ID: 1196697619

View in Genome Browser
Species Human (GRCh38)
Location X:118630381-118630403
Sequence TACTCCTTGTAGAACTCTGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196697619_1196697620 1 Left 1196697619 X:118630381-118630403 CCGACAGAGTTCTACAAGGAGTA 0: 2
1: 0
2: 0
3: 5
4: 122
Right 1196697620 X:118630405-118630427 TGTATCCCAGTATAACCGCCTGG 0: 1
1: 1
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196697619 Original CRISPR TACTCCTTGTAGAACTCTGT CGG (reversed) Exonic
902456902 1:16539931-16539953 TACTCCTTAAAGAACTTTCTGGG - Intergenic
902484328 1:16733246-16733268 TACTCCTTGAAGAACTTACTGGG + Intergenic
902495267 1:16867982-16868004 TACTCCTTAAAGAACTTTCTGGG + Intronic
904976168 1:34458379-34458401 TACTTCTTGGAAACCTCTGTGGG - Intergenic
910666715 1:89733178-89733200 TACTCCCTTTAAAACTCTTTAGG + Intronic
917199377 1:172499063-172499085 TACTCCTTGCAGCTCTCTGAAGG - Intergenic
917680489 1:177361205-177361227 AACTCGTTGTATAACTCTGATGG + Intergenic
918991985 1:191708530-191708552 TAAACTTTGTAGAACTTTGTAGG + Intergenic
920370154 1:205473631-205473653 TCCTCCTTGTAGAATACTCTGGG + Intergenic
921816356 1:219568519-219568541 TTTTCCTTGTAGGACTCTGTAGG - Intergenic
924115114 1:240737678-240737700 TACTCATTGAATAATTCTGTGGG + Intergenic
924475694 1:244380418-244380440 TACTCATTTTAAAAGTCTGTTGG - Intronic
924826279 1:247542366-247542388 AACTCCTTGTAGAATACTGGTGG + Intronic
1063416940 10:5881312-5881334 TACTCTTTGTTGAAATCTTTAGG + Intronic
1063903331 10:10758355-10758377 AATTCCTTATAGAACTCTGAAGG - Intergenic
1068418524 10:56759008-56759030 TAGTACTTCTAGAACTATGTTGG - Intergenic
1068985227 10:63101989-63102011 TACTCATTGTAGTACTCTTCAGG + Intergenic
1072178420 10:92953377-92953399 TACTACTTTTAAAAATCTGTGGG - Intronic
1078261016 11:9708865-9708887 AACTGCTTGTAGAACTCAGTAGG - Intronic
1080722905 11:34867183-34867205 AATTCCTTGTAGACCTCTTTAGG - Intronic
1085126107 11:74003824-74003846 CACCCCTTGTAGAAGGCTGTGGG + Exonic
1086199692 11:84186617-84186639 TAATATTCGTAGAACTCTGTGGG - Intronic
1087750467 11:102001802-102001824 CACTCTTTGTAGAATTGTGTAGG + Intergenic
1088018221 11:105086024-105086046 TTCTCCTTGTAGAGATCTTTTGG - Intronic
1092403579 12:8198636-8198658 TACTCCCAGTGGAACACTGTGGG - Intergenic
1094246710 12:28305358-28305380 TACTCCTTATGGCACTGTGTTGG + Intronic
1107633801 13:42371503-42371525 TACTAATTGTACATCTCTGTGGG + Intergenic
1108938151 13:55912320-55912342 TATTTCTTTTAGAAATCTGTGGG + Intergenic
1113298416 13:108987748-108987770 GACTACTTGGAGAACTCTCTAGG + Intronic
1115153516 14:30312734-30312756 GCCTCCTTGGAGAAGTCTGTAGG + Intergenic
1116089536 14:40287294-40287316 AATTCCTTTTAAAACTCTGTGGG + Intergenic
1116432469 14:44862736-44862758 TACTCCTTGTAGAACTCTGTCGG + Intergenic
1123686963 15:22805383-22805405 TCCTTCTTAGAGAACTCTGTAGG + Intronic
1126131115 15:45342586-45342608 TTCTCCTTTTAAACCTCTGTAGG + Intergenic
1128256376 15:66200426-66200448 CACTCCTTGTAAGACTCTCTAGG + Intronic
1128365806 15:67001571-67001593 TATTTCTTTTAAAACTCTGTGGG - Intergenic
1130601690 15:85279435-85279457 TACTCCATGGAGCACTCAGTAGG + Intergenic
1135080063 16:19426529-19426551 CACTCCTAGTAGATCTCAGTGGG + Intronic
