ID: 1196692170

View in Genome Browser
Species Human (GRCh38)
Location X:118571594-118571616
Sequence ACTAATATGTAGACCGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196692170 Original CRISPR ACTAATATGTAGACCGAGGA GGG (reversed) Intronic
904134332 1:28299707-28299729 ATTTATATGTAGAACCAGGATGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907887152 1:58603457-58603479 ACAAATATGGAGGCCGAGGTGGG - Intergenic
907935629 1:59039590-59039612 ACTAATTTGTAGAACAAGGAAGG + Intergenic
917098575 1:171423995-171424017 ACTAATATTGAGACAGAGTAGGG - Intergenic
919137105 1:193523708-193523730 TCTGATATGTAGACCTGGGATGG + Intergenic
1067768931 10:49109767-49109789 ACTAATGTGTAGCCAAAGGAGGG + Intronic
1069986136 10:72285406-72285428 AGTACTATGCAGACCGAGAAAGG - Intergenic
1071803980 10:89096404-89096426 TGTAATATGTAGACAGAGGGGGG + Intergenic
1080057893 11:27926315-27926337 AATTATATGTAAACCGAAGAAGG - Intergenic
1085758199 11:79219062-79219084 CCTAATGTGTGGACAGAGGATGG + Intronic
1085854583 11:80161744-80161766 ACTAATATGGTGACTGAGGTTGG - Intergenic
1086360532 11:86054373-86054395 TCTAAAATGAAGACGGAGGATGG + Intronic
1095054120 12:37580360-37580382 GCTACTATGTAGGCTGAGGAGGG + Intergenic
1098790398 12:74815605-74815627 ACTAATAGGGAGACAGAGGCAGG + Intergenic
1100809360 12:98323472-98323494 ACTACTAGGGAGACAGAGGAAGG - Intergenic
1101890363 12:108708750-108708772 AATAATAAATAGACCGAGCACGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107571895 13:41670291-41670313 ACTAATTTGAAGAATGAGGAAGG - Intronic
1108305334 13:49126231-49126253 CCTAAGATGTAGACAGAAGAGGG - Intronic
1117334081 14:54741993-54742015 TCTAATATGTAGACCTAAGCAGG - Intronic
1123178981 14:106449769-106449791 ACTTATATGTAGACGCAGCATGG + Intergenic
1130362513 15:83204453-83204475 ACTATTATGTAGATAGAGGGAGG + Intronic
1130850991 15:87793413-87793435 TCTTATTAGTAGACCGAGGAGGG - Intergenic
1138072878 16:54010450-54010472 ACTAATATGAAGAGTTAGGATGG - Intronic
1140492328 16:75348240-75348262 ACTATTTTGGAGACTGAGGAGGG - Intronic
1140800377 16:78482331-78482353 ACTACTACGGAGGCCGAGGAAGG - Intronic
1146385833 17:32372186-32372208 ACTACTCTGGAGACCGAGGCAGG + Exonic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1163121065 19:15218136-15218158 ATTAAAATGTAGGCCGAGCACGG - Intergenic
926156477 2:10457059-10457081 ACTAATACATATACCAAGGAAGG - Intergenic
931311839 2:61089218-61089240 ATTAATATGTAGGCCGGGCACGG + Intronic
936724323 2:115294252-115294274 ACTAGTAGGTTGACCTAGGAGGG + Intronic
938191513 2:129285951-129285973 ACTAATATCTAGACTGTGTAAGG - Intergenic
941254398 2:163210291-163210313 ACAAATATTCAGACCTAGGATGG + Intergenic
945272498 2:207955949-207955971 ACTATTGTGGAGATCGAGGAAGG + Intronic
1169935685 20:10880862-10880884 ACGAGTATGCAGACGGAGGAGGG + Intergenic
1170194873 20:13679719-13679741 AACAATTTGTAGACAGAGGATGG + Intergenic
