ID: 1196692111

View in Genome Browser
Species Human (GRCh38)
Location X:118571104-118571126
Sequence CACAAAAGGCTGGAACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196692111_1196692118 27 Left 1196692111 X:118571104-118571126 CCATGGGGTTCCAGCCTTTTGTG 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1196692118 X:118571154-118571176 CACGTCCAGATCTCTAAGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196692111 Original CRISPR CACAAAAGGCTGGAACCCCA TGG (reversed) Intronic
900731880 1:4267473-4267495 CTCACTAGGCTGGGACCCCAGGG + Intergenic
901884399 1:12212622-12212644 CACAAATGGGAGGAACCTCAGGG - Intergenic
905158035 1:36004034-36004056 CAAAGAAGGCTGGAGCCCCGTGG - Intronic
906187084 1:43870543-43870565 CATAAAAGGCCTGAAACCCAAGG + Intronic
909030240 1:70530606-70530628 CATAAAAGACTGGAACACCTGGG - Intergenic
910778601 1:90901844-90901866 CACAAAGGGCTGTAACCTTATGG - Intergenic
914448829 1:147772981-147773003 AAAAGTAGGCTGGAACCCCAAGG + Intronic
914778366 1:150759782-150759804 TCCAATAAGCTGGAACCCCAGGG + Intronic
915753218 1:158232290-158232312 CAGAAAAGGCTGGGACACAATGG + Intergenic
915808545 1:158880749-158880771 AAGAAAAGGCTGGAACCAAAAGG + Intergenic
916764272 1:167845247-167845269 CACCAAAGGATGGAATCCAAAGG - Intronic
917645777 1:177027249-177027271 CACCAAGGGCTAGAACACCAAGG - Intronic
919442744 1:197657758-197657780 CCCAAAAGGATTGAACCCAAGGG + Intronic
922129157 1:222759518-222759540 CACGGAAGCCTGGAACTCCAGGG - Intergenic
924791294 1:247251229-247251251 AAGAAAAGCCTGGAACCCAATGG - Intergenic
1062830690 10:603664-603686 CACAAAAGGCTGATACAACAGGG + Intronic
1063703064 10:8404252-8404274 CACCCAAGGCTGAAGCCCCAAGG - Intergenic
1065033207 10:21609565-21609587 CACAACATTCTAGAACCCCAGGG + Intronic
1065141600 10:22723653-22723675 CACAGAAGTCTGCAAACCCACGG + Intergenic
1065607231 10:27430375-27430397 GCCAAAAGGCTGGAGACCCATGG - Intergenic
1070784034 10:79152949-79152971 CCTAAAAGGCTGGACCCCCATGG - Intronic
1072629471 10:97135484-97135506 CACAAAAACCTGGAATCACAAGG + Intronic
1076409152 10:130233598-130233620 CACCACGGGCTGGAGCCCCAAGG - Intergenic
1077524883 11:3057930-3057952 CACAGAAGGCAGGAGCCCTAAGG - Intergenic
1082051590 11:47774694-47774716 CACTACAGGCTGGACCTCCAGGG - Intergenic
1082111257 11:48277424-48277446 AAGAAAAGCCTGGGACCCCATGG - Intergenic
1084566887 11:69934818-69934840 CACACAAGGCAGCAAGCCCAGGG + Intergenic
1087380179 11:97395604-97395626 AAGAAAAGCCTGGAACCCTATGG - Intergenic
1089351854 11:117825799-117825821 CAGAAAAGGCTGAAGCCCAATGG + Intronic
1090647139 11:128775483-128775505 TCCCCAAGGCTGGAACCCCAAGG - Intronic
1092090384 12:5798999-5799021 CACAGAAGGGAGGAAACCCAGGG + Intronic
1093421781 12:18982363-18982385 AACAAAAGGCAGGTAGCCCAGGG + Intergenic
1102772513 12:115490690-115490712 CAAAAAATGATGGGACCCCATGG - Intergenic
1105826768 13:24129911-24129933 AACCAAAGGCTGGGACCCCAGGG - Intronic
1106135173 13:26968281-26968303 CACAGAGGGCTGGAACAGCAAGG + Intergenic
1106835311 13:33627826-33627848 CAGAAAAGGCAGGAGCCCCACGG - Intergenic