1140918832 16:79518416-79518438 TACATCTTGTAGAACTCTCATGG + Intergenic
1142221815 16:88858772-88858794 TACACCTTGTAGTCCTCCGTGGG - Exonic
1150716518 17:67576924-67576946 TACTCCTGTTTTAACTCTGTTGG + Intronic
1152372043 17:79894698-79894720 TGCTCCTTGGGGAACTCTGGTGG + Intergenic
1155593242 18:27452595-27452617 TTCAACTTGAAGAACTCTGTAGG + Intergenic
1155907984 18:31475562-31475584 TACTGTTTGTAGAACTCATTTGG - Intronic
1156409706 18:36816190-36816212 TAATCCTTTTAGACCTCTGATGG + Intronic
1157027064 18:43857554-43857576 TACTCCTTGTACAAATTTATGGG + Intergenic
1160355258 18:78222264-78222286 TACTCCCTGTAGAACAATGTAGG - Intergenic
1162265504 19:9570473-9570495 TAATCCTTGAAAAGCTCTGTTGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166563984 19:43752362-43752384 AACTGTTTGTAGAACTCAGTGGG + Intronic
1202707851 1_KI270713v1_random:36581-36603 TACTCCTTGAAGAACTTACTGGG - Intergenic
925256055 2:2489683-2489705 TACTCCTTGTACAGGACTGTGGG + Intergenic
928226962 2:29458112-29458134 TACACATTGTAAAACACTGTGGG - Intronic
932361195 2:71107444-71107466 TTTTCCTTGTTCAACTCTGTTGG + Intergenic
936648334 2:114397605-114397627 TACTCCATTTTGAACTTTGTGGG - Intergenic
936932116 2:117800593-117800615 GAATCCTCGTACAACTCTGTGGG + Intergenic
941285772 2:163610793-163610815 GACTCTGTGTAGATCTCTGTTGG + Exonic
944818542 2:203404901-203404923 TAGTCCTATGAGAACTCTGTAGG + Intronic
948305317 2:236942516-236942538 TAATCTTTGTAGAACTATTTGGG + Intergenic
948329617 2:237154806-237154828 TGCTCCTTCTAGAAATCTGGTGG - Intergenic
1169964931 20:11206170-11206192 TACTCCTTATAGAAAGCTGCTGG - Intergenic
1178116626 21:29424430-29424452 CACTCCTTGTACAATTCTGTAGG + Intronic
1181923378 22:26338259-26338281 TAATCCCTGCAGAACTCTGCAGG + Intronic
1183747044 22:39698019-39698041 CACTCTTTGCAGACCTCTGTGGG + Intergenic
1185342030 22:50295459-50295481 TAGTCCTTGTAAACCTCTGGGGG - Intronic
951681992 3:25304573-25304595 TAATCCTTCCACAACTCTGTGGG + Intronic
953412939 3:42700595-42700617 TACTCCTTCTAGAACACGGCTGG - Intronic
959875494 3:111377685-111377707 TTTTCCTTGTAGAGGTCTGTTGG - Intronic
960121805 3:113954517-113954539 TACACCTTGTAGATATTTGTGGG + Intronic
960494164 3:118355089-118355111 TACTCCTGGGGGGACTCTGTGGG - Intergenic
961331492 3:126144160-126144182 TTTTCATTGTACAACTCTGTTGG - Intronic
962724522 3:138209869-138209891 GACACCTTGTAGAACTTTCTGGG - Exonic
964450656 3:156809640-156809662 TTCGACTTGTAGAACTCTGGAGG + Intergenic
965664096 3:171073627-171073649 CATTCCTTGTAGAAATTTGTTGG - Intronic
967347721 3:188476945-188476967 AACTCCTTTGAGAACTCTCTGGG - Intronic
967353205 3:188538025-188538047 TACTCTTTGTAGATATCTGGTGG - Intronic
969762485 4:9199156-9199178 TACTCCCAGTGGAACACTGTGGG + Intergenic
970525846 4:16931284-16931306 TACTCCTGTTAGAAGTCTGCCGG - Intergenic
974820282 4:67058677-67058699 TGCTCCTTGTTGCTCTCTGTTGG - Intergenic
977061972 4:92271044-92271066 TACACCTTGCAGATCTCTGCAGG - Intergenic
982964833 4:161892527-161892549 TAAACCTTGTAGAAGTCTATAGG + Intronic
985180013 4:187249993-187250015 AATTCATTGTAGATCTCTGTTGG + Intergenic
985641463 5:1065282-1065304 TTCTCCTGGAAGAACTTTGTGGG - Exonic
986544409 5:8879887-8879909 TACCCCTTGTAGAACTGTGGTGG - Intergenic