1181114869 22:20625588-20625610 ACTACTAAGGACACCGAGGAAGG - Intergenic
1184135420 22:42546361-42546383 ACTACTCTGGAGACCGAGGTGGG + Intergenic
950463850 3:13141697-13141719 CCTGATATGTAGGTCGAGGAGGG - Intergenic
951665295 3:25116488-25116510 AACATTAAGTAGACCGAGGATGG - Intergenic
960886939 3:122405616-122405638 ACTATTAGGCAGACTGAGGAAGG - Intronic
965702627 3:171473651-171473673 ACAAATATTTAGGCCGAGGCGGG + Intergenic
984450426 4:179893944-179893966 ACTAATACGTAGACCAAGATGGG - Intergenic
986467949 5:8045734-8045756 ACCAATATGAAGACACAGGAAGG - Intergenic
988838599 5:35060310-35060332 ACAAATATGTAAAGCCAGGAAGG + Exonic
994071362 5:95606473-95606495 TCTAATATGTAGCCAGAGGTGGG + Intergenic
1000004750 5:157173027-157173049 AATAATATGTAAACGGAGGCAGG - Intronic
1003293772 6:4805738-4805760 ACAAAGAGGTAGACAGAGGAAGG - Intronic
1003477859 6:6501247-6501269 ACTAATAGGAAGCCCAAGGATGG + Intergenic
1004887445 6:20065092-20065114 ACTAAAATGTATTCCGAGGGGGG + Intergenic
1008279934 6:49584948-49584970 ATTAATATCTAGACCTAGGAAGG + Intergenic
1010226293 6:73492699-73492721 ACTACTATGGAGACAGAGGTGGG + Intronic
1012420816 6:99063410-99063432 ACTAATGTATAGACCTAGCATGG + Intergenic
1014099246 6:117491689-117491711 ACTAATATGTAGACCTTGTTTGG - Intronic
1016097955 6:140061255-140061277 AATAAGATGGAGACAGAGGATGG + Intergenic
1026154224 7:67813191-67813213 GCTACTCTGGAGACCGAGGAGGG - Intergenic
1027857669 7:83533430-83533452 ACTACTAGGTAGACTGAGGCAGG + Intronic
1029660072 7:101954419-101954441 ACAAATATTTACAACGAGGACGG - Intronic
1029881292 7:103813157-103813179 ATTAATATGTAGAAAGAGAAAGG - Intronic
1032872265 7:135998927-135998949 ACTACCATGTAGACCTAGAAAGG + Intergenic
1035874413 8:3172232-3172254 ACAAAAATGTAGAACAAGGAAGG - Intronic
1037222473 8:16541367-16541389 ACTAATGTGTAGGCATAGGATGG + Intronic
1043360572 8:79466994-79467016 ACTAAGATGGAGACAGAGGCAGG - Intergenic
1044405667 8:91823283-91823305 ACAGATATATAGACCGATGATGG + Intergenic
1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG + Intronic
1050002037 9:1087369-1087391 TCTAACATATAGACCCAGGAGGG + Intergenic
1050679376 9:8092222-8092244 ACATATATGTAGACAGAAGATGG - Intergenic
1052963951 9:34324734-34324756 ACTAAACTGTAGAGTGAGGAAGG - Intronic
1055402942 9:75943868-75943890 AATAATATGTAGGCCGAGTGTGG + Intronic
1058630523 9:106981970-106981992 ACTAAAATGTAGAGAGAGCAAGG + Intronic
1186700611 X:12086168-12086190 ACTAAAATGTAGGCAGAGGGAGG + Intergenic
1188727448 X:33603535-33603557 ACTAAGAAGTAAACTGAGGAGGG - Intergenic
1195146724 X:102026074-102026096 ACTAATATGAAGGCCCATGAGGG - Intergenic
1195509604 X:105699435-105699457 ACTAGAATGTAGATCTAGGAAGG - Intronic
1196692170 X:118571594-118571616 ACTAATATGTAGACCGAGGAGGG - Intronic
1201245998 Y:12004310-12004332 ACTACTCTGTAGACTGAGGTAGG + Intergenic