ID: 1196688839

View in Genome Browser
Species Human (GRCh38)
Location X:118536961-118536983
Sequence AAGGAGAGCCGAATGACTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196688839 Original CRISPR AAGGAGAGCCGAATGACTAG GGG Intronic
901945666 1:12701645-12701667 CAGGAGAGCCGAGTGATTTGGGG + Intergenic
905045473 1:34996480-34996502 AAGGATAATTGAATGACTAGGGG - Intronic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
906175707 1:43770272-43770294 GAGGAGAGGGGAATGAGTAGGGG + Intronic
914872170 1:151484244-151484266 ATGGAGAGCTAAAAGACTAGTGG - Intergenic
923247216 1:232144313-232144335 AAGGGGTGCCGAATGACTCAAGG - Intergenic
924758306 1:246962170-246962192 AAGGAGAGGCTGCTGACTAGTGG + Intronic
1065918859 10:30373800-30373822 AGGGAGAGCCTGATGACAAGTGG + Intronic
1068311465 10:55282196-55282218 AAGGAGGGCAGCATGGCTAGAGG - Intronic
1071812423 10:89198169-89198191 GAGGAGACCTGAATGACAAGAGG - Intergenic
1075204765 10:120437310-120437332 AAGGAGGGCCGTTTGGCTAGGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1080310354 11:30883206-30883228 AGAGAGAGCTGAATGACAAGAGG + Intronic
1083883664 11:65560306-65560328 AGGGAGAGCCGAAGGTGTAGTGG + Intergenic
1084413533 11:69017404-69017426 CAGGAGATCAGAATGAGTAGTGG + Intergenic
1085031774 11:73275460-73275482 AAGGAGAGCCCATTGTCTAAGGG + Intronic
1086966202 11:93031132-93031154 AAGGGGAGACGAATGACTGATGG - Intergenic
1090975167 11:131673750-131673772 AAGGAGAGCCGAGAGAGTGGAGG - Intronic
1097378130 12:58862005-58862027 AAGGAGAGGGGAATGACTGACGG - Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106576325 13:30979058-30979080 AGGGAGAGCCTGAAGACTAGGGG - Intergenic
1106621765 13:31377306-31377328 AAGGGGGGGCGAATGACTAGAGG - Intergenic
1106875073 13:34063037-34063059 CAGGTGAGCCTAATGATTAGAGG - Intergenic
1107739511 13:43434345-43434367 AAGGAAGGCCGAAGGACTAGAGG - Intronic
1111321671 13:86637849-86637871 CAGGAGAGCCAAATTACAAGAGG + Intergenic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1127688695 15:61373477-61373499 AATGAGAGGCGAATAAATAGAGG + Intergenic
1129367994 15:75068765-75068787 AAGGAGGGCAGATTGAGTAGGGG + Intronic
1132135771 15:99337157-99337179 AATGAGTGGCCAATGACTAGGGG - Intronic
1132927646 16:2439590-2439612 AAGAATAGCCGACTGACCAGTGG - Intronic
1136088614 16:27903007-27903029 CAGGCGAGCCGAGTGACCAGAGG + Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1152094130 17:78263363-78263385 AACGAGATCCGAAAGATTAGAGG - Intergenic
1155824140 18:30417966-30417988 AAGGAGAGAGGGATGACCAGAGG - Intergenic
1157433143 18:47646590-47646612 AAGGAGAGACGGATGACTTCTGG + Intergenic
1165343896 19:35231597-35231619 AAGGAGGGCAGAATCACTTGAGG + Intergenic
928541197 2:32285029-32285051 AAGGAGACAAGAATGACTGGGGG + Intronic
931046022 2:58354088-58354110 AAAGAGAAGCGAATGACTATTGG - Intergenic
932502880 2:72199832-72199854 AAGGAAAGCAGGATGACTAATGG - Intronic
1168789783 20:568354-568376 AAGGAAAGCCGAATGGGGAGCGG - Intergenic
1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG + Exonic
1172135751 20:32685578-32685600 AAGGAGACCCCACTGACTTGGGG - Intergenic
1174931335 20:54818384-54818406 AAGGAATACAGAATGACTAGTGG + Intergenic
