ID: 1196687636

View in Genome Browser
Species Human (GRCh38)
Location X:118525788-118525810
Sequence TTTGTGCTAGAAAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196687629_1196687636 23 Left 1196687629 X:118525742-118525764 CCAAATTAAGTTGATTGTATGTT 0: 1
1: 0
2: 0
3: 22
4: 280
Right 1196687636 X:118525788-118525810 TTTGTGCTAGAAAACTCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 185
1196687632_1196687636 -10 Left 1196687632 X:118525775-118525797 CCAGCGGTACTTGTTTGTGCTAG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1196687636 X:118525788-118525810 TTTGTGCTAGAAAACTCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196687636 Original CRISPR TTTGTGCTAGAAAACTCTGG GGG Intronic
900433496 1:2614126-2614148 TTTGTGCTATAACATTCTGTGGG - Intronic
902776795 1:18680031-18680053 TTTGTGCATGACAACTCTGTGGG + Intronic
903764242 1:25723403-25723425 TTTGTGCTAGAAAACCCCAAAGG - Intronic
903887234 1:26547568-26547590 TTGATGCTAGAAGAGTCTGGGGG + Intronic
905683746 1:39893854-39893876 TTTGAGCAAGAAAACTCTCTGGG + Intergenic
907366005 1:53960644-53960666 TATGTGCTAGAAAAATCAGTTGG - Intronic
907925846 1:58954550-58954572 TTTGTGGTGGAAAACACTGGAGG - Intergenic
909192374 1:72570459-72570481 TTTGTGCTAGCTAACTCAGAGGG - Intergenic
909239014 1:73188786-73188808 TGTGTGCCAGATAACTCTTGAGG + Intergenic
913462735 1:119105467-119105489 TGTGTGGTAGAGAACTCAGGAGG + Intronic
915353526 1:155241368-155241390 TATGCCCTATAAAACTCTGGAGG + Intronic
916255468 1:162782955-162782977 TTTGTGCTACTAAACTCTAAAGG - Exonic
918037255 1:180886212-180886234 TTTGTACTTTAAAACTATGGGGG + Exonic
919260655 1:195190192-195190214 TTTTGGCCAGAAAACACTGGTGG - Intergenic
924786426 1:247204056-247204078 TTTGTCCTAGAAAGCTCTAAGGG - Intergenic
1064687034 10:17873523-17873545 CTTGTGCCTGAAAACTGTGGTGG + Intronic
1065824881 10:29561699-29561721 CTTGCCCTTGAAAACTCTGGGGG + Intronic
1066721932 10:38348615-38348637 TTTGTGCTACTAAACTCTAAAGG - Intergenic
1067454612 10:46409550-46409572 TTTTTTCTAGAAATCTCTGACGG - Intergenic
1067632590 10:47975089-47975111 TTTTTTCTAGAAATCTCTGATGG + Intergenic
1070169745 10:73923949-73923971 ATTGTGGTGGAGAACTCTGGGGG + Intergenic
1074394321 10:113084952-113084974 TTTGCCTCAGAAAACTCTGGTGG - Intronic
1074792235 10:116901856-116901878 CTTGAACAAGAAAACTCTGGAGG - Exonic
1077749060 11:4943515-4943537 TTTGTGCTAGATAATTCTTTTGG + Intronic
1078595942 11:12686950-12686972 TTTGTTGTTGAGAACTCTGGTGG + Intronic
1080618746 11:33968591-33968613 TATATGCTAGAAAGCTCTAGAGG + Intergenic
1081311310 11:41576984-41577006 AATGTGCTAAAAAATTCTGGAGG - Intergenic
1081767799 11:45624024-45624046 GTTGTTCTAGAAAACTCTGGAGG + Intergenic
1082895523 11:58185894-58185916 ATTGTGGTAGAAAATTCTTGGGG - Intergenic
1084795276 11:71501139-71501161 TGTGTGCTGGAAAAGCCTGGAGG - Intronic
1086643817 11:89194194-89194216 TATGTGCTTGACAGCTCTGGAGG + Intronic
1086865803 11:91978756-91978778 TTTGTGCTAGAATGCAGTGGGGG - Intergenic
1088037926 11:105340333-105340355 TTTTTGCTAGAATAATCTGAAGG - Intergenic