1107338531 13:39381547-39381569 CAAACCAGGCTGGAACCCCATGG + Intronic
1109116755 13:58398321-58398343 CAAAAAAGGCTGTAACACTATGG - Intergenic
1112432716 13:99366264-99366286 CACAAGAGACTGGGTCCCCAAGG - Intronic
1114465264 14:22917934-22917956 CACGAAAAGCTGGAGCCCCAGGG + Intronic
1117484498 14:56180833-56180855 CACAACTGGCTGGAGCTCCAAGG - Intronic
1117633647 14:57720450-57720472 AAGAAAAGCCTGGAACCCAATGG - Intronic
1118042470 14:61932238-61932260 CACCAAATGCTGGAAACCAAGGG + Intergenic
1118751173 14:68808767-68808789 CAGGAAAGGCTGGAGCTCCATGG - Intergenic
1119191688 14:72687220-72687242 CACAAAAGGCTGAGACCTCCAGG + Intronic
1120543421 14:85779776-85779798 CATAAAATGCTGCAACCACAAGG - Intergenic
1121024227 14:90602623-90602645 CACTGAAGCCTGGAACCCCAGGG - Intronic
1121550688 14:94797362-94797384 CAAAAAAGGCTGGAATACAATGG + Intergenic
1123496089 15:20828382-20828404 CACAAAAGGCTGAGTCCCCTAGG + Intergenic
1123553323 15:21401948-21401970 CACAAAAGGCTGAGTCCCCTAGG + Intergenic
1123589568 15:21839336-21839358 CACAAAAGGCTGAGTCCCCTAGG + Intergenic
1125324708 15:38524934-38524956 CACTAAGGGCAGGAACCCCGAGG + Intronic
1128099954 15:64990188-64990210 CATCAAAGTCTGGAACCCAAAGG - Intronic
1128468348 15:67931265-67931287 CACATAATGCTTGAACTCCAAGG + Intergenic
1131571197 15:93538310-93538332 CACCAAAAGCTGGAAGCACAAGG - Intergenic
1202961671 15_KI270727v1_random:129168-129190 CACAAAAGGCTGAGTCCCCTAGG + Intergenic
1133235113 16:4384108-4384130 CATCAAAGGCAGGGACCCCATGG + Intronic
1135622819 16:23970426-23970448 CACAAAAGCCTGGAGCTCCCAGG - Intronic
1135827959 16:25746922-25746944 CACTGAAGCCTGGAACTCCAGGG + Intronic
1137250946 16:46740450-46740472 CAAAATAGGCTGGACCCCAAAGG + Intronic
1137738906 16:50745629-50745651 CACTAAAGCCTTGAACTCCAGGG + Intronic
1139272912 16:65700146-65700168 TACCAAGGGCTGGAACCCCCAGG + Intergenic
1141221691 16:82075738-82075760 AAGAAAAGGCTGGGACCTCATGG + Intronic
1142583652 17:957284-957306 CACAGAAGCCAGGAACCCCCCGG + Intronic
1142739132 17:1920385-1920407 AACAAAATGCTGGCAACCCAAGG - Intergenic
1145358843 17:22193270-22193292 CTCAAAAGGCTGGCAGCTCAGGG + Intergenic
1148143627 17:45345688-45345710 AACAAAAAGCTGGTTCCCCACGG - Intergenic
1150206108 17:63409245-63409267 CACCAAAGCCTGGAACCCCTGGG + Intronic
1150521910 17:65877338-65877360 CACAAAGAGCTGGAAGTCCAGGG + Intronic
1151564003 17:74887150-74887172 CACAGAAGGCTTGAACTCCCAGG + Intronic
1152253163 17:79222242-79222264 CACAAAGTGTTGGATCCCCAGGG - Intronic
1159168881 18:64736881-64736903 CACAAAATGCAGGCATCCCATGG + Intergenic
1160091170 18:75827882-75827904 CACAAATGGCAGGAGGCCCAGGG + Intergenic
1160820692 19:1056341-1056363 CAACAAAGGCTGGCACTCCATGG + Exonic
1165281870 19:34804588-34804610 CACAAAGGTCTGGAACTCTAGGG - Intergenic
1165330715 19:35140008-35140030 CACATAGGGCTTGAACCCAAGGG - Intronic
1165984899 19:39759425-39759447 CACTGAAGCCTCGAACCCCAGGG + Intergenic
1167159166 19:47756203-47756225 CACAACTGGCTGGAGCCCCACGG - Intronic
1168667265 19:58213785-58213807 CCCAAAGGGCTGGAAACCCCAGG + Intergenic
1202645200 1_KI270706v1_random:132941-132963 CCCACAAGCCTGGAAACCCATGG + Intergenic
