ID: 1196695436

View in Genome Browser
Species Human (GRCh38)
Location X:118606681-118606703
Sequence TTTGCGGGCATCGCTGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196695429_1196695436 8 Left 1196695429 X:118606650-118606672 CCAGCAGGCCTCACACCACAGCC 0: 1
1: 1
2: 3
3: 109
4: 752
Right 1196695436 X:118606681-118606703 TTTGCGGGCATCGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 54
1196695431_1196695436 -7 Left 1196695431 X:118606665-118606687 CCACAGCCACACACCATTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1196695436 X:118606681-118606703 TTTGCGGGCATCGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 54
1196695428_1196695436 14 Left 1196695428 X:118606644-118606666 CCTCTTCCAGCAGGCCTCACACC 0: 1
1: 0
2: 3
3: 28
4: 285
Right 1196695436 X:118606681-118606703 TTTGCGGGCATCGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 54
1196695430_1196695436 0 Left 1196695430 X:118606658-118606680 CCTCACACCACAGCCACACACCA 0: 1
1: 2
2: 49
3: 220
4: 1296
Right 1196695436 X:118606681-118606703 TTTGCGGGCATCGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 54
1196695427_1196695436 20 Left 1196695427 X:118606638-118606660 CCACAACCTCTTCCAGCAGGCCT 0: 1
1: 0
2: 3
3: 25
4: 391
Right 1196695436 X:118606681-118606703 TTTGCGGGCATCGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196695436 Original CRISPR TTTGCGGGCATCGCTGCTGT TGG Intronic
924056438 1:240128764-240128786 TTTCCGGGACTGGCTGCTGTTGG - Intronic
1072487298 10:95868017-95868039 TATACTGTCATCGCTGCTGTTGG + Exonic
1077117306 11:890971-890993 TGTGCTGGCAGCGCTGCTCTTGG + Intronic
1084609461 11:70193053-70193075 TTTGGGGTCATGGCTGCTGTAGG + Intergenic
1088223159 11:107590972-107590994 TCTGCGGACCCCGCTGCTGTGGG - Intergenic
1096859211 12:54511342-54511364 TTGGCAGGCTTCCCTGCTGTTGG + Intronic
1103740663 12:123089158-123089180 CTTTCGGGCACAGCTGCTGTAGG + Intronic
1122238845 14:100348550-100348572 TTTCCAGGCAGTGCTGCTGTTGG - Intronic
1122948337 14:105024944-105024966 TTTGCTGGCATTTCTGCGGTTGG + Intergenic
1129457542 15:75683724-75683746 CTTGCGGGCAGAGCTGCAGTGGG + Intronic
1137928212 16:52562073-52562095 TTTCCGGGCACTGCTGCAGTGGG - Intergenic
1138670727 16:58612165-58612187 ATTGCTGGCATCAGTGCTGTGGG - Intronic
1142266385 16:89065725-89065747 CTTGGGGGCATGGCTGCCGTGGG + Intergenic
1144969556 17:19099129-19099151 TTTGAAGGCAACACTGCTGTGGG + Intergenic
1144978360 17:19152935-19152957 TTTGAAGGCAACACTGCTGTGGG - Intronic
1144989861 17:19225298-19225320 TTTGAAGGCAACACTGCTGTGGG + Intronic
1146445743 17:32931605-32931627 TTTGCAGGCAGCGCTACTGCCGG + Exonic
1148128865 17:45250721-45250743 TTTGTGGCCATGGCTGCTGCTGG + Intergenic
1150197660 17:63317634-63317656 TTTGGGGGCTTGGCAGCTGTTGG - Intronic
1152091551 17:78250370-78250392 GGTGGGGGCATCTCTGCTGTTGG + Intergenic