1088993653 11:114977238-114977260 TCTGTGCTAGTGAATTCTGGGGG - Intergenic
1090198661 11:124838888-124838910 TTTGTGCTAGAAAGGTAAGGAGG - Intergenic
1092012744 12:5128642-5128664 TTTGTTCTAGGAAACTCTAATGG - Intergenic
1092143926 12:6201725-6201747 TTTTTGTTACAAGACTCTGGTGG - Intronic
1096436741 12:51597380-51597402 TTTGTGCTATAAATTTTTGGGGG + Intronic
1100124967 12:91413182-91413204 TTTGTGCTAGATACCTTTGCTGG - Intergenic
1100700941 12:97147179-97147201 TTTCAGCTAGAAAACTTGGGTGG - Intergenic
1101435995 12:104665033-104665055 CTTGTGCTAGCAGACTCAGGGGG + Intronic
1101988671 12:109467068-109467090 TTTGTGCTAAAGCCCTCTGGTGG - Intronic
1102105175 12:110315245-110315267 TTTGTGATAAAAATCTCTGTTGG + Intronic
1102872483 12:116424861-116424883 TTTGGGTGAGAAAACACTGGTGG + Intergenic
1103288968 12:119828198-119828220 TTTGTACTAGAAAGCTATGAAGG + Intronic
1106917801 13:34534023-34534045 TTTGAGCTAGAAGATTCAGGAGG - Intergenic
1108735031 13:53274737-53274759 TTTGATCAGGAAAACTCTGGAGG - Intergenic
1109185488 13:59262904-59262926 TTTCTGCCAGAATACTCAGGTGG - Intergenic
1110227905 13:73139289-73139311 TTTGTGTTAGAAACCACAGGTGG + Intergenic
1110872794 13:80472069-80472091 TGTGTGCCAAAAAACTCTGAAGG - Intergenic
1111700283 13:91678571-91678593 TTGGTGCTAGAACATTTTGGTGG - Intronic
1116375579 14:44195782-44195804 TTTATCCTAGAAAAGTTTGGAGG - Intergenic
1116375772 14:44198502-44198524 TTTTTCCTAGAAAAGTTTGGAGG - Intergenic
1116607865 14:47025731-47025753 TTTGGGCAAGAAAACTGTGTTGG + Intronic
1118019736 14:61698110-61698132 TTTGTTTTGGAAAACTCTGAAGG - Intronic
1118120195 14:62831124-62831146 TTTCTGCTAGTGAACCCTGGTGG + Intronic
1118985285 14:70749271-70749293 TTTGTACAAGAAAACTCTTTGGG - Intronic
1120396108 14:83969329-83969351 TTTTTGCTAGAAAAGTCTTAAGG - Intergenic
1123162265 14:106289681-106289703 AGTGTCCTGGAAAACTCTGGAGG + Intergenic
1126709693 15:51442877-51442899 TTTGTGCTTGGAAAACCTGGAGG + Intergenic
1126874842 15:53030142-53030164 GTTGTGCTATACAACTCAGGGGG - Intergenic
1129306366 15:74666797-74666819 TTTGTGCTGTAAAATTCTGTGGG - Intronic
1130278567 15:82498723-82498745 TTTGTGCTAATTAACACTGGAGG - Intergenic
1131158038 15:90087017-90087039 CTTTTGGTAGAAAACTCTAGTGG - Intronic
1131169931 15:90170676-90170698 ATTGACCTAGAAAACTCTGATGG - Intronic
1135525988 16:23213980-23214002 TTGGTGCTACAAAACAGTGGAGG - Intronic
1135731906 16:24901689-24901711 GTTATTCTAGAACACTCTGGGGG + Intronic
1135826627 16:25734484-25734506 TTTATGGTAGACAACCCTGGAGG - Intronic
1137997880 16:53239261-53239283 TTTCTGCTAGAAAATTCTTAAGG - Intronic
1138977021 16:62220360-62220382 ATTGATTTAGAAAACTCTGGGGG - Intergenic
1141076903 16:81014933-81014955 TTTATGATAGAAGACTCTGTTGG + Intronic
1141376189 16:83532949-83532971 TTTGTGTTAGAAACAGCTGGTGG - Intronic
1142896234 17:2980896-2980918 ATTGTGCTGGAAACCTTTGGTGG + Intronic
1147290019 17:39434450-39434472 TTGATGCTAGAAAACTTTTGAGG - Intronic
1148623498 17:49052108-49052130 TTTGGGCCAGACAATTCTGGGGG - Exonic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149089616 17:52762555-52762577 TTGCTGCTAGAAAACACTGTGGG + Intergenic