927138557 2:20114570-20114592 GACAGAAGTCTGGAAGCCCATGG + Intergenic
927692463 2:25217726-25217748 CACTAAAGCCTGGAACTCCTAGG - Intergenic
929418589 2:41768483-41768505 CAAAAAAGGATGCATCCCCAGGG - Intergenic
933155267 2:78966064-78966086 CACTCAAGGCTGTAACGCCAGGG - Intergenic
933314440 2:80699338-80699360 CACAGCAGGCTCAAACCCCAGGG + Intergenic
934507602 2:94906527-94906549 CCCACAAGCCTGGAAACCCATGG + Intergenic
936010707 2:108923609-108923631 CAAGACAGGCTGAAACCCCAAGG - Intronic
936918045 2:117660085-117660107 CACAGAGGGCTGGAACCACAAGG + Intergenic
939838588 2:147158829-147158851 CCCAAGAGGGTGCAACCCCAGGG - Intergenic
940966818 2:159847405-159847427 CACTACAGACTTGAACCCCAGGG + Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
943918874 2:193676594-193676616 CACAAAAAGCTGGAGACCCTGGG - Intergenic
947398572 2:229711205-229711227 CACCAAAGGAGGGAACCCCTGGG + Intronic
947729171 2:232418717-232418739 CGCCAAAGCCAGGAACCCCAAGG - Intergenic
948427815 2:237898937-237898959 CACCAAAGGCAGAAACCACAAGG + Intronic
948613242 2:239182791-239182813 CGGAAAATGCTGGAACCACAAGG + Intronic
1169921785 20:10741938-10741960 GAGAAAAAGCTGGAACCCCAAGG + Intergenic
1170274341 20:14567031-14567053 CACAGAAGCCTGGAACTCCTGGG + Intronic
1170454238 20:16517668-16517690 AGCAAAAGTCAGGAACCCCAGGG + Intronic
1171895161 20:30751860-30751882 CCCACAAGCCTGGAAACCCACGG + Intergenic
1172633862 20:36396128-36396150 CCGGAAAGGCTGGAGCCCCAAGG + Intronic
1172889309 20:38252825-38252847 CACTACAGGCCTGAACCCCAGGG + Intronic
1172986087 20:38991263-38991285 CACAAAAGGCTTTAAACACAGGG - Intronic
1173133182 20:40413633-40413655 CACAAAAAGCAAGAAACCCAAGG + Intergenic
1173557137 20:43974164-43974186 CACTGCAGGCTGGGACCCCAGGG + Intronic
1173557169 20:43974286-43974308 CACTGAAGGCTGGGGCCCCAGGG + Intronic
1176606689 21:8839802-8839824 CCCACAAGCCTGGAAACCCATGG - Intergenic
1177247020 21:18539699-18539721 CACAGTAGGCTGGAACTCCTGGG - Intergenic
1178495844 21:33085708-33085730 CACAAAAGGCAGGGCTCCCATGG + Intergenic
1180356762 22:11849503-11849525 CCCACAAGCCTGGAAACCCATGG - Intergenic
1180381498 22:12142828-12142850 CCCACAAGCCTGGAAACCCATGG + Intergenic
1181719706 22:24764156-24764178 CAGAAGAGGCCGGGACCCCAGGG - Intronic
1183253719 22:36747335-36747357 CACAAAAGGCCAGAACTCCTGGG - Intergenic
1183766510 22:39881309-39881331 CACCAAAGTCTGGAAACACAGGG + Intronic
949474620 3:4431639-4431661 CAGAAAAGGCTGTAACATCATGG + Intronic
949701435 3:6763982-6764004 CACAAAAGGCTGGAAACTGCAGG - Intergenic
950162817 3:10772684-10772706 CAGGTGAGGCTGGAACCCCAGGG + Intergenic
951908302 3:27724321-27724343 CACAAAACGCAGGAAGCGCAGGG - Intergenic
952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG + Intronic
953579669 3:44142454-44142476 CACAATAGGCTGGAAGCCTGTGG - Intergenic
955078940 3:55639974-55639996 CACACAGGGCAGGAGCCCCAGGG + Intronic
956934661 3:74086885-74086907 CACTATAGCCTTGAACCCCAGGG + Intergenic
959065255 3:101649210-101649232 AGCAAAAGCCTGGAAACCCATGG - Exonic
959609502 3:108277988-108278010 CACAAAAGTCTGAAATCCGATGG + Intergenic
