ID: 1196695309

View in Genome Browser
Species Human (GRCh38)
Location X:118605340-118605362
Sequence ACTCACATGGTGCAGTTGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196695309 Original CRISPR ACTCACATGGTGCAGTTGAT AGG (reversed) Exonic
904596817 1:31651980-31652002 ACTGACAAGGTGAAGTGGATGGG + Intergenic
909382055 1:75009927-75009949 ACTATCATGGTGGAGTTGAAGGG - Intergenic
910222478 1:84901689-84901711 ACACATATTGTGTAGTTGATGGG - Intergenic
913963425 1:143355845-143355867 ACAGACATGGTGCAGGTGAAAGG + Intergenic
914057781 1:144181434-144181456 ACAGACATGGTGCAGGTGAAAGG + Intergenic
914121365 1:144784931-144784953 ACAGACATGGTGCAGGTGAAAGG - Intergenic
923270110 1:232347835-232347857 AAACACATGGTGCAGTTGAAGGG + Intergenic
1067750947 10:48970505-48970527 ATTCCCATGGTGCATTTGACAGG + Intronic
1068275273 10:54787122-54787144 AATCACATAATGCAGTTAATTGG + Intronic
1069709446 10:70479231-70479253 ACTCACAGGGAGCAGTTGCTGGG + Intronic
1070437068 10:76403791-76403813 AGTCACATGGTGCAGTGAAAGGG + Intronic
1074536508 10:114331972-114331994 ACTCACAGGGTGCATGTGACCGG - Intronic
1075815823 10:125264220-125264242 ACTCCCAGGGTGCAGCTGCTGGG + Intergenic
1078961444 11:16277308-16277330 CCTCACATGGTGGAGTGGGTGGG - Intronic
1083846163 11:65334686-65334708 ACTCACAGGAAGCAGTTCATAGG - Intronic
1088828001 11:113512010-113512032 TCTCACATGGTGCTGTTCCTGGG - Intergenic
1089122933 11:116152778-116152800 ACTCAGAAGGTCCAGTTGCTGGG - Intergenic
1092702650 12:11249144-11249166 ACTGACATGTTGCATTTGGTCGG - Intergenic
1092948517 12:13478828-13478850 ACCCACATGGTGTGATTGATTGG + Intergenic
1093338532 12:17940821-17940843 ACACACACGGAGAAGTTGATTGG - Intergenic
1093963166 12:25297819-25297841 GCTCACAGGGAGCAGATGATTGG + Intergenic
1095792131 12:46178827-46178849 ACTCATATGTTGCAATGGATGGG - Intergenic
1097637324 12:62138690-62138712 ACTCACAGGCTGCATTTAATTGG - Intronic
1104000475 12:124856865-124856887 CCTCACTTGGTGCCTTTGATTGG + Intronic
1108282811 13:48876309-48876331 ACTGTCTTGGGGCAGTTGATTGG - Intergenic
1111823760 13:93243931-93243953 ACTCAGATGTTGCTGGTGATGGG + Intronic
1112998776 13:105606893-105606915 ACTAAAATGGTGGATTTGATGGG + Intergenic
1116432556 14:44863834-44863856 AGAACCATGGTGCAGTTGATAGG + Intergenic
1117271966 14:54153878-54153900 AGTCACATGGTACATTTAATTGG - Intergenic
1120225718 14:81789198-81789220 AATCACCTGGTGGAGGTGATTGG + Intergenic
1125902795 15:43364447-43364469 ATTCTCATGATGCAGATGATAGG - Intronic
1126458847 15:48894346-48894368 ACTTTCATTGTGCACTTGATCGG + Intronic
1126882653 15:53115918-53115940 ACTCACAGGGTGCATTTGCTTGG + Intergenic
1129022771 15:72537827-72537849 ACTCACATATGGCAGTTTATGGG - Intronic
1132295016 15:100728519-100728541 GGTCACATGATGCATTTGATGGG - Intergenic
1145977997 17:28995461-28995483 AATCAGATGGTGTAGATGATGGG - Intronic
1147569469 17:41559656-41559678 ACTCACAGAGTGCATCTGATTGG + Intergenic
1152189720 17:78881115-78881137 GCACACAAGGTGCAGATGATCGG - Intronic
1156162641 18:34377986-34378008 AATTACATTGTGAAGTTGATGGG - Intergenic
1156667316 18:39424248-39424270 ACTCACAGAGTGCTGTTGAGTGG + Intergenic
1158704274 18:59777497-59777519 ATTCATATTGTACAGTTGATTGG + Intergenic
1159316307 18:66778193-66778215 ACACACATGGTCCAGTTAATGGG + Intergenic
1159463603 18:68751003-68751025 AGTCACATGGTGCAGCTAAGGGG + Intronic
1164098050 19:22029481-22029503 ACTCACATCAAACAGTTGATGGG + Intergenic
1164118589 19:22245462-22245484 AGTCAAATGAAGCAGTTGATGGG + Intergenic
1164201675 19:23024308-23024330 AGTCAAATGAAGCAGTTGATGGG + Intergenic
1202697264 1_KI270712v1_random:134102-134124 ACAGACATGGTGCAGGTGAAAGG + Intergenic
930141194 2:47953057-47953079 ACTCAACTGCTGCAGTGGATGGG - Intergenic
931423287 2:62148007-62148029 ACTTACATGGTAGAGTTTATGGG - Intergenic