1150995147 17:70308499-70308521 TTTGTTTTAGAGAATTCTGGAGG - Intergenic
1151288814 17:73133596-73133618 TTTGGCCTAGAAAGCTCTGATGG - Intergenic
1151396166 17:73824435-73824457 TTTGTGCTTGAAAACCCTCGTGG - Intergenic
1157525749 18:48380021-48380043 TTTGTGCTATAAAGTTCTGTGGG - Intronic
1157985270 18:52430568-52430590 TTTGTGGTAGGAATCTATGGAGG + Intronic
1162440784 19:10690859-10690881 TGTGTGCTAGAAAACTTTTGAGG + Exonic
1164172863 19:22740720-22740742 ATTGTGCTAGAAAACCCTAAGGG + Intergenic
1166836081 19:45668910-45668932 TGTGTGCTAGAAAACCCTTTGGG + Intronic
1167195364 19:48024438-48024460 TTTGGGGTGGAAAACCCTGGTGG + Intronic
925332581 2:3070549-3070571 ATTGTGCTAGGAATCTCGGGAGG - Intergenic
925745053 2:7036811-7036833 TTTGTACAAGAATTCTCTGGGGG + Intronic
927342512 2:21998366-21998388 TTTGTGTTAGGAAACTGAGGGGG - Intergenic
927348914 2:22083074-22083096 TTTGGGCTAGATAACTATTGGGG + Intergenic
929572195 2:43029698-43029720 TTCTTGCTATAAAACTCTGATGG + Intergenic
931116388 2:59171254-59171276 TTTGTTCTAGAGAAGTCTGGAGG - Intergenic
932148297 2:69344310-69344332 TTAGTCCTAGAAATTTCTGGTGG + Intronic
937332549 2:121041078-121041100 TTTATAGTGGAAAACTCTGGAGG + Intergenic
938621841 2:133063628-133063650 TTTGTTCTAGAATAATCTGTAGG + Intronic
940486348 2:154300850-154300872 TTTCTTCTAGAAAGCTCTGGGGG - Intronic
943341453 2:186686959-186686981 TTTTTCATAGAAAATTCTGGTGG + Intergenic
947337716 2:229104384-229104406 TTTGTGGTAGAAAATTATAGAGG + Intronic
1170128113 20:12988338-12988360 TTTGTTCTAGAAATGACTGGAGG + Intergenic
1171341491 20:24432152-24432174 TTTGGGCTAGAAGGCTGTGGGGG - Intergenic
1172488635 20:35316215-35316237 TTTGTGCTTAACAACTCTGACGG + Intronic
1174788086 20:53451897-53451919 GTTTTGCTAGTAAAGTCTGGGGG + Intronic
1182536247 22:31005346-31005368 TTTGTGCTATACAATTCTGTGGG - Intergenic
951263320 3:20537955-20537977 TTTGTGCATGAATACACTGGTGG - Intergenic
951697065 3:25456080-25456102 TTTTTGCTTGAAAACTCTGCCGG - Intronic
951760410 3:26141254-26141276 TCTGTGCTGGAAACCCCTGGTGG + Intergenic
951852642 3:27159750-27159772 TTTGTTCTAGAAGAGTTTGGAGG + Intronic
954991288 3:54842902-54842924 TTTGTCCTAGAAAGAACTGGAGG - Intronic
957414731 3:79886642-79886664 TTTCTACTAGAAAACTTTAGAGG - Intergenic
957566786 3:81894409-81894431 TTTGTGCTAGAAAATTTGGCTGG + Intergenic
958252772 3:91289572-91289594 TTTGAGAAAGAAAACACTGGAGG - Intergenic
959968889 3:112385899-112385921 TTTGTACTGGAAAATTCAGGAGG - Intergenic
960150087 3:114240493-114240515 TTTGGGTGAGAAAACTCTGTTGG - Intergenic
961998770 3:131273179-131273201 TTTATCCTAGAAAACTCAGGGGG - Intronic
963801849 3:149684085-149684107 TTTGTGTTTGAAAAATATGGGGG + Intronic
965463534 3:168999146-168999168 TTTGGGCCAGAACACTCTCGGGG - Intergenic
966679138 3:182621784-182621806 TTTGTGCTACAATTCTGTGGGGG + Intergenic
970385671 4:15554198-15554220 TTAGTGCTAGAAAAATCTCCTGG + Intronic
970390860 4:15611936-15611958 TGAGTGCTACAAAACTCTAGAGG + Intronic
971969842 4:33606551-33606573 TTTCAGCTAGAGAACACTGGTGG - Intergenic