959974987 3:112448561-112448583 GCCAACAGGCTGGAAACCCAGGG + Intergenic
962010436 3:131385775-131385797 TGCTACAGGCTGGAACCCCAGGG - Intronic
963762764 3:149300756-149300778 CACAAAAGGCTGCAACCTGCAGG - Intergenic
965301772 3:167013400-167013422 CACTAAAGCCTTGAACCCCTGGG - Intergenic
966003354 3:174977665-174977687 CATACCAGGATGGAACCCCAGGG + Intronic
967135154 3:186506934-186506956 CAGAAAAGGCATGTACCCCAAGG + Intergenic
967324619 3:188226893-188226915 CATAAAAGGCTGGAAACCACTGG + Intronic
967655834 3:192047235-192047257 AAAAAAAGGCTGGGACCCAATGG + Intergenic
968848715 4:3063025-3063047 TACTAAAGGCTCCAACCCCAGGG - Intergenic
969066348 4:4484758-4484780 CACAATAGGCTGGAAAGACATGG + Intronic
969345405 4:6566787-6566809 CACAAAAGGGTGTGTCCCCAAGG + Intergenic
970174256 4:13322675-13322697 CACAAAAAGCTGAAATGCCATGG - Intergenic
971065065 4:23022143-23022165 CTCAAAAGGCTGGGAGCCCAAGG - Intergenic
973371423 4:49251355-49251377 CCCACAAGCCTGGAAACCCATGG + Intergenic
973389586 4:49543956-49543978 CCCACAAGCCTGGAAACCCATGG - Intergenic
975401545 4:73944454-73944476 CTGAAAAGTCTGGAACCCCCGGG + Intergenic
976928651 4:90534423-90534445 CACAAAAGGCTGGCACAGCCTGG - Intronic
977177090 4:93830379-93830401 CACACAAGGATGGATGCCCAGGG - Exonic
978235700 4:106456337-106456359 CCCAAAATGCTGGGACCACAAGG - Intergenic
983807848 4:172017647-172017669 CAGAAAGGTCTGGAACCCAAGGG + Intronic
1202750877 4_GL000008v2_random:4032-4054 CAAAAAAGGCTGGAACACAGTGG - Intergenic
985470321 5:38174-38196 CAGGAAACACTGGAACCCCAGGG + Intergenic
985876812 5:2606202-2606224 CATAAATGGCTGGGACTCCAGGG - Intergenic
991681420 5:69143619-69143641 CAAAAAAGCCTGGGACCCGATGG - Intergenic
994061755 5:95486408-95486430 CACTGAAGGCTGCAACCCTATGG + Intronic
997476287 5:134144446-134144468 CATAAAAGGCTGGATCTCCATGG + Intronic
1002332693 5:178455393-178455415 CACAGCAGGGTGGAACCCCAGGG + Intronic
1004551157 6:16648487-16648509 CAAAAAAGTTTGCAACCCCATGG + Intronic
1005345945 6:24890728-24890750 CACTAAAGCCTGGAACTCCTGGG + Intronic
1005346111 6:24892344-24892366 CACTAAAGCCTGGAACTCCTGGG + Intronic
1006107436 6:31724903-31724925 AAAAAAAGGCCTGAACCCCAAGG + Intronic
1007438476 6:41836000-41836022 CACAACAGCCTGGAACTCCTGGG - Intronic
1009371563 6:62909893-62909915 AAGAAAAGCCTGGAACCCAATGG + Intergenic
1009839521 6:69051062-69051084 CAAAAAAGGCTGGGATCCCTTGG - Intronic
1011077290 6:83450330-83450352 CACAAAAGGAGGGGACCCAAAGG - Intergenic
1012059546 6:94461798-94461820 AAGAAAAGTCTGGAACCCAATGG - Intergenic
1012977050 6:105792157-105792179 CACAAACGGGTGGTGCCCCAGGG - Intergenic
1013203313 6:107923234-107923256 CCCAAGTGGCTGGAACCACAGGG + Intronic
1013262680 6:108461802-108461824 CACAAAAGGCTGGCAGTGCACGG + Intronic
1016541746 6:145173547-145173569 CACCAAACACTGGAACCCCCAGG + Intergenic
1016735896 6:147479615-147479637 CACAAAAAGTGTGAACCCCAAGG + Intergenic
1016982492 6:149865215-149865237 CACAGAAGTCTAGAACGCCAAGG - Intergenic
1020332262 7:7031941-7031963 CACAAAAGTCTGGAACTCAAGGG + Intergenic
1020974130 7:14984330-14984352 CACTAATGTCTGGAACTCCAAGG + Intergenic