1175019423 20:55828575-55828597 ATGGAGCCCCGAATGACTTGTGG - Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
953062623 3:39439921-39439943 AAGGTGAGCTGCATGCCTAGAGG - Intergenic
954391290 3:50269322-50269344 AAGGAGAGCCGAAGGCGTGGGGG - Exonic
954717643 3:52534253-52534275 AAGGAGAGCACCAGGACTAGGGG - Intronic
963227657 3:142878625-142878647 AAGGCGGGCCGACTGACTTGAGG + Intronic
969392491 4:6900962-6900984 TAGGAGAGGCGAATGTCTAAGGG + Intergenic
970891472 4:21049756-21049778 AAAGAGTGTAGAATGACTAGGGG - Intronic
979083598 4:116375998-116376020 AATGAGAGCAGAATGTCTATTGG - Intergenic
980593638 4:134924790-134924812 ACAGAGAGCCAAATCACTAGTGG - Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
989304111 5:39931776-39931798 AAGGAGAGCCCAATCACCAGTGG - Intergenic
993364630 5:87020394-87020416 AAGGAGACCAGAATGAGTATGGG - Intergenic
995078328 5:108014890-108014912 AATGAGAGCCAAATGAACAGGGG + Intronic
996238124 5:121159250-121159272 AAGGAGAGTTGTTTGACTAGAGG - Intergenic
997510768 5:134452298-134452320 AAGGACAGCTGGCTGACTAGAGG + Intergenic
998784595 5:145695360-145695382 AAGGAGGCCTGAATGACTAGAGG + Intronic
998829749 5:146144576-146144598 AAGGTGAGCAAATTGACTAGGGG + Intronic
998888735 5:146723315-146723337 AAGGAAAGCTGAATGACTGACGG - Intronic
1004903863 6:20218221-20218243 GAAGAGAGCCTAATGAATAGGGG - Intergenic
1005306396 6:24518108-24518130 AAGGAGAGGGGAATTCCTAGAGG - Intronic
1006807195 6:36796388-36796410 AAACAGACCCAAATGACTAGTGG + Intronic
1010632922 6:78220692-78220714 GAGAAGAGCAGAATGAATAGGGG - Intergenic
1010775004 6:79875467-79875489 AAGAAGAGCAGCATGACTACAGG + Intergenic
1016724454 6:147346324-147346346 CAGGAGGACCGACTGACTAGAGG + Intronic
1032661449 7:133988468-133988490 AAGGCCAGCAGAATAACTAGAGG - Intronic
1033194942 7:139319702-139319724 AAGGAGACCAGAATAACTGGAGG - Intergenic
1038093449 8:24280717-24280739 AAGGAGAGTTGTTTGACTAGTGG + Intergenic
1038685613 8:29714793-29714815 CAAGAGAGCCTAAGGACTAGAGG - Intergenic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1053539641 9:38959937-38959959 AAGGAGAGCCGTGTGACAAATGG + Intergenic
1054626500 9:67403981-67404003 AAGGAGAGCCGTGTGACAAATGG - Intergenic
1054779595 9:69154391-69154413 GAGGAGAGCAGAATGAGTAGAGG - Intronic
1058154614 9:101501395-101501417 AAGAAGAGCCGCATGAAAAGAGG + Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1188772286 X:34167152-34167174 AAGGAGTCCAGAATGACTACTGG + Intergenic
1196688839 X:118536961-118536983 AAGGAGAGCCGAATGACTAGGGG + Intronic
1197013691 X:121598287-121598309 ACTGAGATCTGAATGACTAGTGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198879978 X:141269959-141269981 AACAAAACCCGAATGACTAGAGG + Intergenic
1199446260 X:147925878-147925900 AAGGAGAAAAGAATTACTAGTGG - Intronic
1199693623 X:150328044-150328066 AAGGACAGCCGCATGACTCAGGG + Intergenic
1201342553 Y:12950335-12950357 AAGGAGAGCAGCATGAACAGAGG - Intergenic
1202242264 Y:22783531-22783553 AAGGGGAGCCAGATGACTTGAGG + Intergenic
1202395248 Y:24417279-24417301 AAGGGGAGCCAGATGACTTGAGG + Intergenic
1202475537 Y:25252815-25252837 AAGGGGAGCCAGATGACTTGAGG - Intergenic