ID: 1196688411

View in Genome Browser
Species Human (GRCh38)
Location X:118532482-118532504
Sequence GTTGAAGAAGGTGTGCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196688405_1196688411 -5 Left 1196688405 X:118532464-118532486 CCTCACCAAGAAAACCCAGTTGA 0: 1
1: 0
2: 0
3: 14
4: 184
Right 1196688411 X:118532482-118532504 GTTGAAGAAGGTGTGCCGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 75
1196688403_1196688411 4 Left 1196688403 X:118532455-118532477 CCTGCCTCACCTCACCAAGAAAA 0: 1
1: 0
2: 2
3: 22
4: 367
Right 1196688411 X:118532482-118532504 GTTGAAGAAGGTGTGCCGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 75
1196688406_1196688411 -10 Left 1196688406 X:118532469-118532491 CCAAGAAAACCCAGTTGAAGAAG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 1196688411 X:118532482-118532504 GTTGAAGAAGGTGTGCCGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 75
1196688404_1196688411 0 Left 1196688404 X:118532459-118532481 CCTCACCTCACCAAGAAAACCCA 0: 1
1: 0
2: 1
3: 43
4: 455
Right 1196688411 X:118532482-118532504 GTTGAAGAAGGTGTGCCGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196688411 Original CRISPR GTTGAAGAAGGTGTGCCGGC CGG Intronic
900163008 1:1233284-1233306 GGTGAAGCAGGTGTCCCGGAGGG - Exonic
905105878 1:35563375-35563397 GTTGAGGAAGATGTGGCAGCAGG - Exonic
906295309 1:44645791-44645813 GATGAATCAAGTGTGCCGGCTGG - Intronic
906916071 1:50011861-50011883 GTAGAAGAATGTTTACCGGCCGG + Intronic
907084121 1:51653700-51653722 GTTGAAGAATCTGGACCGGCTGG + Intronic
908571117 1:65411378-65411400 GGTGAAGAAGGTGTACAGGAAGG + Exonic
909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG + Intronic
917855439 1:179095521-179095543 GTTGAAGAAAGTGGGCCAGGTGG + Exonic
920335365 1:205241722-205241744 GTTGAAGGCGGTGGGCCGGGCGG - Exonic
922799770 1:228359897-228359919 GGTGAAGAAGATGGGCCCGCAGG + Intronic
922951961 1:229566035-229566057 GTTCTAAAAGGTGTGCCGGCTGG + Intergenic
1076909615 10:133380362-133380384 GTTGAAGAAGGAGTTCAGGACGG - Exonic
1076986058 11:236603-236625 GTTGAAAAAGGTGTGAGCGCAGG - Intronic
1080689189 11:34541657-34541679 GTTGAAGTAGGTGAGCTGGTAGG - Intergenic
1085721347 11:78914901-78914923 ATTGAAGCGGGTGAGCCGGCAGG - Intronic
1092155246 12:6278333-6278355 GTTGAAGAAGGTGTCCTGACAGG - Intergenic
1096887340 12:54731032-54731054 GTGGCAGCAGGTGTGCCGCCAGG + Intergenic
1101032781 12:100676617-100676639 GTTGAGAAAGGTATGCTGGCTGG + Intergenic
1101560065 12:105848550-105848572 GTTGAAGGAGGTGAGCCTGCTGG + Intergenic
1104837315 12:131799981-131800003 GTTGCAGCATGGGTGCCGGCAGG - Intergenic
1108686697 13:52826267-52826289 GTGGAGGAAGAGGTGCCGGCGGG + Intergenic
1109796737 13:67324432-67324454 GTGGAAGATGGGGTGGCGGCCGG + Intergenic
1111702367 13:91706755-91706777 GTTGAAGAAGATGTTCCTACAGG + Intronic
1113802141 13:113092181-113092203 GGTGGAGAAGGTGGGCCGGGTGG + Intronic
1118860513 14:69659447-69659469 GTTGAAGATGGTGAGCTGGACGG + Intronic
1119258416 14:73220317-73220339 GTGGAAGAAGGTCTGACAGCAGG - Exonic
1121820166 14:96959526-96959548 GTTGGAGAAGGTGAGCAGCCCGG - Intergenic
1123762055 15:23440866-23440888 GGAGAAGAAGATGTGGCGGCAGG - Exonic
1126943761 15:53794396-53794418 GTTGAAGAAAGTGGGAGGGCAGG - Intergenic
1131671619 15:94625899-94625921 GTTGAAGAAGGTCTGAAGGAGGG + Intergenic
1132395412 15:101469681-101469703 GGTGAGGACGGTGTGCAGGCTGG + Intronic
1132630732 16:915977-915999 GGTGCAGAAGGTGTGCAGGGTGG + Intronic
1132666170 16:1082251-1082273 GAAGAAGAGGCTGTGCCGGCAGG - Intergenic