1020974156 7:14984592-14984614 GACAAAAGGACAGAACCCCAGGG - Intergenic
1022535419 7:31095579-31095601 CACATAACTCTGGTACCCCAGGG - Intronic
1022924104 7:35042955-35042977 CATAGAAGGCAGGAACCCTATGG + Intergenic
1024574626 7:50753850-50753872 AAGAAAAGGCAGGAAGCCCAAGG + Intronic
1027055907 7:75049241-75049263 CACAAAATGTTGGAACTACAGGG - Intronic
1028820595 7:95206882-95206904 ATCATAAAGCTGGAACCCCATGG + Intronic
1030488376 7:110200308-110200330 AAGAAAAGCCTGGAACCCAATGG - Intergenic
1031781594 7:125974711-125974733 CTCAAAAGGCTGGAATTTCAGGG + Intergenic
1039060120 8:33566432-33566454 CACAAAGGCCGGGAACCCCTCGG + Intronic
1039646272 8:39287155-39287177 CACAGAAACCTGGAAACCCATGG - Intergenic
1039789809 8:40866292-40866314 CACACAATGCTGGTGCCCCAGGG + Intronic
1040644836 8:49386641-49386663 CACAACAGGCAGGAATCTCAGGG - Intergenic
1041639566 8:60181958-60181980 AACACAAGGCTGGAGCCCGAGGG + Intergenic
1042032720 8:64494188-64494210 CAGAAAAGCCTGGGACCCTATGG + Intergenic
1042368327 8:67962284-67962306 AAGAAAAGGCTGGAACTCCTAGG - Intronic
1043592720 8:81848779-81848801 CACAAAAGTTTGGAACTCAAAGG + Intergenic
1044923199 8:97187339-97187361 CAAGACAGGCTGGAAACCCAAGG - Intergenic
1045551513 8:103176974-103176996 CACAACAGGCTAGAAACACATGG - Intronic
1046102287 8:109628985-109629007 CACAAAAGGCAGGAAAAACAAGG + Intronic
1046766468 8:118074904-118074926 CACAGAAGGCTGGAAGCTCAGGG + Intronic
1047192604 8:122691769-122691791 CACCAGAGGATGGAACTCCAAGG + Intergenic
1049535763 8:143181018-143181040 CACAAAAGGTGGCATCCCCACGG + Intergenic
1049603639 8:143519291-143519313 CCCCGAAGGCTGGAGCCCCAGGG - Intronic
1052113518 9:24619376-24619398 CCCTAAAGCCTGGAAACCCATGG - Intergenic
1053283775 9:36837910-36837932 CCCAACAGCCTGGAACCACAAGG + Exonic
1054353491 9:64040907-64040929 CCCACAAGCCTGGAAACCCATGG - Intergenic
1054357429 9:64074900-64074922 CACTGCAGCCTGGAACCCCAGGG - Intergenic
1056572105 9:87825181-87825203 CACAGCAGGCAGGACCCCCAGGG - Intergenic
1058618860 9:106862906-106862928 CACAAAACGCCGGAGCACCAGGG - Intergenic
1059320521 9:113464844-113464866 CAGAAGAGCCAGGAACCCCAGGG - Intronic
1061523239 9:131135163-131135185 CACAGAAGCCTGGAACTCCCAGG + Intronic
1203695848 Un_GL000214v1:96297-96319 CCCACAAGCCTGGAAACCCATGG + Intergenic
1203741822 Un_GL000218v1:10016-10038 CCCACAAGCCTGGAAACCCATGG - Intergenic
1203702012 Un_KI270742v1:4607-4629 CCCACAAGCCTGGAAACCCATGG - Intergenic
1203553994 Un_KI270743v1:190662-190684 CCCACAAGCCTGGAAACCCATGG - Intergenic
1203640425 Un_KI270751v1:7766-7788 CCCACAAGCCTGGAAACCCATGG - Intergenic
1186399884 X:9247955-9247977 CCCAAAATGCTGGAATCACAGGG - Intergenic
1188595431 X:31894224-31894246 AATAAATGGCTGGAACACCATGG - Intronic
1192239509 X:69318273-69318295 CAAAAGAGGCTGGAACTCCAAGG - Intergenic
1192975881 X:76284822-76284844 AAGAAAAGCCTGGAACCCAATGG - Intergenic
1196552762 X:117048970-117048992 CAAAAAAGCCTGGGACCCAATGG + Intergenic
1196692111 X:118571104-118571126 CACAAAAGGCTGGAACCCCATGG - Intronic
1197343092 X:125297728-125297750 CACAAAATGCTAGATGCCCAGGG + Intergenic