973808628 4:54549004-54549026 GTTGTGCAAGAAAGCACTGGAGG + Intergenic
974602996 4:64110987-64111009 TTTATGCTAGAAAAGTCTCCTGG - Intergenic
974877345 4:67715822-67715844 TTTGGGGTAGAAGCCTCTGGTGG + Intergenic
975050599 4:69859351-69859373 TCAGTGCTAGAATACTATGGTGG + Intronic
978100315 4:104830903-104830925 TTTGAGCCTGTAAACTCTGGAGG - Intergenic
978994427 4:115131846-115131868 TTAGTGCCAAAAAACTCTGTAGG - Intergenic
982073527 4:151716784-151716806 TTTGTTCAAGAAAACTCTAGCGG + Intronic
982151613 4:152464584-152464606 TTTGTACTAGAAACCTCTCAAGG + Intronic
982248257 4:153377682-153377704 TTGGTGCTAGAAAGATCTGTGGG + Intronic
983869406 4:172807771-172807793 TTTGAGCTAAAACACTCTCGTGG + Intronic
984305782 4:177988613-177988635 TTTGTGCTATAAAGGTCTGAGGG - Intronic
984966485 4:185144238-185144260 TATCTGCTTGAAAACTTTGGAGG + Intronic
985111424 4:186550319-186550341 TTGGTACTAGAAAACTCTAAAGG + Intronic
985219803 4:187692371-187692393 TCTGTCCTAGAAAAATCTGCTGG - Intergenic
987398428 5:17448497-17448519 TTTGAGCTATGAAATTCTGGTGG - Intergenic
989381633 5:40814535-40814557 TTTGTGCTATAAAGTTCTGTAGG + Intergenic
989988461 5:50732072-50732094 TTTGTGATATGAAACCCTGGTGG - Intronic
990900978 5:60748595-60748617 TATCTGCTAGAAACATCTGGAGG + Intergenic
991206272 5:64053367-64053389 TTAGTGCTATAAAACTCTATAGG - Intergenic
991989413 5:72322797-72322819 TCTGTGCTAGAAAAGTCAGTAGG + Intronic
995641373 5:114261149-114261171 ATTTTCCTAGAAATCTCTGGAGG - Intergenic
997740279 5:136247015-136247037 TTTGTGGTGGTAAACTTTGGGGG - Intronic
998425190 5:142020670-142020692 TTTGTGCTATAAAATTCTATGGG + Intergenic
999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG + Exonic
1001353208 5:170993167-170993189 ATTGTGCTAAAATACTCTAGGGG + Intronic
1001398018 5:171430425-171430447 TCTGTGCTAGGAATCTCTTGAGG - Intronic
1007308863 6:40929102-40929124 TGTGCACTAGAAAAATCTGGTGG - Intergenic
1007356779 6:41325619-41325641 TTTGTCCTAGATAAATGTGGCGG + Intergenic
1007807438 6:44461041-44461063 TTTGTCCTAGAAAGCTCTAAAGG + Intergenic
1009191711 6:60637349-60637371 TTTGAGAAAGAAAACACTGGAGG + Intergenic
1009507491 6:64503357-64503379 TTTATGTTATAAAATTCTGGGGG + Intronic
1010150904 6:72731251-72731273 TGTGTGCCAGACAAATCTGGTGG - Intronic
1011400729 6:86958669-86958691 TGTCTGCTATAAAACTCTGAAGG + Intronic
1015811478 6:137165716-137165738 TTTGTGCTTGCAATTTCTGGAGG - Intronic
1016226131 6:141740570-141740592 TTTGTGCTCTAAAACTCTATGGG + Intergenic
1016373403 6:143396961-143396983 TTTGTGCTAGAATTCTTTAGTGG + Intergenic
1016434615 6:144023346-144023368 TTTGTGCTATAAAATTCTGTAGG - Intronic
1019800965 7:3088134-3088156 TCTCTGCCAGAAACCTCTGGTGG - Intergenic
1021290146 7:18833264-18833286 TTTGTTCTTGAAAAATCTGTTGG - Intronic
1021542311 7:21773873-21773895 TTTGTTCTAGAAAACTCTTTGGG - Exonic
1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG + Intergenic
1022333543 7:29401828-29401850 AATCTGCTAGCAAACTCTGGTGG - Intronic
1023219365 7:37903157-37903179 TTTGTGCTGGAAAAGTATGGTGG + Intronic
1025859839 7:65316303-65316325 ATTGTGCTAGAAAACCATAGGGG + Intergenic
