375 ATGTCTCTGAAGAAGTGAGAGGG - Intronic
1054814837 9:69465214-69465236 ATGTGTTTGGAAATGAGTGGGGG - Intronic
1054880950 9:70144160-70144182 GTGTGTTTGAGAAAGAGGGAGGG - Intronic
1055758045 9:79575369-79575391 ATTTCTTTGAAAAGGAGTGATGG + Intronic
1057495225 9:95555175-95555197 ATGTGTGTGAAAAGGTATGGAGG + Intergenic
1057706330 9:97397692-97397714 AGATGGTTGAAAAAGGGTGACGG + Intergenic
1059815888 9:117914303-117914325 AATTGTTTGGAAAAGTTTGAGGG - Intergenic
1059874703 9:118621301-118621323 ATGGGTTTGAAAATCTGGGATGG + Intergenic
1059943970 9:119387058-119387080 ATAAGTTAGAAAAATTGTGAAGG - Intergenic
1186462768 X:9761616-9761638 TTGTGTTTAAAAAAGAATGAAGG - Intronic
1186549552 X:10488443-10488465 AAGTGTTGGCAAAAATGTGAAGG - Intronic
1187407220 X:19014932-19014954 ATATGTTTTAAAAAGTGTTCTGG - Intronic
1187643638 X:21322026-21322048 ATGTAATTCAAAATGTGTGATGG - Intergenic
1188267890 X:28100465-28100487 ACTTGTTTGAAACACTGTGAGGG + Intergenic
1188669510 X:32866306-32866328 ATGTATTTGAAATAGTATGTTGG + Intronic
1191190358 X:57660018-57660040 ATGTGTCTGAACAAGTGAGAAGG + Intergenic
1192857626 X:75030251-75030273 AAGTGTTTCAAAAAGTAGGAGGG - Intergenic
1192955230 X:76063240-76063262 ATGTGTTTTGAAATGTGAGAAGG - Intergenic
1193699302 X:84742954-84742976 AGGTGTTTGTAAGAGTGAGAAGG - Intergenic
1196185761 X:112743410-112743432 ATGCATTTGAAAAAGTGTAGAGG - Intergenic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1197584194 X:128324429-128324451 ATGTGTTACAAAATGTGTGCTGG + Intergenic
1198504035 X:137283131-137283153 TTGGCTTTGCAAAAGTGTGATGG + Intergenic
1199059202 X:143333392-143333414 ATGTGTTTTATAATGAGTGATGG - Intergenic
1199250882 X:145660195-145660217 TTGTGTTTGGAAATGTGAGAAGG + Intergenic
1202280087 Y:23174865-23174887 ATGTGTTTTTGAAAATGTGAAGG - Intronic
1202280816 Y:23185710-23185732 ATGTGTTTTTGAAAATGTGAAGG - Intronic
1202436748 Y:24847197-24847219 ATGTGTTTTTGAAAATGTGAAGG + Intronic