987891943 5:23890381-23890403 TTTTCATTGTAGACCTCTGTAGG - Intergenic
988105590 5:26742367-26742389 TACCTCTTTTAAAACTCTGTAGG - Intergenic
988439079 5:31211601-31211623 TAATAGATGTAGAACTCTGTTGG - Intronic
995366538 5:111367815-111367837 TACTCCTTGAAGAAGTCCATAGG - Intronic
997466816 5:134093758-134093780 CACTCCCCCTAGAACTCTGTGGG - Intergenic
1000784332 5:165525277-165525299 TACTCCTTTTTGATCTTTGTAGG - Intergenic
1001077040 5:168637713-168637735 TTCTCCTTCTAGAATTCTCTTGG + Intergenic
1001711738 5:173784346-173784368 GACTCCTTGGAGAACTCTTGGGG + Intergenic
1002334271 5:178467275-178467297 CTCTCCTTGTAGAAATGTGTGGG + Intronic
1002401925 5:178995772-178995794 TTCTCCTTGCAGAACCCTGCAGG + Intronic
1003669857 6:8147099-8147121 AACTCACTCTAGAACTCTGTGGG + Intergenic
1003759971 6:9168509-9168531 TATACTTTGTAAAACTCTGTTGG + Intergenic
1006230652 6:32583818-32583840 TTATCCTTGGAGACCTCTGTGGG - Intronic
1011226872 6:85117565-85117587 CACTGATTTTAGAACTCTGTAGG + Intergenic
1014197615 6:118577441-118577463 CACCCCTTGTGGAACTCTGATGG - Intronic
1019853227 7:3580090-3580112 TTCTCCTTGTAGAGATCTCTTGG - Intronic
1023454785 7:40326582-40326604 AACTCTTTGTAGAACTTTTTCGG + Intronic
1026798718 7:73383459-73383481 AACTCCTTGTAGATGTATGTTGG - Intergenic
1029010547 7:97257140-97257162 TAAGCCTTCTAGAACTTTGTGGG - Intergenic
1029178736 7:98684056-98684078 TACACATTGTGGAATTCTGTAGG - Intergenic
1036865418 8:12392246-12392268 TACTCCCAGTGGAACACTGTGGG - Intergenic
1037651828 8:20846006-20846028 TAATCCTTTTAGAACTCAGAAGG - Intergenic
1037902103 8:22694443-22694465 TCCTCCTTCTGGAACTCTGGCGG - Intergenic
1040297744 8:46169183-46169205 TATTCTTTGTAGACCTCAGTGGG + Intergenic
1040888409 8:52290063-52290085 TACACCTGGTACAACTCTGGTGG + Intronic
1043269671 8:78316074-78316096 ATATCCTTGTAGAGCTCTGTGGG - Intergenic
1043725190 8:83602230-83602252 TACTGCCTCTAGACCTCTGTGGG + Intergenic
1048076482 8:131077114-131077136 TACTTCTTTTATAAGTCTGTTGG - Intergenic
1049486869 8:142869800-142869822 TTATCCTTGAAGAGCTCTGTGGG - Intronic
1050120523 9:2302757-2302779 TACTCATTGTTTAACTTTGTTGG - Intergenic
1051465102 9:17368210-17368232 TACTCCCTGTAGGACTGTGGTGG + Intronic
1055281625 9:74680983-74681005 TTCTTCTTGTAGACCCCTGTAGG + Intronic
1057225417 9:93290467-93290489 GGCTCCTTCTAGAACTCAGTAGG - Intronic
1060465318 9:123899001-123899023 TAAGCCTTGTAGAATGCTGTTGG - Intronic
1061433693 9:130547295-130547317 CACTCCTTCTAGCACTCTCTGGG + Intergenic
1189573498 X:42324963-42324985 TACTGCTTGTTCAACGCTGTGGG + Intergenic
1190327540 X:49215966-49215988 TACTCATTGTGGGGCTCTGTGGG - Intronic
1194095784 X:89636995-89637017 TACTCCCTGTAGGACTGTGGTGG + Intergenic
1196006273 X:110840768-110840790 TTTTCCTGGTAGAACTCTCTTGG + Intergenic
1196216405 X:113057368-113057390 GACTCTTTGTAGAACTCATTAGG + Intergenic
1196697619 X:118630381-118630403 TACTCCTTGTAGAACTCTGTCGG - Exonic
1197158732 X:123299421-123299443 TTCTCCTTGTAGAGATCTTTTGG + Intronic
1197555083 X:127943319-127943341 TTCTCATTGTAGAGCTTTGTTGG - Intergenic
1198597424 X:138251790-138251812 ACCTCCAAGTAGAACTCTGTAGG + Intergenic
1198747080 X:139901725-139901747 TACTCATTGTTGGACTTTGTGGG - Intronic