934278433 2:91591127-91591149 ACAGACATGGTGCAGGTGAAAGG + Intergenic
936806702 2:116341762-116341784 GCTAACATGCTGAAGTTGATGGG + Intergenic
936927698 2:117754580-117754602 ACACACATGCTGGAGTTGGTGGG + Intergenic
937622803 2:124008434-124008456 ACTTACAGGGTGCATTTGAAAGG - Intergenic
937710371 2:124974078-124974100 AGTCACATGGTCCAGTAGAAAGG - Intergenic
941070233 2:160946944-160946966 TCCCACATGTTCCAGTTGATTGG - Intergenic
941089165 2:161154623-161154645 ACTCACATGATGTACCTGATTGG + Intronic
1171096120 20:22333692-22333714 ACTCAAATGGTGCTTTTGAATGG + Intergenic
1172657879 20:36548085-36548107 AGGAACATGGTGAAGTTGATGGG - Exonic
1175738083 20:61400864-61400886 GCTCACAAGGTGCAGATGAAAGG - Intronic
1178537005 21:33418652-33418674 AATTACATGGAGCACTTGATGGG + Intronic
1183417425 22:37690653-37690675 ACTTACATGGAGCAGTAGCTGGG - Intronic
950799824 3:15541343-15541365 TCTCCCATGGTGCAGATGGTGGG - Intergenic
953242707 3:41163839-41163861 ACTCAAATTGTGCATTTGTTTGG - Intergenic
957005352 3:74939246-74939268 AAGCACATAGTGCTGTTGATGGG - Intergenic
965490778 3:169333282-169333304 TTTGACATGGTGCAGTTGATGGG - Intronic
965834667 3:172838221-172838243 ACTCAGGTGGTGGAGTGGATAGG - Intergenic
966442233 3:179958428-179958450 ACCTACATGGTGAAGTTGTTGGG + Intronic
968205715 3:196798211-196798233 ACTGACAGGGGGCAGTGGATGGG + Intronic
968451932 4:679970-679992 AGAAACATGGTGAAGTTGATGGG - Exonic
969032321 4:4225241-4225263 ACAGACATGGTGCAGGTGAAAGG - Intronic
970082366 4:12301940-12301962 ACCCACATGGAGGAGTGGATGGG - Intergenic
971156293 4:24086757-24086779 ACACATATTGTGCATTTGATGGG + Intergenic
971865416 4:32164293-32164315 ACTCAAATCCTGCAGTTGACTGG - Intergenic
975827912 4:78339071-78339093 ACTCACATCCTACAGCTGATAGG - Intronic
976089176 4:81438039-81438061 ACCCTTATGGTGCAGTTGCTGGG - Intronic
976864789 4:89711089-89711111 CTTCACCTGCTGCAGTTGATTGG + Intergenic
979679114 4:123440106-123440128 ACTCTCATGGTGTATTTTATAGG - Intergenic
982693090 4:158570379-158570401 ACTCACATGGTGAAGCTCTTGGG + Intronic
986119190 5:4815022-4815044 ACACACATGGGCCAGTTGAAGGG - Intergenic
997973436 5:138423488-138423510 ACTCACCTGTTTCAGCTGATGGG - Intronic
1018555384 6:165044402-165044424 ACTCACAAGGTGCATGTGATAGG - Intergenic
1021773146 7:24025221-24025243 ACTCATTTGGTACAGTTGTTGGG + Intergenic
1023519457 7:41035880-41035902 CCTCACATGATGCAGCTCATAGG + Intergenic
1030022645 7:105291123-105291145 ACTCAGATGGTGCACATGATAGG - Intronic
1030532802 7:110731001-110731023 AAACACATGTTGCAGCTGATGGG + Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1038865578 8:31435617-31435639 TCTCAGATGATGCAGCTGATAGG + Intergenic
1044585097 8:93862325-93862347 TCTCACATGCATCAGTTGATAGG - Intronic
1047619950 8:126596218-126596240 ACTCACATGGTGCTGGTTTTTGG + Intergenic
1048606302 8:135972033-135972055 ACTCACTTGGGGCAGCTGAAAGG - Intergenic
1048712286 8:137225757-137225779 AGTCACATGCTGCATATGATGGG + Intergenic
1048978302 8:139687809-139687831 AATCACATGGAGAAGTGGATGGG - Intronic
1051974875 9:22937518-22937540 ATTCACATGGTGAAGTGGAGGGG - Intergenic
1059456758 9:114404588-114404610 ACACACATAGTGAAGTTGACTGG - Intronic
1203442925 Un_GL000219v1:28240-28262 AGTCACATAGTCTAGTTGATGGG + Intergenic
1203513733 Un_KI270741v1:147149-147171 AGTCACATAGTCTAGTTGATGGG + Intergenic
1187096852 X:16157762-16157784 AGTCACATGGGGAAGTTGAGTGG + Intergenic
1187996142 X:24928964-24928986 ACCCACATGGAGCAATTTATCGG - Intronic
1196239154 X:113320181-113320203 ACACACAGGGTGAAGTTGAAAGG + Intergenic
1196695309 X:118605340-118605362 ACTCACATGGTGCAGTTGATAGG - Exonic
1198083524 X:133262064-133262086 AAGCACATGTTGTAGTTGATAGG + Intergenic
1199492643 X:148418041-148418063 AGCCACAAGGTGTAGTTGATCGG - Intergenic