1133913130 16:10083999-10084021 GTTGAAGAAGGAGGGTCGCCTGG + Intronic
1139157302 16:64459036-64459058 GCTGAAGAAGGTGTGGAGGAGGG + Intergenic
1140745753 16:77978806-77978828 GTTGAACAAGGTGTGTGAGCAGG - Exonic
1142291127 16:89194047-89194069 GAGGAAGATGGTGTGCGGGCGGG + Intronic
1152643422 17:81458342-81458364 GTTGAAGAGGGCGTCCCTGCTGG - Exonic
1162032397 19:7923134-7923156 GTTGAAGAAGGTGAGGATGCTGG - Exonic
1168463034 19:56577395-56577417 GTTGAGCAAGGTGTGCAAGCTGG - Exonic
927451075 2:23209984-23210006 ATTGAAAAAGGAGTGCCTGCTGG + Intergenic
927611083 2:24541247-24541269 GTTGAAGAAGGGGAGCCTGCAGG + Intronic
928050972 2:27995107-27995129 GTTGGAGAGGGTGTGGCTGCAGG + Intronic
929983105 2:46699217-46699239 GGTGAAGAAGGGGAGGCGGCAGG + Intronic
1170059654 20:12245785-12245807 GTTGAAGAAGGTCTGCATGCTGG + Intergenic
1175431465 20:58907339-58907361 GTTGAAGAAGGAGTGGGGGCTGG - Intronic
1179416411 21:41202226-41202248 GTTGAAGGTGGTGTGAGGGCTGG + Intronic
1179451122 21:41469101-41469123 GTGGGAGAAGGTGTGACGGAGGG - Intronic
1180249159 21:46568222-46568244 ATTGAAAGAGGTGTGCTGGCTGG + Exonic
1183513396 22:38249006-38249028 ACTGGAGAAGGTGTGCAGGCAGG - Intronic
950330915 3:12155508-12155530 GTTGCAGAAGGTATGCTGCCAGG - Intronic
955359811 3:58263636-58263658 GCTGGAGAAGGTGTGCCAGGAGG - Intronic
957976551 3:87453109-87453131 GTTGACGAAGGTGTGGAGGAAGG - Intergenic
967083127 3:186069350-186069372 CTTGAAGAAGTTGTGCCGTAAGG - Intronic
968452616 4:682336-682358 GCTGAAGAAGGTGCACAGGCCGG + Exonic
969628787 4:8323205-8323227 GCTGAAGAATGTGTGCAGGAAGG + Intergenic
982226647 4:153173168-153173190 GTTGAGGAAGGAGTGCTGGAAGG + Intronic
1002633896 5:180597797-180597819 GCTGAGGAAGGGGTGCTGGCAGG + Intergenic
1006055319 6:31379579-31379601 GCAGAAGAAGGTGTGGTGGCTGG - Intergenic
1006743008 6:36322672-36322694 GTTAAAACAGGTGTGCCAGCAGG + Intronic
1012298068 6:97549381-97549403 GTTGAAGCAGGTGTGGGGGGTGG + Intergenic
1013627980 6:111956681-111956703 GTTGAGGCAGGTGTGCAGACAGG + Intergenic
1018290281 6:162285898-162285920 GTTGATAAATGTGTGGCGGCGGG + Intronic
1024308155 7:47945425-47945447 GTTGAGGAAAGTGTGCAGGGAGG + Intronic
1026025718 7:66741839-66741861 GTTAAAGAGTGTGTTCCGGCCGG + Intronic
1027747815 7:82099743-82099765 GTTTAAGAAGGTATTGCGGCCGG - Intronic
1029201421 7:98841808-98841830 GTTCATGCAGGTGTGTCGGCAGG + Intergenic
1030353094 7:108511627-108511649 GGTGAAGAAGGTGTGGCTGAAGG + Intronic
1032128656 7:129212121-129212143 GAAGAAGGAGGTGTGCCCGCTGG + Exonic
1036293764 8:7518296-7518318 GATGAAGGAGGGGTGCGGGCAGG - Intergenic
1036328797 8:7802699-7802721 GATGAAGGAGGGGTGCGGGCAGG + Intergenic
1046661348 8:116950920-116950942 GCTGAAGTAGGTGTGCCGTGAGG + Intronic
1047406802 8:124592200-124592222 GTTAGAGAAGGTGTGCCTGAAGG - Intronic
1053391630 9:37740393-37740415 GTGGAAGAAGGTGGACCTGCTGG - Exonic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062177479 9:135171930-135171952 GCTCAAGCAGGTGAGCCGGCTGG - Intergenic
1203769854 EBV:44141-44163 GTTGAAGAAGGAGAGCTGGGTGG + Intergenic
1187674567 X:21702822-21702844 GTTAGAGGAGGTGTGCCGACAGG - Intergenic
1187755411 X:22520241-22520263 GATGATGAATGTGTGCCGACTGG + Intergenic
1196688411 X:118532482-118532504 GTTGAAGAAGGTGTGCCGGCCGG + Intronic
1199991478 X:152989927-152989949 GCTGAAGAAGGTGTGGCTGGGGG - Exonic
1200169444 X:154061724-154061746 GTTGAAGAGGGTGTGGAGACAGG + Intronic
1201539634 Y:15091745-15091767 GTTGAAGAAGTTTTGCAGGCCGG - Intergenic