1027469966 7:78561421-78561443 TTTGTGACTGAAAACTTTGGAGG - Intronic
1028330218 7:89581000-89581022 TTAGTGCTAGAAAAATCTGTAGG + Intergenic
1028361532 7:89972899-89972921 CTGGTGATAGAAAACACTGGAGG - Intergenic
1028525790 7:91784941-91784963 TTTGAGCTAGAAAAATCTAACGG - Intronic
1029318662 7:99737398-99737420 TTTGTTCTAGAAAACCCAGGGGG - Intergenic
1031068742 7:117138480-117138502 TGTGTGCCAGAAGACTCGGGAGG + Exonic
1032354234 7:131195007-131195029 TTTTTGCGAGATAACTTTGGAGG - Intronic
1032629426 7:133632125-133632147 TTTTTTGTAGAAGACTCTGGTGG + Intronic
1036424766 8:8634545-8634567 TCAGTGCTAGAGAAATCTGGTGG - Intergenic
1036627743 8:10485560-10485582 TTTTTGATAGAATACTCTGGTGG + Intergenic
1037008902 8:13816874-13816896 TTTTTGCTAGGAAACTCTACAGG + Intergenic
1037655402 8:20879270-20879292 TGTGTGTTAGCTAACTCTGGAGG + Intergenic
1039253157 8:35688729-35688751 TGTGTATTAGAAAAATCTGGTGG - Intronic
1041022676 8:53654073-53654095 TGTGTTCTACAAAACTCTGGGGG + Intergenic
1041132690 8:54718944-54718966 TTTGTGCTATACAATTCTGTGGG - Intergenic
1043044031 8:75298430-75298452 GAGGTGCTAGAAAACTCTGGAGG + Intergenic
1043501421 8:80861329-80861351 AATGTGTTAGAAAACACTGGGGG - Intronic
1044278694 8:90332057-90332079 TTGCTGCTTGAAAACTCTGTTGG - Intergenic
1046206455 8:111004664-111004686 TTGGAGATAGAAAACTCTGAAGG - Intergenic
1047083490 8:121491293-121491315 TGTGTGCTAGAGAACAGTGGCGG - Intergenic
1047555837 8:125929449-125929471 TTTGTGTCAGAAAGATCTGGAGG - Intergenic
1048687289 8:136918769-136918791 AGTGTGATAGAAAACACTGGGGG + Intergenic
1051094917 9:13455638-13455660 TTTATGCTTGACAACTTTGGAGG - Intergenic
1051348925 9:16179994-16180016 TTAGTGCTAGACAATTCTGTTGG + Intergenic
1056247604 9:84711834-84711856 TTTGTGACAGAAAAATCTGTGGG - Intronic
1057487962 9:95500691-95500713 TTTGTGACAGAAACATCTGGAGG + Intronic
1057529831 9:95834676-95834698 ATTTGGCTAGGAAACTCTGGTGG - Intergenic
1058113107 9:101053441-101053463 TTTTTGGAAGATAACTCTGGAGG - Intronic
1060425874 9:123505064-123505086 TTTCTGCAAGATAACTCTGAAGG + Intronic
1060545750 9:124458149-124458171 GGTGTGCTGGAAGACTCTGGAGG - Exonic
1060772396 9:126342089-126342111 TTTGTGCCACGAAACTCTGGGGG + Intronic
1062023336 9:134329379-134329401 TTTGTTTTGGTAAACTCTGGAGG + Intronic
1187451253 X:19398423-19398445 TAGTTGCTAGACAACTCTGGGGG - Intronic
1196687636 X:118525788-118525810 TTTGTGCTAGAAAACTCTGGGGG + Intronic
1196724651 X:118885389-118885411 TGTGTGCAAGAAACCTCTAGTGG + Intergenic
1199232439 X:145452584-145452606 TTTGTGTGGCAAAACTCTGGAGG - Intergenic
1200952120 Y:8908457-8908479 CTTGTGCTTGAAAACTAGGGGGG - Intergenic
1202160894 Y:21935179-21935201 CTTGTGCTTGAAAACTAGGGGGG + Intergenic
1202187364 Y:22200337-22200359 CTTGTGCTTGAAAACTATGGGGG - Intergenic
1202203996 Y:22386059-22386081 CTTGTGCTTGAAAACTATGGGGG + Intronic
1202230462 Y:22651194-22651216 CTTGTGCTTGAAAACTAGGGGGG - Intergenic
1202312695 Y:23544971-23544993 CTTGTGCTTGAAAACTAGGGGGG + Intergenic
1202558107 Y:26125623-26125645 CTTGTGCTTGAAAACTAGGGGGG - Intergenic