1154033531 18:10775635-10775657 TTTGGGGGCATCGTTGCTTAAGG - Intronic
1159086922 18:63803546-63803568 TTTGTGGGCAGCGATGCTGTTGG + Intronic
1161355442 19:3816830-3816852 CTGGGGGGCAACGCTGCTGTGGG + Exonic
1165012634 19:32859813-32859835 TGCCCGGGCATCGCTGCTGGCGG - Intronic
1165587410 19:36931042-36931064 TATGTGGGCATCTCTGCTTTGGG + Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
931021464 2:58048820-58048842 TTTGGTGGCATCACTTCTGTTGG - Exonic
936786423 2:116098965-116098987 TTTGTGGGAATCTCTGCTTTTGG - Intergenic
939906202 2:147919055-147919077 TTTGCGGGCATGACAACTGTTGG - Intronic
943453950 2:188079464-188079486 ATTGCTAGCATCCCTGCTGTAGG + Intergenic
1178781725 21:35609739-35609761 TTTGGGGGCACCTCTGCTGTAGG - Intronic
1182512534 22:30829197-30829219 TTGGCGTGCAGGGCTGCTGTGGG + Intronic
951906314 3:27711693-27711715 TTTGCCGGGATAGGTGCTGTTGG + Intergenic
953593173 3:44280673-44280695 TTTGCAACCATCACTGCTGTGGG - Intronic
953684638 3:45067057-45067079 TTTGAGGGCATCACTGCTGCTGG - Intergenic
954645657 3:52130100-52130122 TTTGCCAGCATAGCTGTTGTGGG - Intronic
955520423 3:59770431-59770453 TTTGCGTGCATGGCAGCTGCTGG - Intronic
962327497 3:134447899-134447921 TGTGAGGGCATCTCTGCTGCCGG - Intergenic
962349326 3:134645055-134645077 TTGGCTGGCATAGCTGCTGTGGG + Intronic
967340625 3:188393339-188393361 TTTGGGGGCTTCCCTGCTTTAGG - Intronic
969140030 4:5061617-5061639 TTTGCAGGCATCTGTGCTATAGG + Intronic
969665120 4:8552989-8553011 CATGCCAGCATCGCTGCTGTGGG + Intergenic
983261737 4:165464267-165464289 TTTTAAGGCATCGCTGCTGGAGG + Intronic
984259390 4:177426675-177426697 TTTGCGTGCATCTCAGCTGAGGG + Intergenic
985179537 4:187241617-187241639 TTTGCGAGCCTAGCTGCTGAAGG - Intergenic
985695231 5:1336342-1336364 TTTGGGGGAAAAGCTGCTGTCGG + Intronic
994163190 5:96579899-96579921 TTTTCAGGCACCGCTGCCGTGGG + Intronic
999699543 5:154215727-154215749 TCTGTGTGCATCGCTGCTGCAGG + Intronic
1005734134 6:28729953-28729975 TTTCCGTGCATCTCTGCTTTAGG + Intergenic
1015872160 6:137788020-137788042 TTTGCTGGCATCACTTCTTTTGG - Intergenic
1018460242 6:163991484-163991506 TTTGCTGGCATCCCTGCCATTGG + Intergenic
1018803958 6:167244342-167244364 TTTGCGTGCAGGGCTGCTGACGG + Intergenic
1032795140 7:135270587-135270609 TTTGGGGTCATCACTGCCGTGGG - Intergenic
1035254515 7:157617729-157617751 TCTGAGGGCATTGCTGCTGGAGG - Exonic
1037121884 8:15298460-15298482 TCTGCTGCCATCGCTGTTGTGGG + Intergenic
1046646436 8:116791135-116791157 TGTGCGGGCATCACTACAGTAGG + Intronic
1049505704 8:142995931-142995953 TTTGTGGGCAATGGTGCTGTTGG + Intergenic
1062534158 9:137014282-137014304 GTCGCAGGCATCGCTGCAGTCGG - Exonic
1186220468 X:7344363-7344385 TTTGTGGTCATAGCTGCAGTGGG - Intronic
1196695436 X:118606681-118606703 TTTGCGGGCATCGCTGCTGTTGG + Intronic